QseB mediates biofilm formation and invasion in Salmonella enterica serovar Typhi

Microbial Pathogenesis 104 (2017) 6e11

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

QseB mediates biofilm formation and invasion in Salmonella enterica serovar Typhi Ying Ji 1, Wenliang Li 1, Ying Zhang, Long Chen, Yiquan Zhang, Xueming Zheng, Xinxiang Huang, Bin Ni* School of Medicine, Jiangsu University, Zhenjiang, 212013, Jiangsu, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 October 2016 Received in revised form 23 December 2016 Accepted 2 January 2017 Available online 3 January 2017

QseB is a response regulator of the QseBC two-component system (TCS) which is associated with quorum sensing and functions as a global regulator of flagella, biofilm formation, and virulence. The function of QseB and its interaction with QseC has been the subject of study in some organisms, however, little work was done in Salmonella enterica serovar Typhi (S. Typhi). The objective of this study was to investigate the effect of QseB on biofilm formation and virulence in S. Typhi. It showed that the biofilm formation ability of qseC mutant was limited as compared to the wild type strain. We also show overexpression of qseB was in a qseC mutant. Interestingly, deletion of qseB in a qseC mutant restored a wild type phenotype. These results suggested that QseB may account for the impaired biofilm formation in the absence of QseC. Furthermore, deletion of qseB in wild type cells decreased biofilm formation, whereas overexpression of qseB in wild type cells increased biofilm formation. Quantitative real-time PCR also revealed the up-regulation of some fimbria-associated genes in a qseB overexpression strain. These results indicate that QseB may enhance biofilm formation in the presence of QseC. Taken together, we hypothesize that QseB has dual regulatory functions which are dependent upon its cognate sensor. Additionally, invasion of HeLa cells was enhanced in qseB mutant but attenuated in a qseC mutant compared with wild-type. The b-galactosidase activity of invF::lacZ was increased in qseB mutant but decreased in qseC mutant which was consistent with invasion results. In conclusion, QseB may have dual regulatory functions concerning biofilm formation and plays a negative role in virulence of S. Typhi. © 2017 Elsevier Ltd. All rights reserved.

Keywords: QseB Salmonella enterica serovar Typhi Biofilm Virulence

1. Introduction Two-component systems (TCS) are prevalent in bacterial signal transduction and gene expression regulation [1]. TCS consist of a histidine protein kinase (HK) which is located on the cell membrane, and a cytosolic response regulator (RR) [2]. In most cases, when subjected to external stimulation, the HK component receives signals and activates via self phosphorylation at a conserved histidine residue. The phosphoryl group is then transferred to a conserved aspartate residue on its cognate RR [3]. The activated response regulator then typically binds to DNA sequences to

* Corresponding author. E-mail addresses: [email protected] (Y. Ji), [email protected] (W. Li), [email protected] (Y. Zhang), [email protected] (L. Chen), [email protected] (Y. Zhang), [email protected] (X. Zheng), 512139595@ qq.com (X. Huang), [email protected] (B. Ni). 1 Equal Contributors. http://dx.doi.org/10.1016/j.micpath.2017.01.010 0882-4010/© 2017 Elsevier Ltd. All rights reserved.

promote or inhibit the expression of target genes. Research has revealed that the Salmonella enterica serovar Typhi (S. Typhi) histidine kinase QseC contains a dual function, able to both phosphorylate and dephosphorylate the response regulator QseB [2,4]. However, in recent years, a growing number of studies suggest that QseB can be activated by non-cognate sensors in the absence of QseC and there is a complex and strong cross-talk among QseBC and other TCSs [3]. The response regulator QseB to play a role in growth, motility, biofilm formation and virulence for several organisms [5,6], although the specific target genes and regulatory mechanisms may be quite different between species. In E. coli, it was reported that QseB regulates bacterial flagella and motility by directly binding to the high or low affinity binding site of the flhDC promoter which codes the flagellar master regulator FlhDC [7]. Later, it was also confirmed that QseB has a dual regulatory function as it binds to different sites in the target promoter according to its phosphorylation state, subsequently inhibiting or promoting gene expression

