Quantification of Giardia transcripts during in vitro excystation: Interest for the estimation of cyst viability

water research 43 (2009) 2728–2738

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/watres

Quantification of Giardia transcripts during in vitro excystation: Interest for the estimation of cyst viability Isabelle Bertranda,*, Me´linda Mauxb,c, Karim Helmia, Lucien Hoffmanna, Janine Schwartzbrodb, Henry-Michel Cauchiea a

Centre de Recherche Public – Gabriel Lippmann, Department of Environment and Agro-biotechnologies (EVA), 41 rue du Brill, L-4422 Belvaux, Luxembourg b Laboratory of Physical Chemistry and Microbiology for the Environment (LCPME), UMR 7564 CNRS Nancy Universite´, Faculte´ de Pharmacie, 5 rue Albert Lebrun, F-54001 Nancy Cedex, France c De´partement Eaux & Environnement, Institut Pasteur de Lille, 1 rue Professeur Calmette, BP 245, F-59019 Lille Cedex, France

article info

abstract

Article history:

The aim of the present study was to evaluate the potential of transcript quantification

Received 12 November 2008

as an indicator of Giardia cyst viability. The variations of b-giardin, EF1A and ADHE mRNAs

Received in revised form

were quantified during excystation by real-time RT-PCR assays and compared with the

11 March 2009

percentages of viability estimated using propidium iodide staining and in vitro excystation.

Accepted 14 March 2009

The first experiments were performed with purified G. duodenalis assemblage B cysts. When

Published online 25 March 2009

55% of excysting protozoa were observed, the increase of the selected transcripts ranged from 0.40  0.13 to 0.97  0.11 log10 after 1 h of incubation in excystation medium. Purified

Keywords:

cysts were also stored at 4  C for up to 56 days and analysed at several sampling times.

Giardia

Significant correlations were observed between the variations of the selected mRNAs

Viability

and the percentages of viability estimated with staining and excystation methods. Among

mRNA

the three transcripts, b-giardin appeared to be the most appropriate to study the viability of

In vitro excystation

Giardia cysts concentrated from wastewater samples.

Propidium iodide

ª 2009 Published by Elsevier Ltd.

Wastewater

1.

Introduction

The intestinal parasite Giardia duodenalis is a common cause of waterborne and foodborne illnesses throughout the world (Slifko et al., 2000; Savioli et al., 2006; Yoder and Beach, 2007). The protozoan Giardia has two life stages: the cyst and the trophozoite. Among the methods available for the estimation of cyst viability, animal infectivity is the only method allowing a direct measure of the capacity of cysts to cause infection (Labatiuk et al., 1991). Animal infectivity and in vitro excystation have been used to study either cyst survival in

environmental water samples or the effect of disinfectants and UV light (Jarroll et al., 1988; Johnson et al., 1997; Olson et al., 1999; Mofidi et al., 2002; Widmer et al., 2002). During in vitro excystation, Giardia cysts are exposed to media mimicking the physiological conditions observed in the stomach and upper small intestine of their hosts. Animal model and in vitro excystation need relatively high numbers of Giardia cysts (Sauch et al., 1991) and in vitro excystation is considered to be subjective due to the presence of partially emerged trophozoites (Labatiuk et al., 1991). At present, the combination of fluorogenic vital dyes staining (e.g. propidium

* Corresponding author. LCPME, UMR 7564 CNRS Nancy Universite´, Faculte´ de Pharmacie, 5 rue Albert Lebrun, BP 80403, F-54 001 Nancy Cedex, France. Tel.: þ33 (0)3 8368 2292; fax: þ33 (0)3 8368 2301. E-mail address: [email protected] (I. Bertrand). 0043-1354/$ – see front matter ª 2009 Published by Elsevier Ltd. doi:10.1016/j.watres.2009.03.028

water research 43 (2009) 2728–2738

iodide) with immunofluorescence assay (IFA) is the conventional method used to detect and to estimate the viability of cysts in environmental samples (Dowd and Pillai, 1997; Thiriat et al., 1998). However, an overestimation of viability or a lack of correlation has been previously observed when vital dye staining was compared with in vitro excystation and the animal model (deRegnier et al., 1989; Labatiuk et al., 1991). Many studies have highlighted the interest of molecular techniques for the detection or the genotyping of Giardia duodenalis cysts in clinical and environmental samples (Amar et al., 2002; Caccio et al., 2003; Sulaiman et al., 2004). Few studies have evaluated mRNA as a target to distinguish live from dead cysts. Mahbubani et al. (1991) observed an increase of the structural protein giardin mRNA in live cysts during in vitro excystation. Abbaszadegan et al. (1997) detected heat shock protein (HSP) 70 transcript in viable cysts only after an induction step at 42  C for 15 min. These studies were based on qualitative RT-PCR which relies on endpoint measurements, whereas real-time RT-PCR allows the quantification of the initial amount of mRNA in each sample. Several studies have reported the use of real-time (RT)-PCR, for the quantification of microorganisms (Amar et al., 2003; Guy et al., 2003; Verweij et al., 2004). Fontaine and Guillot have studied the stability of 18S rRNA and rDNA in heat inactivated Cryptosporidium oocysts by using real-time RT-PCR. The authors observed that rRNA was less stable than rDNA, but remained detectable after 4 h at 95  C. These results suggest that the presence of 18S rRNA may not be associated with oocysts viability. In order to avoid an overestimation of viability using the FISH method, Smith et al. (2004) proposed to perform a treatment based on nuclease in recently heat inactivated oocysts. To date, no study has been published about either the real-time quantification of mRNAs during excystation of Giardia cysts or the quantification of mRNAs as an early indicator of viability. The purpose of the present work was to quantify the variations of three transcripts during in vitro excystation in order to evaluate the potential of such a method for the estimation of Giardia cysts viability. Three real-time RT-PCR assays were developed for the specific quantification of b-giardin, EF1A (elongation factor 1 alpha) and ADHE (alcohol dehydrogenase E) transcripts. Giardins form a family of structural proteins considered to be unique to this protozoan parasite (Faubert, 2000; Caccio et al., 2002). EF1A is involved in the GTP-dependent binding of aminoacyl-tRNAs to the site A of the ribosomes in the second step of translation from mRNAs to proteins (Kapp and Lorsch, 2004). ADHE belongs to the bifunctional enzyme aldehyde/alcohol dehydrogenase (ALDH/ADHE) which catalyses the two reactions allowing acetyl-CoA to be reduced to acetaldehyde and then to ethanol (Sanchez, 1998). First, the transcripts were monitored during in vitro excystation performed with highly and freshly purified G. duodenalis assemblage B cysts passed through gerbils. Secondly, highly purified cysts belonging to the same strain were stored at þ4  C for up to 56 days and transcripts were quantified during in vitro excystations performed at different sampling times. The expression profiles of b-giardin, EF1A and ADHE mRNAs were then compared with the percentages of viability observed with excystation and propidium iodide staining methods. The last experiment of this study was performed with Giardia cysts concentrated from wastewater

2729

samples in order to study a population of Giardia cysts which had not been previously passed through gerbils or maintained in axenic culture. Moreover, this last experiment was performed to obtain a first evaluation of mRNAs quantification as a potential tool for the analysis of environmental Giardia cysts.

