Quantitation of the sterol regulatory element-binding protein mRNA in mononuclear blood cells by competitive RT-PCR

Clinica Chimica Acta 336 (2003) 27 – 37 www.elsevier.com/locate/clinchim

Quantitation of the sterol regulatory element-binding protein mRNA in mononuclear blood cells by competitive RT-PCR Christian Skarits, Susanna Fischer, Oskar A. Haas * Children’s Cancer Research Institute, St. Anna Children’s Hospital, Kinderspitalgasse 6, A-1090 Vienna, Austria Received 6 January 2003; received in revised form 28 May 2003; accepted 31 May 2003

Abstract Background: The genes for the sterol regulatory element-binding protein-1a (SREBP-1a), -1c, and -2, the low-density lipoprotein (LDL) receptor, and the 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase play a key role in the intracellular cholesterol and lipid metabolism. Methods: To enable the absolute and relative quantitation of the mRNA levels of these genes we developed a competitive reverse transcriptase-polymerase chain reaction (RT-PCR) assay. The inclusion of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene for reference and normalization enabled us to accurately discriminate between a twofold variance in the expression levels of these genes. We used this assay to study their expression in mononuclear peripheral blood cells (PBMNC). Results: We found that the relative expression of SREBP-1a is tenfold higher than that of SREBP-1c, but only half of that of SREBP-2. The level of SREBP-1a transcripts correlated with that of the SREBP1c, LDL receptor, HMG-CoA reductase, and SREBP-2 genes, whereas the amount of SREBP-1c mRNA did not show a relationship with that of the latter three genes. The most abundant transcript in PBMNC is that of SREBP-2, followed by that of SREBP-1a, whereas SREBP-1c mRNA is only found in smaller amounts. Conclusions: This competitive RT-PCR method is very well suited for the accurate quantitation of the respective mRNAs. D 2003 Elsevier B.V. All rights reserved. Keywords: Cholesterol synthesis; LDL receptor; HMG-CoA reductase; Human mononuclear cells

1. Introduction Abbreviations: bp, basepair; CV, coefficient of variation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HMG-CoA, 3-hydroxy-3-methylglutaryl coenzyme A; LDL, low-density lipoprotein; mRNA, messenger ribonucleic acid; PBMNC, peripheral blood cells; PCR, polymerase chain reaction; RT, reverse transcriptase; SREBP, sterol regulatory element-binding protein; SREBP-1a, sterol regulatory element-binding protein-1a; SREBP1c, sterol regulatory element-binding protein-1c; SREBP-2, sterol regulatory element-binding protein-2. * Corresponding author. Tel.: +43-1-40170-486; fax: +43-140170-437. E-mail address: [email protected] (O.A. Haas). 0009-8981/$ - see front matter D 2003 Elsevier B.V. All rights reserved. doi:10.1016/S0009-8981(03)00295-X

The key components of the cholesterol metabolism and homeostasis are the HMG-CoA reductase and the low-density lipoprotein (LDL) receptor. Human cells can either synthesize their own cholesterol or they can take it up via the LDL receptor by receptor-mediated endocytosis [1,2]. The rate-limiting step of the biosynthetic pathway is catalyzed by the HMG-CoA reductase [3,4]. The key transcriptional modulators of sterol-responsive genes that are subjected to feedback regulation by cholesterol are the sterol regulatory