Y. Ji et al. / Microbial Pathogenesis 104 (2017) 6e11

[8]. In UPEC and S. Typhimurium [9e12], QseB is shown to be a negative regulator of bacterial motility, and a qseB mutant does not affect flagellar gene expression. However, in the absence of QseC, qseB is over-expressed and non-phosphorylated QseB is increased, resulting in downregulation of flagella, pili and cilia genes. On the contrary, in Edwardsiella tarda (E. tarda) [13], both qseB and qseC mutants show weaker motility than wild type, which can be restored by complementation. In contrast, within Aeromonas hydrophila (A. hydrophila) [14], qseB deletion can lead to a decrease of qseC transcription such that it is undetectable via RT-PCR. S. Typhi is a human pathogen and can cause inflammation of the gastrointestinal tract, severe sepsis, or systemic infection [15]. S. Typhi has a similar genomic sequence to S. Typhimurium, such that the homolog of qseBC in a wild-type strain of S. Typhi shares nearly 99% identity with that of S. Typhimurium, but the pathogenicity of these two strains are quite different. Previously, work regarding QseBC TCS function in S. Typhi revealed that QseC downregulates a series of invasion-associated genes in the presence of glucose and the regulation is not dependent on QseB [16]. However, what role QseB plays in the metabolism and invasion of S. Typhi is still unknown. By studying the possible regulatory mechanism of QseBC TCS, we have found QseB RR may have dual regulatory functions regarding biofilm formation that are dependent on whether QseC is present or not. These findings may suppress S. Typhi invasion in epithelial cells. 2. Materials and methods 2.1. Bacterial strains and culture media The wild-type (WT) strain S. Typhi GIFU10007 [17] was used as the parent strain to generate all mutants generated in this study. The qseB, qseC and qseBC mutants were prepared by homologous recombination with the suicide plasmid pGMB151 according to a previously described method [18]. To obtain the qseB complement strain, the coding sequence of qseB was cloned into pBAD/gIII (Invitrogen) using NcoI and BglII restriction sites, resulting plasmid pQseB, then the recombinant plasmid was introduced into qseB mutant. The qseC complement strain was created in the same way. The wild type containing vector pBAD/gIII or pQseB was also prepared similarly. All constructs were verified by PCR and DNA sequencing. Unless otherwise indicated, bacteria were incubated at 37  C in Luria-Bertani (LB) broth with shaking (250 rpm). For the biofilm formation assay, bacterial cells were grown in trypticase soy broth (TSB). The complemented strains were induced by L-arabinose (0.2% w/v). When necessary, ampicillin was added to the medium at a final concentration of 100 mg/mL. 2.2. Biofilm formation assay Strains culturing in TSB at 37  C were grown overnight and then were diluted 1:100 in fresh TSB and incubated with shaking. When AOD600 of bacteria reached to 0.4, L-arabinose was added to WT/ pBAD and WT/pQseB strains to induce gene expression for 30 min. Other strains continued growth until AOD600 reached to 0.6. After that, 200 ml of each bacterial suspension was transferred to a sterile 96-well round-bottom microtiter plate. Blank controls were filled with 200 ml of sterile TSB. After static culture at 30  C for 96 h, planktonic cells were carefully removed. After the plate was gently washed twice with phosphate-buffered saline (PBS), the adherent biofilm of each well was fixed with 250 ml of methanol for 10 min and then stained with 300 ml of 1% (w/v) crystal violet for 10 min. Then the unbound dye was removed and the wells were washed with PBS three times. The stained biomass was dissolved with