2.

Materials and methods

2.1.

Purified microorganisms

Purified G. duodenalis assemblage B cysts (strain H-3 passed through gerbils) were obtained from Waterborne Inc. (New Orleans, LA). Prior to delivery, cysts were 95–99% purified by sucrose and Percoll gradients and water washes, then stored in PBS (pH 7.4) with antibiotics and Tween 20. Other protozoa and bacteria were included in this work for the evaluation of the oligonucleotides specificity: G. duodenalis assemblages A, C and E cysts previously purified from human faeces, dog faeces and slaughterhouse wastewater (Bertrand and Schwartzbrod, 2007), G. muris (Waterborne Inc.), Cryptosporidium parvum oocysts (INRA, Institut National de la Recherche Agronomique, Nouzilly, France), Toxoplasma gondii (CHU, Nancy, France), Entamoeba histolytica, Entamoeba dispar (Institut de Parasitologie, Strasbourg, France), Campylobacter jejuni (ATCC 29428; CHU Nancy, France), Salmonella enterica Serovar Typhimurium WG49 and Escherichia coli K12Hfr.

2.2.

Environmental cysts

Four wastewater samples (2 L) were collected from the influent of the wastewater treatment plant located in Schifflange, Luxembourg (capacity: 90,000 inhabitant equivalents) and stored at 4  C. The concentration and purification of Giardia cysts were performed within 24 h. The concentration step of Giardia cysts was achieved by centrifugation. For each water sample, 600 mL were centrifuged twice at 1500  g for 20 min with a swinging bucket rotor. The supernatants were discarded and the pellet was used for Percoll-sucrose flotation (specific gravity: 1.10) (Bertrand et al., 2004). Each wastewater sample was divided in six aliquots conserved at 4  C prior to in vitro excystation procedure or immunofluorescence assays combined with propidium iodide staining.

2.3. Immunofluorescence assay combined with propidium iodide staining The fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody (A100FLK Aqua-Glo G/C Direct, Waterborne) and propidium iodide (PI, Sigma) were used in the staining procedure. One hundred microliters of sample, 40 mL of monoclonal antibody solution and 10 mL (1 mg mL1) of PI were mixed and incubated at 37  C for 40 min. PBS (850 mL) was then added. After a centrifugation step at 6000  g for 1 min, the supernatant (900 mL) was discarded. The examinations were performed on 10 mL aliquots placed between slides at 200 magnification using a fluorescence microscope (Thiriat et al., 1998). From 200 to 300 cysts were examined for each sample. The PI enters and stains the DNA of cysts whose wall is compromised (Schupp and Erlandsen, 1987).

2730

2.4.

water research 43 (2009) 2728–2738

In vitro excystation

In vitro excystation was performed in two phases as previously described (Bingham and Meyer, 1979). During phase I, 0.1 mL of cyst suspension was added to 1 mL of a pepsin-acid solution (25 mM NaHCO3, 12 mM KCl, 40 mM NaCl, 6 mM CaCl2, 1500 units mL1 pepsine [Sigma], final pH adjusted to 2.0 with HCl [1 M]) and incubated at 37  C for 1 h (Buchel et al., 1987). The suspension was then centrifuged at 800  g for 3 min and the supernatant (1 mL) was discarded. Two washing steps were applied on the pellet with PBS warmed at 37  C. During phase II, the pellet was suspended in 1 mL of TYI-S-33 medium supplemented with bovine bile (Keister, 1983; Clark and Diamond, 2002) and maintained at 37  C. Percentage of excystation was determined by counting the number of intact cysts, partially excysted cysts, and totally excysted cysts with a Nageotte counting chamber and applying the formula of Bingham et al. (1979). From 200 to 300 protozoa were examined for each sample. The samples used for the quantification of transcripts were washed once with PBS and stored at 80  C prior to nucleic acids extraction.

2.5.

Nucleic acids extraction

DNA extraction was carried out with the QIAamp DNA stool kit (Qiagen) and the carrier RNA (Qiagen) as previously described (Bertrand and Schwartzbrod, 2007). The extracted DNA was immediately stored at 80  C. The QIAamp DNA stool kit (Qiagen) followed by the QIAamp Viral RNA kit (Qiagen) were used for the extraction of RNA. To estimate the sensitivity of real-time RT-PCR assays, ranges of dilution 1:10 (V/V) in PBS pH 7.2 were carried out prior to RNA extraction. Cyst wall lysis (95  C, 10 min) and adsorption of impurities on InhibitEx resin were achieved with QIAamp DNA stool kit. The RNA extraction was then carried on with QIAamp Viral RNA kit following the protocol proposed by the supplier. A DNase treatment (RNase free DNase set, Qiagen) was performed on the column after the first washing step carried out with buffer AW1. The extracted RNA was immediately stored at 80  C.

2.6.