28

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

element-binding proteins (SREBPs) [5 –10]. They are members of a family of membrane-bound transcription factors. They regulate multiple genes that are involved both in cholesterol biosynthesis and uptake as well as in fatty acid synthesis and lipid metabolism. Two (SREBP-1a, -1c) of the three known human SREBPs originate from alternate transcription start sites of a single gene. The third, SREBP-2, is highly homologous to the former, but it is transcribed from a different locus [5– 10]. In response to sterol deprivation, the amino-terminal domains of the SREBPs are released from the membranes of the endoplasmic reticulum by a two-step proteolytic cascade [11]. To determine the absolute and relative gene expression levels of the SREBP-1a, -1c, -2, LDL receptor, and HMG-CoA reductase genes in mononuclear peripheral blood cells (PBMNC) from healthy normolipemic human individuals, we have developed a competitive reverse transcriptase-polymerase chain reaction (RTPCR) assay. Competitive PCR is a highly sensitive technique for quantitation of small amounts of specific DNA and RNA. The target mRNA is converted into cDNA by reverse transcription (RT) before co-amplification with an artificial internal standard, a related or unrelated competitor RNA sequence. After visualization of the generated PCR fragments by agarose gel electrophoresis and ethidium bromide staining, the amount of generated DNA can be determined by densitometric analysis. The amount of the amplified mRNA sequence is set relative to that of the coamplified competitor RNA sequence. Using a titration-like experiment with varying but known amounts of the competitor RNA sequence, the unknown copy number of the target mRNA sequence can be determined by linear regression analysis [12]. For an accurate estimation of the absolute copy numbers, it is necessary to know the number of cells from which the mRNA is extracted. Since this may be not the case in many instances, the amount of total RNA is often used instead for comparison. The accuracy and reproducibility of this technique, on the other hand, are subject to variations in the RNA yield during extraction and the spectrophotometric RNA measurement as well as the tissue-dependent efficacy of reverse transcription. In the assay described herein, we have used a third alternative, namely the comparison of the

expression levels of the individual genes with that of an invariantly expressed reference housekeeping gene, the glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

2. Materials and methods 2.1. Cloning and synthesis of the competitor RNA sequence The primers used in this study are shown in Table 1. The specificity of the generated PCR fragments was confirmed by digestion with multiple restriction enzymes and sequencing. Commercially available RNA transcribed from pAW109, a plasmid containing an identical insert of pAW108, was used in the RT reaction (106 copies pAW109 RNA from Perkin Elmer, Austria) [13] according to the manufacturer’s protocol (200 U MuMLV reverse transcriptase from Life Technologies, Austria). Primers AW102, AW104, AW125, and AW126 have been published by Wang et al. [13], and the respective sites of hybridization are covered by pAW109 RNA. All other primers shown in Table 1 were designed in this study. A PCR fragment was generated using this cDNA as template and AW125 and AW104 as primers (3 pg template; 50 Al reaction volume; 10 mmol/l Tris –HCl, pH 8.8; 1.5 mmol/l MgCl2; 50 mmol/l KCl; 0.1% Triton X-100; 0.15 Amol/l primer; 0.2 mmol/l dNTP; 1.25 U Taq polymerase). After cycling (95 jC for 5 min; 95 jC for 30 s, 62 jC for 30 s, 72 jC for 30 s, 35 cycles; 72 jC for 5 min), this 323-bp fragment was purified by agarose gel electrophoresis (2% agarose, Techcomp, Hong Kong). The purified AW125/AW104-fragment was further subjected to two PCRs. One PCR was designed to extend the template fragment towards the 5V-end and the other one towards the 3V-end. The ‘‘5V long primer’’ that covered the uninterrupted 5V– 3Vsequences of CS09, CS13, CS05, CS01, and AW125, was used together with the AW125/AW104 fragment in an extension reaction (2.5 ng of both DNAs, 50 Al reaction volume, 10 mmol/l Tris –HCl, pH 8.8; 1.5 mmol/l MgCl2; 50 mmol/l KCl; 0.1% Triton X-100; 1 Amol/l primer; 0.2 mmol/l dNTP; 1.25 U Taq polymerase; denaturation at 95 jC for 5 min; cycling three times: 95 jC for 1 min, 72 jC for 1 min). Subsequently, this reaction mixture was supplemented

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

29

Table 1 List of oligonucleotide sequences and the expected size of their PCR products Target mRNA

SREBP-1a SREBP-1c SREBP-2 LDL receptor HMG-CoA reductase GAPDH

Primer

CS01 CS02 CS05 CS02 CS09 CS10 AW125 AW126 AW102 AW104 CS13 CS14

Primer positiona

Sequence (5V>3V)

CTGCTGACCGACATCGAAGAC GATGCTCAGTGGCACTGACTCTTC CGGAGCCATGGATTGCACTTTC GATGCTCAGTGGCACTGACTCTTC CCCTTCAGTGCAACGGTCATTCAC TGCCATTGGCCGTTTGTGTC CAATGTCTCACCAAGCTCTG TCTGTCTCGAGGGGTAGCTG TACCATGTCAGGGGTACGTC CAAGCCTAGAGACATAATCATC AGGTCGGAGTCAACGGATTTGG ACAGTCTTCTGGGTGGCAGTGATG