7

200 ml 30% (v/v) acetic acid after air drying. The mean OD value of the sterile negative controls was subtracted from each test value to obtain the ‘true’ biofilm level. The experiment was repeated independently three times. 2.3. RNA extraction and quantitative real-time PCR (qRT-PCR) The strains were cultured under the above conditions. When Larabinose was added to the plasmid-carrying strains for 30 min or the AOD600 of other strains reached to 0.5, bacteria was collected by centrifugation at 10,000 g, 4  C for 2 min and RNA was isolated using TRIzol reagent (Invitrogen). The extracted RNA was treated with RNase-free DNase I (TaKaRa) to eliminate DNA contamination. The concentration of cDNA in all samples was detected using a ND1000 Spectrophotometer (NanoDrop Technologies). 4 mg of the purified RNA was reverse transcribed to cDNA by PrimeScript Reverse Transcriptase (TaKaRa) with gene-specific reverse primers according to protocol. Quantification of cDNA was carried out using SYBR Premix Ex Taq II (TaKaRa) with corresponding primers and monitored with a C1000 Thermal Cycler (Bio-Rad) according to instructions. Primer sequences are listed in Table 1. Each experiment was performed with three independent samples. 2.4. Assay of bacterial invasion in HeLa cells HeLa cells were grown in RPMI 1640 medium with 10% heatinactivated fetal bovine serum at 37  C in 5% CO2. Cells were seeded at 2.5  105 cells per well in 24-well tissue-culture plates for 24 h before infection. Bacteria cultured overnight in LB was diluted 1:100 with fresh LB and incubated at 37  C with shaking (250 rpm). When grown to log phase (OD600 0.4e0.6), bacteria was added to HeLa cells at a MOI of 20. Plates were incubated at 37  C in 5% (v/v) CO2 for 90 min, the supernatant was removed and then each well was rinsed three times with PBS. Some cells were lysed by addition of 1 mL 0.5% (v/v) Triton per well at 37  C in 5% (v/v) CO2 for 10 min and then all liquid of each well was collected and centrifuged at 5000 g for 20 min. The sediment was resuspended using PBS and plated onto LB agar, incubated at 37  C overnight. After that, bacteria colonies were counted to evaluate the level of bacterial adhesion (T0). The remaining cells from the 24-well plate were incubated for a further 90 min with 1 mL gentamicin (100 mg/mL) to kill extracellular bacteria. Cell lysis and colony counts proceeded as

Table 1 Primers used in this study. Name

Sequence (5′ to 3′)

Primers used for real-time PCR analyses 5s-qF 5s-qR csgD- qF csgD- qR fimA- qF fimA- qR bssR- qF bssR- qR fimY- qF fimY- qR pilP- qF pilP- qR stcB- qF stcB- qR stgD- qF stgD- qR Primers used for b-Galactosidase InvF- qF InvF- qR

TTGTCTGGCGGCAGTAGC TTTGATGCCTGGCAGTTC TCAGCCGGTTGCATTGTT AATCCGCTGACCACGTGT GAGCGGCGGTACTATTCA ACCGCCAGCAAATTAGTG ATTGCGAAAAGCGAAGGG AGGTCGGACAATCATGGT GCTGGGCGTTTTTTTGTC TGGATCAGCCGAAGAAAG TTTCCCCGGTAACAGCGT ACTGGTCGTGGGCACATT TGGTCAGCAGATCAAAAT CCAATCCTCTGAAAACTG CGGAATGTTGGATGAGAA CGGCAGAAAAAGTCAATG assays CTAGTCGACCAATACTATTTGCGTTGG CTAGAATTCGTCTCCTGATACTGGTGC

8

Y. Ji et al. / Microbial Pathogenesis 104 (2017) 6e11

above. The bacteria colonies were counted to assess the level of bacterial invasion (T90). The ratio of T0 to T90 represents the bacterial invasiveness. 2.5. b-Galactosidase assay The invF promoter region was amplified by PCR (the primer sequences are shown in Table 1) and cloned into pHRP309 [19], a promoterless b-galactosidase reporter vector. The reconstructed reporter plasmid was introduced into WT, DqseB and DqseC by electroporation. LB plate containing gentamicin was used to screen for transform ants. The transcription level of the invF gene was estimated from the activity of b-galactosidase. Bacteria cultured overnight in LB containing gentamicin were diluted 1:100 with fresh LB and incubated at 37  C with shaking (250 rpm). When grown to log phase (OD600 0.4e0.6), the cultures were assayed for b-galactosidase activity, as described previously [20]. 3. Results 3.1. QseB may play a dual role on biofilm formation in S. Typhi Previous work has revealed that the decreased motility of S. Typhi observed when qseC is deleted could be due to negative regulation of QseB [16]. To further characterize the role of QseB in S. Typhi, we studied bacterial biofilm formation in the low nutrient medium TSB. Bacteria were stained with crystal violet culture for

