Quantification of human dopamine D2s receptor interactions with G,γ, G-protein α-, β- and γ- subunit of denoted protein; D2s, dopamine receptor-‘short‘ variant subfamily 2; D2s-CL3, the third intracellular domain of D2s receptor; D2s-CL3-GST, fusion protein of D2s-CL3 and GST.i, 1,2- and Gαo-proteins

NEUROCHEMISTRY International Neurochem[ Int[ 22 "0887# 160Ð164

Quanti_cation of human dopamine D1s receptor interactions with Gai\0\1! and Gao!proteins Miljan Simonovica\ Vukic Sos³kica\b\\ Jelena Joksimovicb a

Institute of Chemistry\ Technolo`y and Metallur`y and b Institute for Biolo`ical Research\ 00959 Bel`rade\ Yu`oslavia Received 4 February 0887^ accepted 18 April 0887

Abstract A simple and rapid in vitro method for qualitative and quantitative estimation of the Ga!subunits interaction with the third intracellular loop of human D1s dopamine receptor has been developed[ For this purpose\ D1s!CL2 was cloned in pGEX!1T vector and expressed in E[ coli BL10 DE2 as a fusion protein with glutathione!S!transferase "D1s!CL2!GST#[ The resulting soluble construct was puri_ed by a.nity chromatography on glutathione!Sepharose[ Ga!subunits were expressed and puri_ed as His!tagged proteins[ For the assay of Ga:D1s!CL2!GST interactions\ varying concentrations of pure His!tagged Ga!proteins were immobilized on His!Bind Resin and titrated with D1s!CL2!GST fusion protein[ Ga:D1s!CL2!GST interactions were quanti_ed by GST activity determination assay[ It was shown that the fusion protein interacts speci_cally with di}erent Ga proteins\ especially with Gai proteins[ Based on saturation binding analyses\ Kd values were determined revealing the highest a.nity of His!Gai\1 binding to the fusion protein[ The a.nities for Gai:D1s!CL2!GST protein interactions estimated in this way were in nanomolar range of concentrations[ Þ 0887 Elsevier Science Ltd[ All rights reserved[

0[ Introduction At least _ve di}erent dopamine receptor subtypes from the gene superfamily of G protein!coupled seven!trans! membrane domain receptors are involved in the dopa! minergic signal transduction across cellular membranes "Civelli et al[\ 0882^ Gingrich and Caron\ 0882#[ At the molecular level\ these receptors induce a variety of cell type!speci_c signals transduction pathways including the activation of Gs and Gi:Go "Senogles et al[\ 0889^ Malek et al[\ 0882# responsible for further downstream trans! duction of the dopaminergic signal in a cascade[ Interactions of the dopamine receptors with a!subunits of G!proteins were studied by several authors who employed di}erent experimental approaches "for a review see Pristupa et al[\ 0886#[ Mutagenesis analyses of intra! cellular regions "Strader et al[\ 0876^ Dixon et al[\ 0877^ O|Dowd et al[\ 0877^ Niznik et al[\ 0884# and the studies with site!speci_c peptides "Wade et al[\ 0883^ Taylor et  Corresponding author[ Tel[] 99270 00 65 33 11^ fax] 99270 00 65 03 22^ e!mail] vsoskicÝhelix[chem[bg[ac[yu Abbreviations] Gi\0\ Gi\1 and Go\ guanine nucleotide!binding proteins designated according to Gilman "0876#^ Ga\b\g\ G!protein a!\ b! and g! subunit of denoted protein^ D1s\ dopamine receptor!{{short{{ variant subfamily 1^ D1s!CL2\ the third intracellular domain of D1s receptor^ D1s!CL2!GST\ fusion protein of D1s!CL2 and GST[ 9086Ð9075:87 ,08[99 Þ 0887 Elsevier Science Ltd[ All rights reserved PII] S 9 0 8 6 Ð 9 0 7 5 " 8 7 # 9 9 9 2 0 Ð X

al[\ 0885# indicated that particularly the third intracellular loop of the D1 receptor interacts with a!subunit of het! erotrimeric G!proteins\ to stimulate e}ector systems[ Also\ it has been shown that the entire structure of the dopamine receptor molecule is not necessary for the inter! action with G proteins and short peptides containing critical amino acid sequence were found to be e}ective\ as well "Wade et al[\ 0883^ Taylor et al[\ 0885#[ This prompted us to select the third intracellular loop region of the dopamine D1 receptor rather than the intact recep! tor to study the interactions of this receptor with Ga subunits[ In the present study a simple and speci_c in vitro method qualitative and quantitative estimation of the third intracellular loop of the human D1 dopamine receptor interactions with Gai\0\1 and Gao!proteins is described[