PCR product (bp) mRNA

cRNA

321

371

328

393

401

459

258

301

247

303

550

459

b

73 to 93 370 to 393b 7 to 15b 298 to 321b 255 to 278c 636 to 655c 2297 to 2316d 2535 to 2554d 546 to 565e 771 to 792e 14 to 35f 540 to 563f

a

Relative to the translational start ATG of cDNA. Ref. [7]. c Ref. [9]. d Ref. [1]. e Ref. [3]. f Ref. [24]. b

with primers CS09 and AW104 and a 415-bp 5Vextended fragment was generated with a standard cycling program (95 jC for 30 s, 62 jC for 30 s, 72 jC for 30 s, 40 cycles; 72 jC for 5 min). The second extension towards the 3V-end of the AW125/AW104 fragment was performed in an identical fashion. In this case, a ‘‘3Vlong primer’’ that covered the uninterrupted 5V–3V sequences of CS14, CS10, CS02, and AW104 was used for extension. Primers AW125 and CS14 were used to amplify a 391-bp 3V-extended fragment. Both extended fragments were gel-purified as described previously and further subjected to an extension/amplification reaction. This was done by adding the 5V- and 3V-extended fragments in a molar ratio of 1:1 to the reaction mixture (50 Al reaction volume; 10 mmol/l Tris – HCl, pH 8.8; 1.5 mmol/l MgCl2; 50 mmol/l KCl; 0.1% Triton X-100; 1 Amol/l primer CS09 and CS14; 0.2 mmol/l dNTP; 1.25 U Taq polymerase). The cycling procedure was the same as described in the previous extension/amplification reactions with the ‘‘long primers’’ except for performing only 30 cycles in the amplification step. The generated 483-bp fragment was cloned using the pGEMR-T vector system (Promega, Austria) according to the manufacturer’s instructions and sequenced for confirmation (Fig. 1). The resulting plasmid was designated pG5/CS110(+). It was linearized with SalI (Promega)

(60 Al reaction volume; 5 Ag DNA; 37 jC for 16 h) and agarose gel-purified. The DNA was concentrated by precipitation (3  vol. of 83 mmol/l Na-acetate/70% ethanol) and subjected to in vitro transcription with T7 RNA polymerase and the AmpliScribek T7 transcription kit (Epicentre Technologies, USA) as recommended by the manufacturer. To remove the DNA, 1 U of DNase I (Epicentre Technologies) was added to the transcription reaction, and incubation was performed at 37 jC for 15 min. Addition of 1 volume of 5 mol/ l ammonium acetate and incubation for 15 min on ice precipitates specifically RNA, which was subsequently centrifuged, washed with 70% ethanol, resuspended in autoclaved water, and stored at 20 jC. This purification procedure was repeated three times. This standard RNA stock solution was checked for residual DNA contamination by PCR using all primer pairs used in this study. Finally, the competitor RNA concentration was further standardized in a parallel quantitation using pAW109 RNA (Perkin Elmer) and primer pairs for LDL receptor and HMG-CoA reductase sequences. 2.2. RNA isolation and cDNA synthesis After informed consent, PBMNC from seven healthy and normolipemic volunteers (five females,

30

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

Fig. 1. Map of plasmid pG5/CS110(+). An insert of 483 bp was constructed and cloned into a pGEMR – T vector system as described in Materials and methods. The sites of hybridization of the primers listed in Table 1 are shown. The sites designated CS09 to AW102 and AW126 to CS14 are not separated by extra base pairs, respectively. E: EcoRI; Bc: BclI; Bs: BstEII; T7: T7 RNA polymerase start site.