Primers and probes

Oligonucleotides were designed against the coding regions of b-giardin, EF1A and ADHE genes using the Primer Express Oligo Design software (version 1.5, Applied Biosystems). For b-giardin, a 95-bp fragment was amplified with Giardin set: forward primer (G-for) 50 -TCTATGTTCACCTCCACCCGTAC-30 (positions 776–798 on the P1 sequence, GenBank X85958), reverse primer (G-rev) 50 -TTGCTGAGCTT GACCGCC-30 (positions 853–870 on the P1 sequence) and TaqMan probe (Gprobe) 50 -FAM TCACCCAGACGATGGA CAAGCCCTAMRA-30 (positions 801–823 on the P1 sequence). For EF1A, a 123-bp fragment was amplified with EF1A set: forward primer (GIAF2) 50 -GAGATGAYGAAGCAGCTCAAGAAC-30 (positions 341–364 on the BAH-12 sequence, GenBank AF069569) and reverse primer (GIAR1) 50 -CTCGTACCASGGCATCTTGTC-30 (positions 443–463 on the BAH-12 sequence) and TaqMan probe (EF1Aprobe) 50 -FAM TCGGCTGGAAGAAGGCCGAGG TAMRA-30 (positions 366–386 on the BAH-12 sequence). The primers

GIAF2 and GIAR1 have been previously described (Bertrand et al., 2004). For the ADHE gene, only assemblage A sequences are available on GenBank (http://www.ncbi.nlm.nih.gov/ Genbank/index.html). Thus, a conventional PCR was carried out with ADG1 and ADI2 primers (Maux et al., 2002) which allowed to amplify a 449-bp fragment for assemblage A and assemblage B. A sequencing analysis of the two fragments was then performed with BigDye Terminator v. 3.1 Cycle Sequencing kit (Applied Biosystems) and the sequences were aligned using ClustalW software (http://www.ebi.ac.uk/ ClustalW/). The primers and probe were designed using the Primer Express Oligo Design software (version 1.5). A 140-bp fragment was amplified with ADHE set: forward primer (ADHE-for) 50 -AAC GAGGCCACTGGRAARC-30 (positions 287– 305 on the WB sequence, GenBank XM_763863) and the reverse primer (ADHE-rev) 50 -TGGCKCACYTCKGTGAAG-30 (positions 409–426 on the WB sequence). The numerous variations between the two sequences required the design of an LNA probe (Locked Nucleic Acid, Eurogentec). The sequence of the LNA probe was 50 -FAM AGCGGCACTTGCAGT TAMRA-30 (position 381–395 on the WB sequence). The underlined nucleotides are nucleic acid analogues containing a bicyclic furanose unit locked in a RNA-mimicking sugar conformation (Reynisson et al., 2006). These modifications of nucleotides increase thermal duplex DNA stability and improve the specificity of probe hybridisation to its target sequence (Eurogentec). In the present study, the LNA technology allowed the design of a short probe (15 nucleotides) hybridising with assemblage A and assemblage B sequences.

2.7.

RNA reverse transcription

Reverse transcription (RT) procedure was carried out with 5 mL of extracted RNA, 1 mL of dNTPs (Invitrogen), 2 mL of reverse primer at 10 mM (Eurogentec) and 5 mL of DNase–RNase free water (Sigma). This first RT step was performed at 65  C for 5 min and immediately incubated on ice for at least 1 min. Reaction mixture consisting of 4 mL of 5 First-Strand Buffer (Invitrogen), 1 mL of 0.1 M DTT (Invitrogen), 1 mL of RNase Inhibitor (Promega) and 1 mL (200 units) of SuperScript II Reverse Transcriptase (Invitrogen) was added in reaction tube to give a final volume of 20 mL. This RT mixture was then incubated 1 h at 55  C, followed by 15 min at 70  C. The cDNA was immediately cooled at 4  C.

2.8.

Real-time quantitative PCR

Amplification reactions (50 mL) contained 5 mL of either cDNA or extracted DNA, 0.5 mM of each primer, 0.3 mM of probe, 5 mL of 10 reaction buffer, 5 mL of MgCl2 (final concentration: 5 mM), dNTPs (final concentration: 200 mM each) and HotGoldStar (final concentration: 0.025 U mL1). Reaction buffer, MgCl2, dNTPs and PCR enzyme were provided in qPCR Core kit (Eurogentec). Cycling parameters were: 2 min at 50  C, 10 min at 95  C, followed by 50 cycles of 15 s at 95  C and 60 s at 60  C, on ABI Prism (Applied Biosystems). Both positive and negative controls were included in RT-PCR to validate the results. DNase–RNase free water was used as negative control throughout. Tenfold dilution of G. duodenalis cysts (strain H-3) in purified suspensions was used to construct standard curves. The

water research 43 (2009) 2728–2738

Ct values of each dilution amplified in triplicate were plotted against the logarithm of the starting quantity of cysts. The slope (s) of the standard curve was used to determine the PCR efficiency (E ) in conformity with E ¼ 101/s  1 (Kubista et al., 2006). Thus, a standard curve with a slope of 3.32 corresponded to a reaction with an efficiency value of 100%.

2.9. Quantification of transcripts during in vitro excystation For highly purified suspensions and environmental cysts, the quantification of b-giardin, EF1A and ADHE mRNAs was performed before the excystation procedure and then after 30 min, 1, 2 and 4 h of incubation in TYI-S-33 medium maintained at 37  C. In the present work, Giardia cysts analysed before excystation procedure were considered as control cysts. The variations of transcripts during in vitro excystation are expressed in log10(Nx/N0). Nx/N0 is the ratio of the quantity of transcripts detected after x h of incubation in TYI-S-33 medium over the quantity of transcripts detected before excystation procedure.

3.

Results

3.1.

Real-time RT-PCR

The oligonucleotides specificity was first evaluated by submitting primers and probes to the BLAST test (http://www. ncbi.nlm.nih.gov/BLAST/). The results showed the specificity of the three sets for the Giardia genus. The specificity was then estimated by performing real-time PCR assays with DNAs from protozoa and bacteria. DNA extracted from G. muris, C. parvum, T. gondii, E. dispar, E. histolytica, C. jejuni, E. coli and S. enterica serovar Typhimurium was not amplified. The Giardin and EF1A sets allowed to detect the assemblages A, B, C and E belonging to G. duodenalis. Only the two major assemblages A and B were detected with the assay designed against the coding region of the ADHE gene. The sensitivity of real-time RT-PCR assays was examined by performing RT-PCR assays in triplicate with tenfold serial dilution of purified cysts (assemblage B, strain H-3). The quantities of RNA were equivalent to concentrations ranging from 10,000 to 0.01 cysts per reaction. Fig. 1 shows the standard curves obtained from the Ct values of this range of dilutions in purified suspension. For b-giardin, a linear response (r2 ¼ 0.998) was observed from 10,000 to 1 cyst per reaction for each well of the triplicates (100% of positive samples). For EF1A, a linear response (r2 ¼ 0.995) was observed from 10,000 to 10 cysts per reaction for each well of the triplicates. For ADHE, a linear response (r2 ¼ 0.985) was observed from 10,000 to 100 cysts per reaction for each well of the triplicates. Thus, the limit of detection reached 1, 10 and 100 cysts per reaction for b-giardin, EF1A and ADHE, respectively. From the slope of the standard curves, the realtime RT-PCR amplification efficiency (E ) was estimated to be 95% for b-giardin, 102% for EF1A and 76% for ADHE.