1[ Experimental procedures 1[0[ Materials Plasmid DNA encoding the human dopamine D1 recep! tor was a generous gift of Dr O[ Civelli "Oregon Hlth[ Sci[ Univ[ Portland\ OR\ U[S[A[#[ Plasmids NpT6!4\ encoding Gai\0!His and Gao!His\ and pQE!5\ encoding

161

M[ Simonovic et al[:Neurochem[ Int[ 22 "0887# 160Ð164

Gai\1\ were kindly provided by Dr M[ Linder "Washington Univ[\ Sch[ Med[\ St[ Louis\ MO\ U[S[A[#[ The other chemicals were from the following sources] expression vector pGEX!1T\ restriction endonucleases\ T3 DNA ligase\ alkaline phosphatase and T3 poly! nucleotide kinase*Biolabs!New England^ Pfu DNA polymerase*Stratagene^ DNA!se*Boehringer^ lyso! syme*Serva^ ATP\ GDP\ GTP\ PMSF\ kanamycin and ampicillin*Sigma^ glutathione "GSH# and Na!deoxy! cholate*Merck^ His!Bind Resin*Qiagen^ CDNB* Squib!Bristol Labs^ GSH!Sepharose*Pharmacia LKB^ Bactopeptone\ yeast extract and bacto agar*Difco^ Sequenase v[1[90 kit*Amersham[ 1[0[0[ Clonin` of the third intracellular loop of dopamine D1s receptor into pGEX!1T Standard procedures were used for DNA manipulations "Sambrook et al[\ 0878#[ The third intracellular loop of human D1s dopamine receptor was ampli_ed by the poly! merase chain reaction "PCR#[ To obtain D1s!CL2 domain the following pair of primers containing plasmid DNA encoding human D1s dopamine receptor was used] N!terminus*4?CGCGGATCCAAGATCTACATTG TCCTCCGC2? and C!terminus*4?CCGGAATTCCT! GAGTGGCTTTCTTCTCCTT2?[ The PCR product was cut with BamHI and EcoRI and cloned into BamHI! Eco!RI sites of the prokaryotic expression plasmid pGEX!1T[ The resulting clones were sequenced with Sequenase v[1[90 kit to avoid introduction of errors during the PCR or subcloning[ 1[0[1[ Subclonin` of Gai\1 from pQE!5 into H5pQE!59 In order to construct Gai\1 protein with six!histidine tag at its N!terminus\ Gai\1 was subcloned from pQE!5 into H5pQE!59 as described by Lee et al[ "0883#[ 1[0[2[ Expression and puri_cation of the D1s!CL2!GST fusion protein E[ coli BL10 DE2 cells were maintained and transformed with pGEX!1T!D1s!CL2 using CaCl1!method "Sambrook et al[\ 0878#[ The cells were grown in Luria broth sup! plemented with ampicillin "_nal conc[ 099 mg:ml# at 26>C until A599 reached 9[3Ð9[5\ then the expression was induced with isopropylthiogalactoside "IPTG^ _nal conc[ 9[0 mM#\ temperature decreased to 11>C and glucose added "_nal conc[ 19 mM#[ The cells were harvested 5 h later "2999×`\ 09 min\ Sorvall SS!0 centrifuge#\ resus! pended in 039 mM NaCl\ 1[6 mM KCl\ 09 mM Na1HPO3\ 07 mM KH1PO3\ pH 6[29 "PBS^ 49 ml bu}er:ml culture# and incubated "04 min\ 14>C# with lysosyme "_nal conc[ 9[1 mg:ml# and phenyl!methylsulfonyl ~uoride "PMSF^ _nal conc[ 06 mg:l#[ After than\ Na!deoxycholate and DNA!se were introduced "_nal conc[ 0[5 mg:ml and 19 mg:ml\ respectively# and the incubation continued "04 min\ 14>C#[ The lysate was centrifuged "01\999×`\ 39 min\ Sorvall SS!0# and the supernatant loaded on GSH!