96 h in 96 well plate, and a purple circle adhering to the polystyrene wall at the air-liquid interface of the culture was observed, indicative of biofilm formation. The stained biomass was dissolved with 30% acetic acid and OD570 was measured to quantify biofilm formation (Fig. 1). As shown in Fig. 1a and b, the biofilm forming abilities of DqseB and DqseC were both significantly weaker than WT, meanwhile, the biofilm formation of complement strains DqseB/pQseB and DqseC/pQseC increased to wild type levels. Interestingly, deletion of qseB in a qseC mutant restored the trend to wild type as well. These results indicated that the decrease of biofilm formation of DqseC could be due to negative regulation of QseB via QseC. To further explore the role of QseB in biofilm formation, QseB was overexpressed in the strain WT/pQseB revealed a nearly 2 fold increase of biofilm in WT/pQseB in comparison to the control strain (WT/pBAD), as shown in Fig. 1c and d. Consistent with this, deletion of qseB in WT weakened biofilm formation, further indicating that QseB may promote biofilm formation. Taken together, we can infer that QseB may play a dual role on biofilm formation in S. Typhi.

3.2. QseB may have dual regulatory functions to biofilm related genes in a QseC-dependent way In order to confirm the above results and to further study the downstream regulation pathways of the response regulator QseB, transcript levels of relevant genes were studied by RT-PCR. Specified genes include the major biofilm activator csgd [21], fimA

Fig. 1. Biofilm formation assay of S. Typhi. a, c Biofilms were stained with crystal violet and dissolved with 30% acetic acid in 96-well round-bottom microtiter plate. The strain WT/ pBAD was used as a control. b, d Quantitation of biomass was measured using OD570. Experiments were repeated three times in triplicate. ***, P < 0.001, determined by two-tailed unpaired Student t-test. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Y. Ji et al. / Microbial Pathogenesis 104 (2017) 6e11

(coding the major type 1 pili subunit), fimY (coding fimbriae Y protein), bssR (biofilm formation regulatory protein), pilP (coding pilus assembly protein), stcB (coding fimbrial chaperone protein) and stgD (coding fimbrial protein). These transcript levels were detected by real-time RT-PCR in WT, DqseB and DqseC. Except for csgd and fimA, fimbriae-related genes showed no significant changes in the three strains. The transcription level of csgd and fimA are decreased in DqseC but DqseB remained comparable with WT (Fig. 2a). In previous studies, constitutively high qseB transcription has been observed in DqseC (data not shown), which was confirmed in other strains [5]. These results indicated that in DqseC, the overexpression of qseB may cause negative regulation in biofilm related genes. It is strange that there is no difference in DqseB compared with wild type strains, seemingly inconsistent with the observed biofilm phenotype. We speculate that there may be other unknown genes involved in the regulation of biofilm in DqseB. We also detected the expression levels of these genes in a qseB overexpression strain (Fig. 2b). Unlike DqseC, there were no significant difference of either csgD or fimA transcript levels between WT/pQseB and the control stain, while expression of pilP, stcB and stgD increased 5-fold, 14-fold, and 3-fold, respectively in WT/pQseB compared with the control. The encoding product of pilP was suggested to be required for pilus assembly which takes part in biofilm formation [22]. From the results above, we propose a hypothesis wherein the overexpression of QseB can up-regulate the biofilm related genes in the presence of QseC and down-regulate the major biofilm activator without its cognate sensor. 3.3. QseB attenuates the invasion of epithelial cells in S. Typhi through SPI-1 Next we investigated the influence of QseB on the invasion of