2731

3.2. Quantification of DNAs and mRNAs during in vitro excystation In vitro excystation procedure was performed with freshly and highly purified G. duodenalis assemblage B cysts (6  105 cysts mL1). Twenty-nine percent and 69% of viable protozoa were observed with excystation and PI staining methods, respectively. b-giardin, EF1A and ADHE mRNAs and DNAs were then extracted and quantified separately after 30 min, 1, 2 and 4 h of incubation in TYI-S-33 medium. b-giardin, EF1A and ADHE DNAs were quantified in triplicate during the incubation in TYI-S-33 medium (Fig. 2) in order to check that the increase of mRNAs does not originate from either parasite multiplication or from a more efficient extraction after exposure to excystation conditions. b-giardin and EF1A DNAs increased slightly after 2 h of incubation in TYI-S-33 medium, whereas ADHE did not increase. After 4 h of incubation, the increase ranged from 0.12  0.09 log10 (ADHE) to 0.23  0.05 log10 (EF1A). b-giardin, EF1A and ADHE mRNAs were quantified in triplicate during the incubation in TYI-S-33 medium (Fig. 2). For b-giardin, mRNA increased during the first 30 min of incubation to 0.47  0.01 log10. Thus, the quantity of b-giardin mRNA was three times higher after 30 min of incubation than in control cysts. Then, the quantities of b-giardin mRNA were stable during the continuation of the incubation. EF1A mRNA increased linearly during the first 2 h to 1.02  0.06 log10 and then more slightly. An increase of ADHE mRNA was observed after 2 and 4 h of incubation and reached 0.78  0.10 log10. Thus, EF1A and ADHE mRNAs were 11 and six times higher after 4 h of incubation in TYI-S-33 medium than in control cysts, respectively.

3.3. Comparison of transcripts quantification with PI staining and in vitro excystation methods Freshly and highly purified G. duodenalis assemblage B cysts were stored in PBS (6  105 cysts mL1) in the dark at 4  C for up to 56 days. The viability of cysts was monitored using in vitro excystation and PI staining methods. For freshly purified cysts (D0), 55 and 84% of viable cysts were detected using excystation and PI staining methods, respectively. The percentages of viability observed with these two methods are provided in brackets in the legend for Figs. 3–5. Excystation method concluded to an absence of viable cysts after 35 days, while the use of PI staining method showed a complete inactivation of cysts only after 56 days. A significant correlation (Pearson product moment correlation coefficient r ¼ 0.938, p-value <0.0001) has been observed between in vitro excystation and PI staining methods. b-giardin, EF1A and ADHE transcripts were quantified in cysts stored at 4  C and used as control during excystation procedures. After 42 days of storage, the transcripts decreased slightly in cysts to 0.15  0.03 log10 for b-giardin, 0.16  0.02 log10 for EF1A and 0.22  0.04 log10 for ADHE. The variations of b-giardin, EF1A and ADHE transcripts were quantified during the excystation procedures performed with the cysts before storage (D0) and with the cysts stored 7, 14, 28 and 42 days (D7–D42) at 4  C. Real-time RT-PCR assays were carried out in triplicate in control cysts and after 30 min,

2732

water research 43 (2009) 2728–2738

45 β-giardin

EF1A

ADHE

Threshold cycle (Ct)

40 ADHE slope: -4.07 Y-interception: 48.73 squared correlation coefficient: 0.985

35

EF1A slope:-3.27 Y-interception:39.08 squared correlation coefficient: 0.995

30

β-giardin slope:- 3.43 Y-interception: 37.05 squared correlation coefficient: 0.998

25

20 1,0E-01

1,0E+00

1,0E+01

1,0E+02

1,0E+03

1,0E+04

1,0E+05

1,0E+06

1,0E+07

Starting quantity Fig. 1 – Standard curves generated from G. duodenalis cysts in purified suspensions for b-giardin, EF1A and ADHE targets.

1, 2 and 4 h of incubation in TYI-S-33 medium (Figs. 3–5). By using freshly purified cysts and cysts stored until 14 days (D7, D14), an increase of the transcripts was observed during the incubation in TYI-S-33 medium. For b-giardin (Fig. 3), the highest increase were observed after 1 h of incubation and ranged from 0.50  0.05 log10 (D7) to 0.85  0.06 log10 (D0). For EF1A (Fig. 4), mRNA increased continuously during the incubation in excystation medium and the increase ranged from 0.90  0.04 log10 (D14) to 1.54  0.12 log10 for (D0) after 4 h of incubation. For ADHE (Fig. 5), an increase of mRNA was observed between 1 and 4 h of incubation and ranged from 0.75  0.16 log10 (D14) to 1.28  0.10 log10 (D0) after 4 h of incubation. By using cysts stored 28 days, a decrease of the three transcripts was observed after 30 min of incubation and an increase was then observed between 1 and 4 h of incubation. Nevertheless, the quantity of b-giardin was lower than those obtained for control cysts after 4 h of incubation (0.11  0.02 log10). After 4 h of incubation, the value of ADHE mRNA was similar to those observed for control cysts as the increase reached 0.14  0.15 log10, whereas the increase of EF1A reached 0.40  0.01 log10. After 42 days of storage, the transcripts decreased continuously during the excystation procedure, the decrease ranged between 0.67  0.05 log10 (EF1A) and 1.40  0.12 log10 (b-giardin) after 4 h of incubation. Thus, b-giardin, EF1A and ADHE mRNAs increased during excystation by using cysts stored until 14 days at 4  C. In these samples, the percentages of viable cysts varied from 25 to 55% and from 64 to 84% by using excystation and PI staining methods, respectively. After 28 days of storage, only EF1A mRNA quantification resulted in higher values than those obtained in control cysts, while the viability of cysts reached 6 and 39% with the excystation and PI staining methods, respectively. After 42 days of storage, the quantities of transcripts decreased continuously during the incubation in TYI-S-33 medium and no excysting protozoan was observed with excystation procedure, whereas 25% of the cysts were still viable according to the PI staining method. For each time of incubation in TYI-S-33 medium (30 min, 1, 2 and 4 h), the

variations of the transcripts in the protozoa stored from 0 to 42 days were plotted against the percentages of viability. The Pearson product moment correlation coefficients (r) ranged from 0.725 ( p-value ¼ 0.02) to 0.834 ( p-value ¼ 0.0001) and from 0.846 ( p-value <0.0001) to 0.901 ( p-value <0.0001) when the variations of the transcripts were compared with the excystation and PI staining methods, respectively. Thus, a significant correlation was shown between the variations of b-giardin, EF1A and ADHE transcripts and the viability of cysts estimated with these two methods.