Sepharose "0[9 ml gel:l culture# equilibrated with 04 vol[ of ice!cold PBS¦0[9 mM EDTA[ Protein was eluted with 09 mM GSH\ 49 mM Tris\ pH 7[9[ The fractions containing fusion protein were pooled and dialyzed against 0[9 mM EDTA\ 09 mM Tris\ pH 7[9\ overnight\ at 3>C[ Puri_ed protein was concentrated by PEG!39999 to 0[9 mg protein:ml\ and stored at −19>C in 39) "v:v# glycerol[ 1[0[3[ 0!Chloro!1\3!dinitrobenzene "CDNB# assay for GST!fusion protein activity determination Functionality of the GST!fusion protein was determined by standard CDNB assay "Pabst et al[\ 0863#[ Protein sample\ 9[0 M CDNB solution in 69) EtOH and 9[0 M GSH "09 ml\ each#\ 0[9 M K!phosphate bu}er\ pH 5[49 "099 ml# and double distilled water "769 ml# were mixed and incubated "4 min\ 14>C#[ After that\ absorbancy was recorded at 239 nm[ 1[0[4[ Expression and puri_cation of His!Ga proteins This was done as described by Lee et al[ "0883#[ 1[0[5[ Ga!D1s!CL2!GST His!Bind Resin assays "a# Interactions of Ga!GDP form with D1s!CL2!GST[ His!Bind Resin was washed with bu}er "9[0) oval! bumin\ 09 mM Tris\ pH 6[39# by repeated centrifugation "2499×`\ 0 min\ Fisher Sci[ microfuge#[ Varying con! centrations of His!Gai\1\ Gai\0!His or Ga9!His "9[903Ð17 nM\ 9[9034Ð18 nM and 9[18Ð614 nM\ respectively# pre! pared in the same bu}er and preincubated with 0[9 mM GDP were mixed with 29 ml of His!Bind Resin[ The mixture "_nal vol[ 74 ml# was incubated "11>C\ 59 min constant shaking#\ D1s!CL2!GST solution "9[03 mM\ 74 ml# was added and the incubation continued for 59 min[ Unbound protein was removed by double washing with ice!cold 09 mM Tris!HCl\ pH 6[39[ The samples were examined by CDNB assay\ GST reaction terminated with 19 ml of 1 M HCl and the activity measured as above[ "b# Interactions of His!Gai\1!GTP form and D1s!CL2! GST "GDP!GTP exchange assay#[ Prior to assay\ varying concentrations of His!Gai\1 protein "9[903Ð17 nM# were incubated "59 min\ 26>C# with GTP solution\ pH 7[9 "_nal conc[ 0[9 mM in a vol[ of 74 ml# and further handled as under "a#[ "c# Interactions of denatured His!Gai\1! GDP form and D1s!CL2!GST[ Prior to assay\ the Ga protein was heated "04 min\ 84>C# and further processed as above[ 1[1[ Data analysis Saturation binding data were analyzed and graphically displayed by nonlinear curve _tting using the GraphPad Prism 0[92 program[ Kd values were calculated using the same program[

M[ Simonovic et al[:Neurochem[ Int[ 22 "0887# 160Ð164

162

1[2[ Miscellaneous

3[ Discussion

Protein was determined by Lowry et al[ "0840# using bovine serum albumin as a reference[ Degree of protein puri_cation was checked by SDS!polyacrylamide slab gel electrophoresis "Laemmli\ 0869#[