9

HeLa cells by S. Typhi WT, DqseB and DqseC. There was a decrease in HeLa cell invasion by DqseC but a slightly increase in DqseB invasion when compared to WT (Fig. 3a). Since HeLa cell invasion is an SPI1-dependent phenotype, the promoter of the SPI-1 gene invF was fused to lacZ and the expression of invF was measured by the bgalactosidase activity of invF::LacZ (Fig. 3b). Results indicate that transcription of invF was repressed in DqseC but activated in DqseB, consistent with the results of HeLa cell invasion. Considering the overexpression of qseB in the absence of qseC, the repression of invF transcription in DqseC provides further evidence that QseB can attenuate the invasion of epithelial cells by S. Typhi. 4. Discussion Our results showed that biofilm formation was weakened upon deletion of qseC. The significant reduction of biofilm formation and high expression of qseB in DqseC is consistent with previous studies conducted in multiple strains. It has been proposed that QseB can be activated in a QseC-independent way, possibly through interaction with non-cognate sensors like PmrB [3]. PmrB-mediated phosphorylation of QseB is similar to QseC-mediated phosphorylation, though the PmrB-mediated dephosphorylation is much less efficient than the corresponding QseC process. Without QseC, the overabundance of unphosphorylated QseB results in misregulation of down-stream genes. However, the biofilm forming ability of DqseB in S. Typhi was also reduced, which is inconsistent with other reports in which deletion of qseB has no significant impact on biofilm biomass. We hypothesize that QseB in S. Typhi may play a dual role in regulation of biofilm related genes according to its phosphorylation state in a QseC-dependent way. In the presence of QseC, QseB plays a normal function, promoting biofilm formation to some degree. Without QseC, the abnormal activation of QseB takes

Fig. 2. Expression of biofilm associated genes (csgd, fimA, bssR, fimY, pilP, stcB and stgD) as determined by qRT-PCR. a RNA was extracted from WT, DqseB and DqseC after growth to OD600 0.6 TSB. b RNA was extracted from WT, DqseB and DqseC after growth to OD600 0.4 and induction by L-arabinose for 30 min in TSB. Strain WT/pBAD was used as a control. 5S rRNA was used as the internal reference. The data are the mean of three independent experiments done in duplicate. The error bars indicate the standard deviation. ***, P < 0.001; **, P < 0.001, determined by two-tailed unpaired Student t-test.

10

Y. Ji et al. / Microbial Pathogenesis 104 (2017) 6e11

Fig. 3. QseB regulation of S. Typhi invasion of epithelial cells and SPI-1 gene invF. a Interaction of WT, DqseB and DqseC strains with HeLa cells. The bacterial invasiveness was investigated by comparing the number of bacteria at 90 min (T90) with the number at 0 min (T0). *, P < 0.05, determined by two-tailed unpaired Student t-test. b b-galactosidase assays were performed in multicopy using invF::lacZ promoter fusions in WT, DqseB and DqseC grown at 37  C to an OD600 of 0.6. *, P < 0.05, determined by two-tailed unpaired Student t-test.

a negative role in epithelial cell invasion. The latter has a more serious and direct impact on the biofilm. In S. Typhi, QseBC is a global regulator of virulence genes [23,24]. Expression of SPI-1, sifA and SPI-3 all decreased in a qseC mutant, and epithelial cell invasion was also weakened as compared to wild type. As a sensor, QseC is able to sense AI-3, Epi, and NE [25] signals. In the liver and spleen of signal-deficient mice, expression of sipA, sopB, and mgtB were all down regulated, which indicates that during bacterial infection, host signal molecules are able to activate the transcription of S. Typhi virulence genes. When qseC is deficient, S. Typhi is unable to sense the signal molecules, and transcription of virulence factors is down regulated. This may be the reason of the decline in bacterial invasion. However, the enhancement of invasion in DqseB has not been reported in previous works. This may be due to the differences in experimental methods, and also may be attributed to the differences and complexity of QseBC regulation among various bacteria species. Further studies are needed to investigate survival within macrophages, and the expression of other relevant virulence genes, such as sifA, sopB, mgtB, and sipA. We have preliminarily demonstrated that QseB, the response regulater of two-component system QseBC, may have dual regulatory functions in regards to biofilm formation and virulence of S. Typhi. However, the direct or indirect mechanism of QseB on