3.4.

Environmental cysts

The quantification of b-giardin, EF1A and ADHE mRNAs during excystation was then performed in triplicate using Giardia cysts concentrated from four wastewater samples (EC1–EC4). The numerous debris contained in these wastewater samples did not allow to estimate the percentage of viability obtained with the in vitro excystation procedure. The concentration and the viability of cysts were determined using the immunofluorescence assay combined with PI staining. The concentrations of Giardia cysts detected with the immunofluorescence assay ranged from 5.9  103 cysts L1 (EC3) to 1.8  104 cysts L1 (EC2) and the percentages of viable cysts were between 65 and 71% with PI staining method. The percentages of viability estimated with PI staining method are provided in brackets in the legend for Figs. 6 and 7. The variations of b-giardin mRNA observed with environmental cysts (Fig. 6) were very similar to those obtained with purified assemblage B cysts whose percentages of viability ranged from 24 to 26% with the excystation method and from 64 to 70% with the PI staining method. For these four samples, the highest increases of b-giardin mRNA were observed after 1 h of incubation in TYI-S-33 medium and ranged from 0.48  0.11 to 1.13  0.32 log10. For EF1A mRNA (Fig. 7), only two wastewater samples (EC3 and EC4) showed relatively similar results to those observed with the purified assemblage B samples containing 26 and 64% of viable cysts with

2733

water research 43 (2009) 2728–2738

2,0 1,5

Log10 (Nx/N0)

1,0 0,5 0,0 0

0,5

1

2

1,5

2,5

3

3,5

4

4,5

-0,5

Incubation in TYI-S-33 medium : Time (h) -1,0 -1,5 -2,0 β-giardin DNA

EF1A DNA

ADHE DNA

β-giardin mRNA

EF1A mRNA

ADHE mRNA

Fig. 2 – Variations of b-giardin, EF1A and ADHE DNAs and mRNAs during in vitro excystation performed with purified cysts.

excystation and PI staining methods, respectively. The results obtained for the two other samples (EC1 and EC2) were similar to those obtained with the purified samples containing 6 and 39% of viable cysts with excystation and PI staining methods, respectively. No amplification of ADHE mRNA was observed before and during the excystation procedures by using cysts concentrated from wastewater samples.

4.

wastewater samples. The aim of this work was to estimate the interest of transcripts quantification as an indicator of Giardia cysts viability. The variations of the selected mRNAs were compared with the percentages of viability observed with the excystation and PI staining methods. Prior to the quantification of transcripts during excystation, the specificity and the sensitivity of the real-time RT-PCR assays were evaluated. The specificity of primers and probes was evaluated by BLAST tests and real-time PCR. Primers and probes appeared to be specific for G. duodenalis species. The sensitivity of the assays, evaluated with mRNA extracted from purified cysts, reached 1, 10 and 100 cysts per reaction for bgiardin, EF1A and ADHE sets, respectively. Mahbubani et al. (1991) detected b-giardin mRNA to the equivalent of one cyst per reaction. In the present work, a sensitivity of 400 and 4000 cysts L1 of wastewater could be reached for b-giardin

Discussion

In the present study, real-time RT-PCR assays allowing rapid and specific quantification of b-giardin, EF1A and ADHE transcripts were developed in order to study their variations during in vitro excystation performed with highly purified Giardia duodenalis cysts and then with cysts concentrated from 2,0 1,5

Log10 (Nx/N0)

1,0 0,5 0,0 0

0,5

1

1,5

2

2,5

3

3,5

4

4,5

-0,5 -1,0 Incubation in TYI-S-33 medium: time (h)

-1,5 -2,0 D0 (55

; 84 )

D7 (24

; 70 )

D14 (26

; 64 )

D28 (6

; 39 )

D42 (0

; 25 )

Fig. 3 – Variations of b-giardin mRNA during in vitro excystation performed with purified cysts stored 0, 7, 14, 28 and 42 days at D4 8C. The percentage of viable cysts observed with in vitro excystation and PI staining methods are indicated in brackets.

2734

water research 43 (2009) 2728–2738

2,0

1,5

Log10(Nx/N0)

1,0

0,5

0,0 0,5

0

1

1,5

2

2,5

3

3,5

4

4,5

-0,5

Incubation in TYI-S-33 medium : Time (h) -1,0

-1,5

-2,0 D0 (55

; 84 )

D7 (24

; 70 )

D14 (26

; 64 )

D28 (6

; 39 )

D42 (0

; 25 )

Fig. 4 – Variations of EF1A mRNA during in vitro excystation performed with purified cysts stored 0, 7, 14, 28 and 42 days at D4 8C. The percentages of viable cysts observed with in vitro excystation and PI staining methods are indicated in brackets.

and EF1A transcripts, respectively. The concentrations of this protozoan frequently range between 1000 and 10,000 cysts L1 of wastewater (Guy et al., 2003; Ottoson et al., 2006). Thus, the real-time RT-PCR assays developed in this study should be relevant to quantify the variations of b-giardin and EF1A transcripts in environmental samples. On the other hand, the low sensitivity of the real-time RT-PCR assay developed for ADHE mRNA did not allow performing experiments with cysts concentrated from wastewater samples. Although ADHE mRNA has been already amplified in trophozoites (Nino and Wasserman, 2003), the presence of this transcript had not

been demonstrated in cysts before the present study. The lack of ADHE mRNA amplification in the previous published study might be due to the low expression level of this metabolic enzyme during the cyst stage. Nino and Wasserman (2003) indeed performed conventional RT-PCR assay on 20 ng of total RNA extracted from cysts while we needed at least 100 cysts to obtain an amplification curve. b-giardin, EF1A and ADHE transcripts were then quantified during in vitro excystation procedures performed with freshly and highly purified G. duodenalis assemblage B cysts. Not all Giardia may excyst in the artificial conditions used to mimic

2,0 1,5

Log10 (Nx/N0)

1,0 0,5 0,0 0

0,5

1

1,5

22

2,5

3

3,5

4

4,5

-0,5 -1,0

Incubation in TYI-S-33 medium : time (h)

-1,5 -2,0 D0 (55

; 84 )

D7 (24

; 70 )

D14 (26

; 64 )

D28 (6

; 39 )

D42 (0

; 25 )

Fig. 5 – Variations of ADHE mRNA during in vitro excystation performed with purified cysts stored 0, 7, 14, 28 and 42 days at D4 8C. The percentages of viable cysts observed with in vitro excystation and PI staining methods are indicated in brackets.