Di}erent strategies have been employed during the past decade in the studies of dopamine receptors functioning and signal transduction pathways "Gilman\ 0876^ Sen! ogles et al[\ 0889^ Senogles\ 0883^ Grunewald et al[\ 0885^ Richtand et al[\ 0886^ Sidhu and Kimura\ 0886^ Weiss et al[\ 0886#[ The third intracellular domain of the D1 dopamine receptor was shown to be responsible for the interaction with Gi:Go proteins "Malek et al[\ 0882# but only indirect\ time!consuming and expensive procedures for the estimation of these interactions are available so far[ This prompted us to develop a rapid and simple in vitro procedure to quantitate the interactions of D1s! CL2 and Ga!proteins\ which could be useful for rapid screening of a library of potential G!protein ligands[ For this purpose the D1s!CL2 domain was used as a model system of the entire receptor[ The third intracellular loop of the D1s receptor was cloned in pGEX!T1 plasmid and the fusion protein consisting of the third receptor loop linked to glutathione!S!transferase was expressed "D1s! CL2!GST#[ This enabled a simple puri_cation of the intracellular domain of the dopamine receptor and besides\ the product was labelled with an active enzyme\ the activity of which served to measure the extent of the interactions[ All Ga!proteins were expressed as His!tagged proteins\ Gai\1 being tagged at the N!terminus\ while Gai\0 and Gao at the C!termini[ Based on a high a.nity of poly!His tags to the Ni1¦!bound resin a solid phase system was developed to immobilize the puri_ed Ga proteins[ Our results showed that His!Gai\1 expressed the highest bind! ing a.nity for the fusion protein\ while the a.nities of ai\0!His and Ga9!His were 2!fold and 049!fold lower\ respectively[ The di}erences in binding a.nity could be ascribed to di}erent His!tag position since it has been reported by Hamm et al[ "0877# that C!terminus of Ga proteins plays a crucial role in their interaction with receptor molecules[ Although His!tagged Ga proteins are easily expressed in some bacteria a}ording the products with fully preserved functionality\ it is a matter of further research to explain in which way could His!tags in~uence the interactions of these proteins with receptor molecules[ The a.nity for the receptor was signi_cantly reduced when Gai\1 protein was o}ered GTP instead of GDP\ pointing to the speci_city of GDP!GTP exchange assay[ Thermal denaturation of His!Gai\1!GDP form that led to irreversible conformational change of Gai\1!subunit inhibited His!Gai\1:D1s!CL2!GST interactions that can be taken as the evidence that the native structure of Gai\1 is required for these interactions[ Our results\ showing that D1s dopamine receptor\ par! ticularly the third intracellular domain\ interacts speci_! cally with Gai\0\1!proteins are in accordance with the data of several authors "Senogles et al[\ 0889^ Senogles\ 0883^ Grunewald et al[\ 0885#[ Grunewald et al[ "0885# dem!

2[ Results 2[0[ Expression and puri_cation of the D1s!CL2!GST fusion protein D1s!CL2 was cloned into BamHI!Eco!RI sites of the pro! karyotic expression plasmid pGEX!1T[ Endogenous pro! tease!free E[ coli BL10 DH2 strain was used as a host[ The expression was performed at 11>C to avoid more extensive proteolytic degradation of fusion protein occur! ring at higher temperatures[ Under these conditions D1s! CL2!GST was successfully expressed and upon puri! _cation\ the fusion protein in a soluble form was obtained in the yield of 2 mg:l bacterial culture[

2[1[ Ga!D1s!CL2!GST His!Bind Resin Assays Interactions of soluble D1s!CL2 domain\ cloned and expressed as GST!fusion protein with His!Ga!proteins were measured using His!Bind Resin[ CDNB assay "Pabst et al[\ 0863# was employed to determine GST activity[ Ga!proteins were expressed as His!tagged proteins\ Gai\1 being tagged at the N!terminus\ while Gai\0 and Gao at the C!termini[ Various concentrations of Ga! proteins were immobilized on His!Bind Resin and titrated with D1s!CL2!GST fusion protein[ The results presented as saturation binding curves are shown in Fig[ 0\ graphs "a#Ð"c#[ Kd values for the interactions of D1s! CL2!GST with various His!tagged Ga!GDP proteins cal! culated from saturation binding curves are inserted in Fig[ 0\ graphs "a#Ð"c#[ As seen\ His!Gai\1 expressed the highest a.nity binding for the fusion protein\ while the a.nity of Gai\0!His and Gao!His was 2!fold and 049!fold lower\ respectively[ GDP!GTP exchange assay showed that the a.nity for the receptor was signi_cantly decreased when Ga!protein was o}ered GTP instead of GDP\ thus demonstrating the speci_city of this assay "Fig[0\ graph "a##[ Thermal denaturation of His!Gai\1!GDP form completely inhibited His!Gai\1:D1s!CL2!GST interactions "Fig[ 0\ graph "a## due to irreversible conformational change of Gai\1!subunit[ The results on the interactions of the fusion protein with the active forms of Gai\0 and Gao presented as saturation binding curves are depicted in Fig[ 0\ graphs "b# and "c#\ respectively[