related genes and the role of QseB phosphorylation in the regulation of the downstream genes requires further investigation. Acknowledgments We thank Dr. Logan Nickels (University of Pennsylvania) for helpful suggestions and polishing of the manuscript. This work was supported by grants from National Natural Science Foundation of China (31300122) and the Natural Science Foundation of Jiangsu Province (BK20130497, BK20130504). References [1] J.A. Hoch, Two-component and phosphorelay signal transduction, Curr. Opin. Microbiol. 3 (2000) 165e170. http://www.ncbi.nlm.nih.gov/pubmed/ 10745001. [2] A.M. Stock, V.L. Robinson, P.N. Goudreau, Two-component signal transduction, Annu. Rev. Biochem. 69 (2000) 183e215, http://dx.doi.org/10.1146/ annurev.biochem.69.1.183. [3] K.R. Guckes, M. Kostakioti, E.J. Breland, A.P. Gu, C.L. Shaffer, C.R. Martinez 3rd, S.J. Hultgren, M. Hadjifrangiskou, Strong cross-system interactions drive the activation of the QseB response regulator in the absence of its cognate sensor, Proc. Natl. Acad. Sci. U. S. A. 110 (2013) 16592e16597, http://dx.doi.org/ 10.1073/pnas.1315320110. [4] M. Goulian, Two-component signaling circuit structure and properties, Curr. Opin. Microbiol. 13 (2010) 184e189, http://dx.doi.org/10.1016/

Y. Ji et al. / Microbial Pathogenesis 104 (2017) 6e11 j.mib.2010.01.009. [5] W.A. Weigel, D.R. Demuth, QseBC, a two component bacterial adrenergic receptor and global regulator of virulence in Enterobacteriaceae and Pasteurellaceae, Mol. Oral Microbiol. 31 (5) (2016 Oct) 379e397, http://dx.doi.org/ 10.1111/omi.12138. Epub 2015 Nov 20. [6] V.K. Sharma, T.A. Casey, Determining the relative contribution and hierarchy of hha and qseBC in the regulation of flagellar motility of Escherichia coli O157:H7, PLoS One 9 (2014) e85866, http://dx.doi.org/10.1371/ journal.pone.0085866. [7] M.B. Clarke, V. Sperandio, Transcriptional regulation of flhDC by QseBC and sigma (FliA) in enterohaemorrhagic Escherichia coli, Mol. Microbiol. 57 (2005) 1734e1749, http://dx.doi.org/10.1111/j.1365-2958.2005.04792.x. [8] D.T. Hughes, M.B. Clarke, K. Yamamoto, D.A. Rasko, V. Sperandio, The QseC adrenergic signaling cascade in Enterohemorrhagic E. coli (EHEC), PLoS Pathog. 5 (2009) e1000553, http://dx.doi.org/10.1371/journal.ppat.1000553. [9] B.L. Bearson, S.M. Bearson, The role of the QseC quorum-sensing sensor kinase in colonization and norepinephrine-enhanced motility of Salmonella enterica serovar Typhimurium, Microb. Pathog. 44 (2008) 271e278, http://dx.doi.org/ 10.1016/j.micpath.2007.10.001. [10] M. Merighi, A.N. Septer, A. Carroll-Portillo, A. Bhatiya, S. Porwollik, M. McClelland, J.S. Gunn, Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium, BMC Microbiol. 9 (2009) 42, http://dx.doi.org/10.1186/1471-2180-9-42. [11] C.G. Moreira, D. Weinshenker, V. Sperandio, QseC mediates Salmonella enterica serovar typhimurium virulence in vitro and in vivo, Infect. Immun. 78 (2010) 914e926, http://dx.doi.org/10.1128/IAI.01038-09. [12] B.L. Bearson, S.M. Bearson, I.S. Lee, B.W. Brunelle, The Salmonella enterica serovar Typhimurium QseB response regulator negatively regulates bacterial motility and swine colonization in the absence of the QseC sensor kinase, Microb. Pathog. 48 (2010) 214e219, http://dx.doi.org/10.1016/ j.micpath.2010.03.005. [13] X. Wang, Q. Wang, M. Yang, J. Xiao, Q. Liu, H. Wu, Y. Zhang, QseBC controls flagellar motility, fimbrial hemagglutination and intracellular virulence in fish pathogen Edwardsiella tarda, Fish. Shellfish Immunol. 30 (2011) 944e953, http://dx.doi.org/10.1016/j.fsi.2011.01.019. [14] E.V. Kozlova, B.K. Khajanchi, V.L. Popov, J. Wen, A.K. Chopra, Impact of QseBC system in c-di-GMP-dependent quorum sensing regulatory network in a clinical isolate SSU of Aeromonas hydrophila, Microb. Pathog. 53 (2012) 115e124, http://dx.doi.org/10.1016/j.micpath.2012.05.008. [15] C.M. Parry, T.T. Hien, G. Dougan, N.J. White, J.J. Farrar, Typhoid fever, N. Engl. J.