two males; mean age 33.3 years) were isolated after an overnight fast from 10 ml of venous blood. The mononuclear cells were separated from erythrocytes and granulocytes by density gradient centrifugation using Lymphoprepk (Nycomed, Austria) as recommended by the manufacturer. PBMNC were resuspended in medium that was supplemented with 10% dimethyl sulfoxide (Sigma, Austria) and 24.3% fetal calf serum (Life Technologies), frozen with an automated freezing device (SY-LAB IceCube 1610 computer freezer), and stored in liquid nitrogen until further use. For isolation of total RNA, the TRIZOLR Reagent (Life Technologies) was used. It is based on the single-step RNA isolation method developed by Chomczynski and Sacchi [14]. Briefly, 5– 10  106 cells were thawed on ice, collected by centrifugation, and lysed with 1 ml of the reagent. The concentration of the RNA samples was determined spectrophotometrically. To calculate the mean concentration, several independently diluted RNA solutions were measured. RNA samples were stored at 70 jC. Total RNA was diluted to a concentration of 40 ng/Al, and a constant amount of 200 ng (5 Al) was used in each RT reaction. For each RNA sample, 13 reactions were performed in a titration-like manner. The competitor RNA was diluted by a factor of 0.3, commencing with 3.0  108 copies in the first reaction, 1  108 in the second, 3.33  107 in the third, until the last one which contained 5.65  102 copies. In a total volume of 20 Al, 5 Al of total RNA was incubated with 1 Al of competitor RNA and the following standard RT reagents: 50 mmol/l Tris – HCl, pH 8.3; 3 mmol/

l MgCl2; 75 mmol/l KCl; 10 mmol/l dithiotreitol; 2 mmol/l deoxynucleotides (Life Technologies); 2.5 Amol/l random hexanucleotides (Perkin Elmer); 50 U M-MLV reverse transcriptase (Life Technologies). Master mixes were used that contained all components except total RNA (5 Al) and M-MLV-RT (3.25 Al working solution). All components were combined on ice, overlaid with mineral oil (Sigma), and incubated at room temperature for 10 min. RT was performed at 37 jC for 60 min followed by inactivation of the transcriptase by heating for 5 min at 95 jC. cDNAs were stored at 20 jC. 2.3. PCR amplification The nucleotide sequences of the expected amplification products of the SREBP-1a, -1c, -2, LDL receptor, HMG-CoA reductase, and GAPDH genes are shown together with their respective primer sets and product sizes in Table 1. Primers were designed with the help of the GeneRunnerR software (version 3.00, Hastings Software, USA) and custom synthesized by Life Technologies. PCR was carried out in a reaction volume of 25 Al consisting of the following reagents: 3 Al of cDNA; 10 mmol/l Tris – HCl, pH 8.8; 1.5 mmol/l MgCl2; 50 mmol/l KCl; 0.1% Triton X100; 0.2 Amol/l primers; 0.2 mmol/l deoxynucleotides; 1.25 U Taq polymerase (DyNAzymek, Finnzymes Oy, Finland). Only for the amplification of the GAPDH sequence the original cDNA solution had to be diluted 1:100. Master mixes contained all components except cDNA (3 Al) and Taq polymerase

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

(2.5 Al working solution). After addition of two drops of mineral oil, the following cycling protocol was performed: 95 jC for 5 min; 95 jC for 30 s, 60 – 62 jC for 30 s, 72 jC for 30 s, 32 – 38 cycles; 72 jC for 5 min (Biometra Trio-Thermoblock, Szabo, Austria). For amplification of SREBP-1a, -1c, -2, and GAPDH sequences, annealing was performed at 62 jC, whereas in the case of the LDL receptor and HMG-CoA reductase sequences, it was done at 60 jC. The numbers of cycles were the following: 32 (GAPDH), 35 (SREBP-1a, -1c, -2), 37 (HMG-CoA reductase), and 38 (LDL receptor). To secure that total and competitor RNA were free of potentially contaminating DNA or cDNA, we omitted M-MLV-RT from the RT reaction. Even after 60 PCR cycles, this negative control system did not reveal any visible fragments (data not shown).