163

M[ Simonovic et al[:Neurochem[ Int[ 22 "0887# 160Ð164

Fig[ 0[ Graph "a# Saturation binding curve of His!Gai\1!D1s!CL2!GST interactions[ "0# squares*native GDP form and D1s!CL2!GST^ "1# circles and full line*GDP!GTP exchange assay^ His!Gai\1!GTP form and D1s!CL2!GST^ "2# triangles and dashed line*denatured His!Gai\1 and D1s!CL2!GST[ Graph "b# Saturation binding curve of Gai\0!His!GDP form interaction with D1s!CL2!GST[ Graph "c# Saturation binding curve of Gao!His!GDP interaction with D1s!CL2!GST[ Representative curves are shown[ Kd values were calculated from saturation binding curves[ The results are the means2S[E[M[ from at least 2 experiments done in triplicate[

onstrated in baculovirus!infected Sf8 insect cells pre! ferred coupling of the intact dopamine D1s receptor to heterotrimeric Gi\0 with 1Ð3 fold higher a.nity vs Gi\1[ Opposite to that\ Senogles et al[ "0889# investigating the interactions of D1s receptor from bovine pituitary and Gi\0\1\2!proteins from bovine brain found that Gi\1 expre! ssed 09!fold higher coupling a.nity than Gi\0 and Gi\2[

Working with GH3Cl mammalian cell culture Senogles "0883# demonstrated that D1s receptor is dominantly sig! naling through Gai\1!protein[The discrepancies of these data could be ascribed to di}erences in both cell systems and experimental procedures[ Herein presented method for quantitative determination of D1s!CL2 domain inter! actions with di}erent Ga proteins strongly suggests that

M[ Simonovic et al[:Neurochem[ Int[ 22 "0887# 160Ð164

D1s receptor signals preferentially through Gi!proteins[ Further studies along this line are in progress[

Acknowledgements This work was supported by the Ministry for Science and

[# and Technology of Serbia\ contracts è 91E13 "M[S[\ V[S

[#[ è92E19 "J[J[\ V[S

References Civelli\ O[\ Bunzow\ J[ R[\ Grandy\ D[ K[\ 0882[ Molecular diversity of dopamine receptors[ Annu[ Rev[ Pharmacol[ Toxicol[ 21\ 170Ð296[ Dixon\ R[ A[\ Sigal\ I[ S[\ Strader\ C[ D[\ 0887[ StructureÐfunction analysis of the b!adrenergic receptor[ Cold Spring Harbor Symp[ Quant[ Biol[ 42\ 376Ð386[ Gilman\ A[ G[\ 0876[ G proteins] transducers of receptor!generated signals[ Annu[ Rev[ Biochem[ 45\ 504Ð538[ Gingrich\ J[ A[\ Caron\ M[G[\ 0882[ Recent advances in the molecular biology of dopamine receptors[ Annu[ Rev[ Neurosci[ 05\ 188Ð210[ Grunewald\ S[\ Reilander\ H[\ Michel\ H[\ 0885[ In vivo reconstitution of dopamine D1s receptor!mediated G protein activation in bac! ulovirus!infected insect cells] preferred coupling to Gi0 vs Gi1[ Bio! chemistry 24\ 04051Ð04062[ Hamm\ H[ E[\ Deretic\ D[\ Arendt\ A[\ Hargrave\ P[ A[\ Koenig\ B[\ Hofmann\ K[ P[\ 0877[ Site of G protein binding to rhodopsin mapped with synthetic peptides from the a!subunit[ Science 130\ 721Ð724[ Laemmli\ U[ K[\ 0869[ Cleavage of structural proteins during the assembly of the head of bacteriophage T3[ Nature 166\ 579Ð574[ Lee\ E[\ Linder\ M[ E[\ Gilman\ A[ G[\ 0883[ Expression of G protein a!subunits in E[ coli[ Meth[ Enzymol[ 126\ 035Ð053[ Lowry\ O[ H[\ Rosebrough\ N[ J[\ Farr\ A[ L[\ Randall\ R[ J[\ 0840[ Protein measurement with the Folin phenol reagent[ J[ Biol[ Chem[ 082\ 154Ð164[ Malek\ D[\ Muench\ G[\ Palm\ D[\ 0882[ Two sites in the third inner loop of the dopamine D1 receptor are involved in functional G