2735

water research 43 (2009) 2728–2738

2,0 1,5

Log10 (Nx/N0)

1,0 0,5 0,0 0

0,5

1

1,5

2

2,5

3

3,5

4

4,5

-0,5

Incubation in TYI-S-33 medium: Time (h) -1,0 -1,5 -2,0 EC1 (70 )

EC2 (65 )

EC3 (71 )

EC4 (67 )

Fig. 6 – Variations of b-giardin mRNA during in vitro excystation performed with cysts concentrated from wastewaters. The percentages of viable cysts observed with PI staining method are indicated in brackets.

the gastro-intestinal tract, thus 29 and 55% of excysted protozoa were obtained during these experiments. These results are in agreement with previous studies reporting percentages of excystation ranging from 30 to 67% (Buchel et al., 1987; Mahbubani et al., 1991; Nino and Wasserman, 2003; Hernandez and Wasserman, 2006). In the present study, the variations of transcripts depended on the target and the percentage of excystation. For b-giardin mRNA, the highest increases were observed during the first hour of incubation. Thus, the quantities of b-giardin mRNA were 2.8 to seven times higher after 1 h in TYI-S-33 medium than in control cysts. For EF1A, a continuous increase of mRNA was observed during the incubation in TYI-S-33 medium. The quantities detected for this transcript were 11–34 times higher after 4 h of incubation than in control cysts. The highest increases of ADHE mRNA were observed after 2 and 4 h of incubation in TYI-S-33 medium and the quantities were six to 19 times higher after 4 h of incubation than in control cysts. DNA was also quantified during excystation in order to check that the variations of transcripts were not due either to

a multiplication of trophozoites or to a more efficient extraction of nucleic acids after exposure to excystation conditions. No increase of the DNAs was observed after 1 h of incubation and the quantities were only 1.4–1.7 times higher after 4 h of incubation than in control cysts. In a previous study, Bernander et al. (2001) showed that the newly excysted cell (excyzoite) contains four nuclei (cellular ploidy 16N: 4  4N) and divides into two trophozoites with a cellular ploidy of 8N (2  4N). These two cells divide again into two trophozoites with a ploidy of 4N (2  2N). By using flow cytometry, an increase of the 8N peak was observed 4 h after the beginning of the excystation. Thus, each viable cyst resulted in four trophozoites without any replication of DNA after 4 h of incubation in the excystation medium. By using G. duodenalis trophozoites belonging to assemblage B, Karanis and Ey (1998) observed a generation time (or doubling time) of 18 h to more than 20 h in axenic cultures. Thus, in the present study, the increase of b-giardin, EF1A and ADHE transcripts during the incubation in TYI-S-33 medium seemed to be due to the modification of the metabolism of this protozoan.

2,0 1,5

Log10 (Nx/N0)

1,0 0,5 0,0 0

1

2

3

4

-0,5

Incubation in TYI-S-33 medium: time (h) -1,0 -1,5 -2,0 EC1 (70 )

EC2 (65 )

EC3 (71 )

EC4 (67 )

Fig. 7 – Variations of EF1A mRNA during in vitro excystation performed with cysts concentrated from wastewaters. The percentages of viable cysts observed with PI staining method are indicated in brackets.

2736

water research 43 (2009) 2728–2738

The variations of b-giardin, EF1A and ADHE transcripts were also quantified during in vitro excystation carried out with purified assemblage B cysts stored at 4  C. The stability of these three mRNAs in control cysts stored 42 days at 4  C confirmed that the presence of mRNA could not be used as an indicator of viability. By using cysts stored 7 and 14 days, an increase of these mRNAs was observed during the incubation in TYI-S-33 medium. For these samples, 24–26% of excysting protozoa were observed and the variations of mRNAs were in agreement with the freshly purified cysts showing an excystation of 29%. When the excystation procedure was performed with cysts stored 28 days at 4  C, the results varied according to the transcript, since a slight increase was observed only for EF1A mRNA. After 42 days at 4  C, the three transcripts decreased continuously during the excystation procedure, but were still detected after 4 h of incubation in the TYI-S-33 medium. Fontaine and Guillot (2003) have observed a degradation of 18S rRNA in Cryptosporidium oocysts reaching 2 log10 after 4 h of incubation at 95  C. In the present study, the incubation at 37  C during the excystation procedure might have enhanced the activity of the degradative RNases enzymes. For each time of incubation in TYI-S-33 medium (30 min, 1, 2 and 4 h), the variations of the three transcripts were plotted against the percentages of viability estimated with either excystation or staining method. The statistical analysis showed a significant correlation between the variations of the transcripts and the viability of Giardia cysts. In the present work, Giardia cysts concentrated from wastewater samples (n ¼ 4) were also used in order to study mRNAs variations in a larger population of protozoa which had not been passed through animal or maintained in culture. Previous studies have shown that in vivo and in vitro multiplication may lead to a selection of the assemblages (Andrews et al., 1992; Karanis and Ey, 1998). By using cysts concentrated from wastewater, the numerous particles contained in the samples did not allow to estimate the percentage of excysting protozoa, whereas PI staining showed percentages of viability ranging from 65 to 70%. Among the three selected transcripts, the variations of b-giardin mRNA observed with the four wastewater samples were very similar to those obtained with highly purified samples containing from 24 to 26% of viable cysts with the excystation method and from 64 to 70% of viable cysts with PI staining method. For EF1A mRNA, similar results were obtained between environmental and purified cysts for two samples. From these results, b-giardin mRNA appeared to be the most appropriate target to evaluate the viability of Giardia cysts from environmental water samples which contain several genotypes and species of Giardia cysts, as well as numerous particles and PCR inhibitors. At present, PI staining is considered to be a rapid and inexpensive method for the analysis of samples which contain low numbers of Giardia cysts. However, our results obtained with cysts in purified suspensions showed that the PI staining method resulted in highest percentages of viability. Although 25% of viable cysts were detected with the PI staining method, no increase of these mRNAs was observed during the excystation procedure. An overestimation of viability has been previously observed when PI staining was compared with in vitro excystation by using either cysts purified from faecal samples (Smith and Smith, 1989) or cysts treated with