31

mined in the following way: corrected intensity of competitor fragment = intensity of competitor fragment  (number of bp of target fragment/number of bp of competitor fragment). These values were compared with the intensities of the respective target products. The correction procedure was tested with serial dilutions of AX174 DNA digested with HaeIII

2.4. Quantitation of PCR products and calculation of copy numbers Following PCR amplification, 10 Al of PCR product mixed with 2 Al of loading solution (40% sucrose, 1 mmol/l EDTA, and 0.03% bromphenol blue) was subjected to electrophoresis in a 2% agarose gel that was prestained with ethidium bromide (2 Ag/ml; Sigma). The running buffer (1  TBE) was also stained with ethidium bromide using the same concentration. After washing with distilled water, stained gels were placed on a UV-transilluminator and images were taken with a video system (Mitsubishi Video System, Copy Processor P67E, Japan) and saved as TIFF files. The images were subsequently analyzed with a densitometric software package from KODAK (KODAK digital sciencek 1D 2.0.2, Eastman KODAK, USA). To determine the linear range of the detection system, AX174 DNA was digested with HaeIII (Life Technologies), and serial dilutions were subjected to electrophoresis. The fluorescence intensities of four fragments (234, 310, 603, and 872 bp) were analyzed densitometrically and compared with the quantity of each fragment. There was a linear relationship between the log of DNA mass and the log of band intensity (3 to 70 ng DNA; r = 0.995 F 0.004; n = 4). For correction of fluorescence intensities due to the proportional character of ethidium bromide intercalation, corrected intensities of the competitor fragments were deter-

Fig. 2. Constant equivalence points of SREBP-1a (A) and SREBP1c (B) quantitation. Competitive RT-PCR was performed as described in Materials and methods except that aliquots of 5 Al were taken during PCR cycling after 33 (triangles), 35 (circles), and 37 (diamonds) cycles. Densitometric analysis and calculation were done as described, and linear regression lines were calculated according to the method of least squares. It: intensity of target fragment; Ic: intensity of competitor fragment.

32

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

(234, 310, 603, and 872 bp) and with all PCR fragments of this study. No interference of band intensities was detected (data not shown). The calculation of copy numbers was based on the linear relationship between the log of DNA mass or copy number and the log of fluorescence intensity. As a result, the following equation was established: log (It/ Ic) = K  log cc + D, where It is the intensity of the target fragment, Ic is the corrected intensity of the competitor PCR fragment, and cc is the initial copy number of the competitor RNA. Theoretically, starting from equal copy numbers of target and competitor RNA, designated as the equivalence point, there will be an equal intensity of the respective PCR products, and hence, log (It/Ic) = 0. Therefore, cc can be determined as log cc = D/K, where K is the slope and D is the constant of the linear regression analysis, when log (It/Ic) is plotted against log cc. The coefficient of variation (CV) for all linear fits was V 0.99. Statistical analysis was performed with the XLStatistics software (version 5, Rodney Carr, Australia).

3. Results 3.1. Constant equivalence points First we investigated how increasing numbers of PCR cycles and the unequal amplification efficiency of target and competitor sequences affect the equiva-

lence point. For this purpose, we took aliquots from each PCR reaction after various cycle numbers and measured them. Fig. 2 shows a representative linear regression analysis of the equivalence points of SREBP-1a and -1c. With increasing cycle numbers the slope of the curve flattens, but all lines meet approximately at the same point, which represents the equivalence point. For the six transcripts investigated in this study, the CV was between 4% and 8% (data not shown). We also analyzed different images of the same gel and determined a CV of 1 – 5% (data not shown). Since the net intensities of the different fragments were within the same magnitude, three to five data points in the vicinity of the equivalence point were sufficient for the linear regression analysis. 3.2. Accuracy and reproducibility For the evaluation of the resolvable difference in mRNA copy numbers, we used either 100 or 200-ng total RNA per reaction. Theoretically, there should be twice as many gene copies in 200-ng RNA compared with that in 100 ng. In Fig. 3, diagrammatic representations of regression analyses for three of the six mRNA are depicted. The reproducibility was tested in four experiments, and the CV never exceeded 9% (Table 2). All mean coefficients of correlation were V 0.99. The accuracy was determined by calculating the factor F that is the number of copies per 200 ng of RNA relative to the number of copies per 100 ng

Fig. 3. Accuracy of the competitive RT-PCR method. The equivalence points of the mRNA copy numbers should theoretically differ by a factor of 2. 100 ng (open signs) and 200 ng (solid signs) of total RNA from a single individual were subjected to competitive RT-PCR and the calculations were performed as described in Materials and methods. Regression analyses of SREBP-1c (triangles), SREBP-2 (circles), and GAPDH (squares) are shown. A summary of the results is shown in Table 2. Each data point represents the mean of duplicate experiments. It: intensity of target fragment; Ic: intensity of competitor fragment.