164

protein!mediated coupling to adenylate cyclase[ FEBS Lett[ 214\ 104Ð108[ Niznik\ H[B[\ Sunahara\ R[ K[\ Pristupa\ Z[ B[\ Jarvie\ K[ R[\ 0884[ Molekulare Grundlagen der Interaktion zwischen Dopamin! "D0:D1# Rezeptoren[ In] Gerlach\ J[ "Ed[# Schizophrenie[ Dopa! minrezeptoren und Neuroleptika[ Springer\ Berlin\ pp[ 0Ð18[ O|Dowd\ B[ F[\ Hnatowich\ M[\ Regan\ J[ W[\ Leader\ W[ M[\ Caron\ M[ G[\ Lefkowitz\ R[ J[\ 0877[ Site!directed mutagenesis of the cytoplasmic domains of the human b1!adrenergic receptor] local! ization of regions involved in G protein receptor coupling[ J[ Biol[ Chem[ 152\ 04874Ð04881[ Pabst\ M[ J[\ Habig\ W[ H[\ Jakoby\ W[ B[\ 0863[ Glutathione!S!trans! ferase A[ J[ Biol[ Chem[ 138\ 6039Ð6049[ Richtand\ N[ M[\ Kelsoe\ J[ R[\ Kuczenski\ R[\ Segal\ D[ S[\ 0886[ Quanti_cation of dopamine D0 and D1 receptor mRNA levels associated with the development of behavioral sensitization in amphetamine treated rats[ Neurochem[ Int[ 20\ 020Ð026[ Sambrook\ J[\ Fritsch\ E[ F[\ Maniatis\ T[\ 0878[ Molecular Cloning] A Laboratory Manual\ 1nd ed[ Cold Spring Harbor Lab[ Cold Spring Harbor\ NY\ 0!0515[ Senogles\ S[ E[\ 0883[ The D1 dopamine receptor isoforms signal through distinct Ga!proteins to inhibit adenylyl cyclase[ J[ Biol[ Chem[ 158\ 12019Ð12016[ Senogles\ S[ E[\ Spiegel\ A[ M[\ Padrell\ E[\ Iyengar\ R[\ Caron\ M[ G[\ 0889[ Speci_city of receptor!G protein interactions[ Discrimination of Gi subtypes by the D1 dopamine receptor in a reconstituted system[ J[ Biol[ Chem[ 154\ 3496Ð3403[ Sidhu\ A[\ Kimura\ K[\ 0886[ A novel regulation of expression of the a!subunit of G stimulatory protein by dopamine via D0 dopamine receptors[ J[ Neurochem[ 57\ 076Ð083[ Strader\ C[ D[\ Dixon\ R[ A[\ Cheung\ A[ H[\ Candelore\ M[ R[\ Blake\ A[ D[\ Sigal I[ S[\ 0876[ Mutations that uncouple the b!adrenergic receptor from Gs and increase agonist a.nity[ J[ Biol[ Chem[ 151\ 05328Ð05332[ Taylor\ J[ M[\ Jacobmosier\ G[ G[\ Lawton\ R[ G[\ Vandort\ M[\ Neubig\ R[ R[\ 0885[ Receptor and membrane interaction sites on Gb*a receptor!derived peptide binds to the carboxyl terminus[ J[ Biol[ Chem[ 160\ 2225Ð2228[ Wade\ S[ M[\ Dalman\ H[ M[\ Yang\ S[ Z[\ Neubig\ R[ R[\ 0883[ Multisite interactions of receptors and G proteins] enhanced potency of dimeric receptor peptides in modifying G protein func! tion[ Mol[ Pharmacol[ 34\ 0080Ð0086[ Weiss\ B[\ Davidkova\ G[\ Zhou\ L[!W[\ Zhang\ S[!P[\ Morabito\ M[\ 0886[ Expression of a D1 dopamine receptor antisense RNA in brain inhibits D1!mediated behaviors[ Neurochem[ Int[ 20\ 460Ð479[