chlorine or monochloramine (Sauch et al., 1991). Only cells with a compromised wall are stained by PI (Schupp and Erlandsen, 1987), but an intact cyst wall might be insufficient to induce an infection in the host. On the other hand, the variations of b-giardin, EF1A and ADHE mRNAs were in agreement with the excystation method, since these transcripts did not increase when no excysting protozoan was detected. Finally, the quantification of mRNAs could be performed with cysts concentrated from wastewater samples. This work provides the first results about the real-time quantification of transcripts during the excystation process and shows the potential interest of this method in the estimation of the viability of Giardia cysts. Thus, the quantification of mRNAs during the excystation procedure allowed to evaluate the viability of Giardia cysts, but above all it did not overestimate the viability of cysts and could be performed with environmental samples, especially by targeting b-giardin mRNA. The results obtained with wastewater samples could be improved by the evaluation of new targets allowing a more sensitive detection of mRNAs variations. Thus, ferredoxin oxidoreductase (PFOR), acetyl-CoA synthetase (ACS), thiolase and reductase mRNAs appear or increase during in vitro excystation (Nino and Wasserman, 2003; Hernandez and Wasserman, 2006), but sequencing analysis are needed to allow the development of new RT-PCR assays against these targets. The comparison of a larger series of transcripts, the analysis of environmental and clinical samples, as well as the evaluation of viability after disinfection treatment (chlorination, UV light) could lead to the development and the validation of new procedures based on mRNAs quantification for the estimation of Giardia cysts viability.

5.

Conclusions

 b-giardin, EF1A and ADHE transcripts increased during in vitro excystation procedures performed with viable cysts. The variations of the selected transcripts correlated significantly with the percentages of viability observed with in vitro excystation and PI staining methods.  The PI staining method resulted in the highest percentages of viability and might overestimate the viability of Giardia cysts. Thus, the selected mRNAs did not increase and no excysting protozoan was observed after 42 days of storage at 4  C, whereas 25% of cysts were still viable according to the staining method.  In vitro excystation could not be performed with wastewater samples. On the other hand, the real-time RT-PCR method allowed to quantify the variations of transcripts in such complex environmental samples. b-giardin mRNA appeared to be the most appropriate target to study the viability of environmental cysts.

Acknowledgements This work was funded by the FNR (National Research Found) from Luxembourg (SECAL Program, KAWA project, FNR/03/07/ 07) and by the Ministe`re de la Culture, de l’Enseignement

water research 43 (2009) 2728–2738

Supe´rieur et de la Recherche du Grand-Duche´ du Luxembourg (BFR06/013). We thank Laurent Solinhac for his technical assistance in sequencing analysis.

references

Abbaszadegan, M., Huber, M.S., Gerba, C.P., Pepper, I.L., 1997. Detection of viable Giardia cysts by amplification of heat shock-induced mRNA. Applied and Environmental Microbiology 63, 324–328. Amar, C.F., Dear, P.H., Pedraza-Diaz, S., Looker, N., Linnane, E., McLauchlin, J., 2002. Sensitive PCR-restriction fragment length polymorphism assay for detection and genotyping of Giardia duodenalis in human feces. Journal of Clinical Microbiology 40 (2), 446–452. Amar, C.F., Dear, P.H., McLauchlin, J., 2003. Detection and genotyping by real-time PCR/RFLP analyses of Giardia duodenalis from human faeces. Journal of Medical Microbiology 52, 681–683. Andrews, R.H., Chilton, N.B., Mayrhofer, G., 1992. Selection of specific genotypes of Giardia intestinalis by growth in vitro and in vivo. Parasitology 105, 375–386. Bernander, R., Palm, J.E., Svard, S.G., 2001. Genome ploidy in different stages of the Giardia lamblia life cycle. Cellular Microbiology 3 (1), 55–62. Bertrand, I., Schwartzbrod, J., 2007. Detection and genotyping of Giardia duodenalis in wastewater: relation between assemblages and faecal contamination origin. Water Research 41, 3675–3682. Bertrand, I., Gantzer, C., Chesnot, T., Schwartzbrod, J., 2004. Improved specificity for Giardia lamblia cyst quantification in wastewater by development of a real-time PCR method. Journal of Microbiological Methods 57, 41–53. Bingham, A.K., Meyer, E.A., 1979. Giardia excystation can be induced in vitro in acidic solutions. Nature 277 (5694), 301–302. Bingham, A.K., Jarroll Jr., E.L., Meyer, E.A., Radulescu, S., 1979. Giardia sp.: physical factors of excystation in vitro, and excystation vs eosin exclusion as determinants of viability. Experimental Parasitology 47, 284–291. Buchel, L.A., Gorenflot, A., Chochillon, C., Savel, J., Gobert, J.G., 1987. In vitro excystation of Giardia from humans: a scanning electron microscopy study. Journal of Parasitology 73, 487–493. Caccio, S.M., De Giacomo, M., Pozio, E., 2002. Sequence analysis of the beta-giardin gene and development of a polymerase chain reaction-restriction fragment length polymorphism assay to genotype Giardia duodenalis cysts from human faecal samples. International Journal for Parasitology 32, 1023–1030. Caccio, S.M., De Giacomo, M., Aulicino, F.A., Pozio, E., 2003. Giardia cysts in wastewater treatment plants in Italy. Applied and Environmental Microbiology 69 (6), 3393–3398. Clark, C.G., Diamond, L.S., 2002. Methods for cultivation of luminal parasitic protists of clinical importance. Clinical Microbiology Reviews 15, 329–341. deRegnier, D.P., Cole, L., Schupp, D.G., Erlandsen, S.L., 1989. Viability of Giardia cysts suspended in lake, river, and tap water. Applied and Environmental Microbiology 55 (5), 1223–1229. Dowd, S.E., Pillai, S.D., 1997. A rapid viability assay for Cryptosporidium oocysts and Giardia cysts for use in conjunction with indirect fluorescent antibody detection. Canadian Journal of Microbiology 43, 658–662. Faubert, G., 2000. Immune response to Giardia duodenalis. Clinical Microbiology Reviews 13 (1), 35–54. Fontaine, M., Guillot, E., 2003. Study of 18S rRNA and rDNA stability by real-time RT-PCR in heat-inactivated Cryptosporidium parvum oocysts. FEMS Microbiology Letters 226, 237–243.