11

Med. 347 (2002) 1770e1782, http://dx.doi.org/10.1056/NEJMra020201. [16] Z. Luo, M. Wang, H. Du, T. Yang, F. Wang, B. Ni, S. Xu, X. Huang, The putative sensor kinase QseC of Salmonella enterica serovar Typhi can promote invasion in the presence of glucose, Food Res. Int. 45 (2012) 1004e1010. http://dx.doi. org/10.1016/j.foodres.2011.01.019. [17] S. Kohbata, H. Yokoyama, E. Yabuuchi, Cytopathogenic effect of Salmonella typhi GIFU 10007 on M cells of murine ileal Peyer's patches in ligated ileal loops: an ultrastructural study, Microbiol. Immunol. 30 (1986) 1225e1237. http://www.ncbi.nlm.nih.gov/pubmed/3553868. [18] H. Du, M. Wang, Z. Luo, B. Ni, F. Wang, Y. Meng, S. Xu, X. Huang, Coregulation of gene expression by sigma factors RpoE and RpoS in Salmonella enterica serovar Typhi during hyperosmotic stress, Curr. Microbiol. 62 (2011) 1483e1489, http://dx.doi.org/10.1007/s00284-011-9890-8. [19] R.E. Parales, C.S. Harwood, Construction and use of a new broad-host-range lacZ transcriptional fusion vector, pHRP309, for Gram bacteria, Gene 133 (1993) 23e30. http://dx.doi.org/10.1016/0378-1119(93)90220-W. [20] M. JH, Experiment 48 Assay of b-Galactosidase, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1972. [21] I. Ahmad, S. Lamprokostopoulou, A. Fau - Le Guyon, E. Le Guyon, S. Fau Streck, M. Streck, E. Fau - Barthel, V. Barthel, M. Fau - Peters, W.-D. Peters, V. Fau - Hardt, U. Hardt Wd Fau - Romling, U. Romling, P.L. One, Complex c-diGMP signaling networks mediate transition between virulence properties and biofilm formation in Salmonella enterica serovar Typhimurium, 2011 doi:D NLM: PMC3229569 EDAT- 2011/12/14 06:00 MHDA- 2012/07/21 06:00 CRDT- 2011/12/14 06:00 PHST- 2011/03/25 [received] PHST- 2011/11/07 [accepted] PHST- 2011/12/02 [epublish] AID - 10.1371/journal.pone.0028351 [doi] AID - PONE-D-11e05496 [pii] PST - ppublish. [22] M. Pohlschroder, R.N. Esquivel, M. Front, Archaeal Type IV Pili and Their Involvement in Biofilm Formation, 2015 doi:D - NLM: PMC4371748 OTO NOTNLM. [23] K. Kutsukake, Y. Ohya, T. Iino, Transcriptional analysis of the flagellar regulon of Salmonella typhimurium, J. Bacteriol. 172 (1990) 741e747. http://www. ncbi.nlm.nih.gov/pubmed/2404955. [24] K. Kutsukake, T. Iino, Role of the FliA-FlgM regulatory system on the transcriptional control of the flagellar regulon and flagellar formation in Salmonella typhimurium, J. Bacteriol. 176 (1994) 3598e3605. http://www.ncbi.nlm. nih.gov/pubmed/8206838. [25] M.B. Clarke, D.T. Hughes, C. Zhu, E.C. Boedeker, V. Sperandio, The QseC sensor kinase: a bacterial adrenergic receptor, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 10420e10425, http://dx.doi.org/10.1073/pnas.0604343103.