2737

Guy, R.A., Payment, P., Krull, U.J., Horgen, P.A., 2003. Real-time PCR for quantification of Giardia and Cryptosporidium in environmental water samples and sewage. Applied and Environmental Microbiology 69 (9), 5178–5185. Hernandez, P.C., Wasserman, M., 2006. Do genes from the cholesterol synthesis pathway exist and express in Giardia intestinalis? Parasitology Research 98, 194–199. Jarroll, E.L., Manning, P., Lindmark, D.G., Coggins, J.R., Erlandsen, S.L., 1988. Effect of disinfectants on Giardia cysts. CRC Critical Reviews in Environmental Control 18, 1–28. Johnson, D.C., Enriquez, C.E., Pepper, I.L., Davis, T.L., Gerba, C.P., Rose, J.B., 1997. Survival of Giardia, Cryptosporidium, poliovirus and Salmonella in marine waters. Water Science and Technology 35 (11–12), 261–268. Kapp, L.D., Lorsch, J.R., 2004. The molecular mechanics of eukaryotic translation. Annual Review of Biochemistry 73, 657–704. Karanis, P., Ey, P.L., 1998. Characterization of axenic isolates of Giardia intestinalis established from humans and animals in Germany. Parasitology Research 84, 442–449. Keister, D.B., 1983. Axenic culture of Giardia lamblia in TYI-S-33 medium supplemented with bile. Transactions of the Royal Society of Tropical Medicine and Hygiene 77, 487–488. Kubista, M., Andrade, J.M., Bengtsson, M., Forootan, A., Jonak, J., Lind, K., Sindelka, R., Sjoback, R., Sjogreen, B., Strombom, L., Stahlberg, A., Zoric, N., 2006. The real-time polymerase chain reaction. Molecular Aspects of Medicine 27 (2–3), 95–125. Labatiuk, C.W., Schaeffer III, F.W., Finch, G.R., Belosevic, M., 1991. Comparison of animal infectivity, excystation, and fluorogenic dye as measures of Giardia muris cyst inactivation by ozone. Applied and Environmental Microbiology 57 (11), 3187–3192. Mahbubani, M.H., Bej, A.K., Perlin, M., Schaefer 3rd, F.W., Jakubowski, W., Atlas, R.M., 1991. Detection of Giardia cysts by using the polymerase chain reaction and distinguishing live from dead cysts. Applied Environmental Microbiology 57 (12), 3456–3461. Maux, M., Bertrand, I., Gantzer, C., Schwartzbrod, J., 2002. Estimating Giardia cyst viability using RT-PCR. Water Science Technology. Water Supply 2, 107–114. Mofidi, A.A., Meyer, E.A., Wallis, P.M., Chou, C.I., Meyer, B.P., Ramalingam, S., Coffey, B.M., 2002. The effect of UV light on the inactivation of Giardia lamblia and Giardia muris cysts as determined by animal infectivity assay (P-2951-01). Water Research 36, 2098–2108. Nino, C.A., Wasserman, M., 2003. Transcription of metabolic enzyme genes during the excystation of Giardia lamblia. Parasitology International 52, 291–298. Olson, M.E., Goh, J., Phillips, M., Guselle, N., McAllister, T.A., 1999. Giardia cyst and Cryptosporidium oocyst survival in water, soil, and cattle feces. Journal of Environmental Quality 28, 1991–1996. Ottoson, J., Hansen, A., Bjorlenius, B., Norder, H., Stenstrom, T.A., 2006. Removal of viruses, parasitic protozoa and microbial indicators in conventional and membrane processes in a wastewater pilot plant. Water Research 40, 1449–1457. Reynisson, E., Josefen, M.H., Krause, M., Hoorfar, J., 2006. Evaluation of probe chemistries and platforms to improve the detection limit of real-time PCR. Journal of Microbiological Methods 66, 206–216. Sanchez, L.B., 1998. Aldehyde dehydrogenase (CoA-acetylating) and the mechanism of ethanol formation in the amitochondriate protist, Giardia lamblia. Archives of Biochemistry and Biophysics 354, 57–64. Sauch, J.F., Flanigan, D., Galvin, M.L., Berman, D., Jakubowski, W., 1991. Propidium iodide as an indicator of Giardia cyst viability. Applied and Environmental Microbiology 57 (11), 3243–3247. Savioli, L., Smith, H., Thompson, A., 2006. Giardia and Cryptosporidium join the ‘neglected disease initiative’. Trends in Parasitology 22, 203–208. Schupp, D.G., Erlandsen, S.L., 1987. A new method to determine Giardia cysts viability: correlation of fluorescein diacetate and

2738

water research 43 (2009) 2728–2738

propidium iodide staining with animal infectivity. Applied and Environmental Microbiology 53 (4), 704–707. Slifko, T.R., Smith, H.V., Rose, J.B., 2000. Emerging parasite zoonoses associated with water and food. International Journal for Parasitology 30, 1379–1393. Smith, A.L., Smith, H.V., 1989. A comparison of fluorescein diacetate and propidium iodide staining and in vitro excystation for determining Giardia intestinalis cyst viability. Parasitology 99, 329–331. Smith, J.J., Gunasekera, T.S., Barardi, C.R.M., Veal, D., Vesey, G., 2004. Determination of Cryptosporidium parvum oocyst viability by fluorescence in situ hybridization using a ribosomal RNA-directed probe. Journal of Applied Microbiology 96, 409–417. Sulaiman, I.M., Jiang, J., Singh, A., Xiao, L., 2004. Distribution of Giardia duodenalis genotypes and subgenotypes in raw urban wastewater in Milwaukee, Wisconsin. Applied and Environmental Microbiology 70 (6), 3776–3780.

Thiriat, L., Sidaner, F., Schwartzbrod, J., 1998. Determination of Giardia cyst viability in environmental and faecal samples by immunofluorescence, fluorogenic dye staining and differential interference contrast microscopy. Letters in Applied Microbiology 26, 237–242. Verweij, J.J., Blange, R.A., Templeton, K., Schinkel, J., Brienen, E.A., van Rooyen, M.A., van Lieshout, L., Polderman, A.M., 2004. Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. Journal of Clinical Microbiology 42, 1220–1223. Widmer, G., Clancy, T., Ward, H.D., Miller, D., Batzer, G.M., Pearon, C.B., Bukhari, Z., 2002. Structural and biochemical alterations in Giardia lamblia cysts exposed to ozone. Journal of Parasitology 88, 1100–1106. Yoder, J.S., Beach, M.J., 2007. Giardiasis surveillance – United States, 2003–2005. MMWR CDC Surveillance Summaries 56 (SS07), 11–18.