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

33

Table 2 Parameters demonstrating the accuracy and reproducibility of our competitive RT-PCR method

3.3. Quantitation of relative SREBP-1a, -1c, -2, LDL receptor, and HMG-CoA reductase mRNA expression

mRNA

Copies/Ag total RNA

CV (%)

F

SREBP-1a SREBP-1c SREBP-2 LDL receptor HMG-CoA reductase GAPDH

4.10 F 0.27  105 1.01 F 0.09  105 1.36 F 0.08  106 2.55 F 0.08  105 3.19 F 0.30  106 5.82 F 0.30  107

7 9 6 3 9 5

2.04 F 0.19 1.69 F 0.09 2.10 F 0.17 2.09 F 0.07 2.38 F 0.10 1.83 F 0.06

The ranges of the absolute copy numbers per microgram of total RNA of all transcripts are listed in Table 3. The CV ranges from 43% (GAPDH) to 79% (LDL receptor). When the absolute data were set relative to that of GAPDH, the resulting relative amounts of all other transcripts were in the percent range of that of the GAPDH expression (Table 3). The mean reduction of all CVs was 13.8 F 2.1% (n = 5). The highest relative expression was observed for SREBP-2 and HMG-CoA reductase. They were both in the same range (5.5 F 2.2% and 6.6 F 2.3%, respectively). Approximately half of that relative expression was found for SREBP-1a and the LDL receptor (2.6 F 1.3% and 2.5 F 1.6%, respectively). SREBP-1c expression was the lowest with 0.3 F 0.2% of that of the GAPDH mRNA. We also looked for potential correlations between the relative expression patterns of the respective mRNAs. We found that the relative expression of the LDL receptor gene correlated significantly with that of HMG-CoA reductase, SREBP-1a, and -2 genes ( p < 0.05, p < 0.04, and p < 0.01, respectively). The relative amount of the HMG-CoA reductase mRNA correlated with the relative expression of SREBP-1a and -2 (p < 0.05 in both instances). Finally, the relative SREBP-1a expression correlated significantly with that of SREBP-1c, and -2

Total RNA of a single individual was subjected to competitive RTPCR. The calculations were performed as described in Materials and methods. All mRNAs were analyzed four times (2  100 ng RNA/ reaction, 2  200 ng RNA/reaction). The confidence intervals were defined as mean F 3  S.D. In no instance, the interval of copies per 100 ng RNA overlapped the interval of copies per 200 ng RNA. The numbers of data points used for linear regression analysis were either four (SREBP-1a, SREBP-1c, SREBP-2, HMG-CoA reductase) or five (LDL receptor, GAPDH). S.D.: standard deviation. F: copies/200 ng RNA relative to copies/100 ng RNA (theoretically, F = 2).

(theoretically, F = 2). Table 2 shows that the experimental values of F are approximately 2. We were easily able to discriminate the data sets, because even when we used the mean F 3 standard deviations (S.D.), the data sets did not overlap (data not shown). The copy numbers per reaction ranged from approximately 1  104 (SREBP-1c mRNA in 100-ng total RNA) to about 1  107 (GAPDH mRNA in 200-ng total RNA; Table 2).

Table 3 Results of the mRNA quantitation in normolipemic individuals HMG-CoA reductase

SREBP-1a

SREBP-1c

SREBP-2

GAPDH

(  105 copies/lg RNA) Range 0.2 – 12.7 Mean F S.D. 5.1 F 4.0 CV (%) 79

LDL receptor

3.0 – 22.5 12.8 F 6.5 51

0.9 – 9.5 5.2 F 3.2 61

0.13 – 1.34 0.60 F 0.47 78

1.2 – 21.4 11.8 F 6.7 57

53 – 325 201 F 85 43

(%) Range Mean F S.D. CV (%)

4.2 – 11.0 6.6 F 2.3 36

0.9 – 4.6 2.6 F 1.3 50

0.07 – 0.66 0.31 F 0.20 66

1.1 – 8.8 5.5 F 2.2 40

100

0.2 – 5.2 2.5 F 1.6 65

– –

The upper half of the table shows the range and mean of the absolute copy numbers of the six analysed genes and the bottom half the copy numbers relative to that of the GAPDH gene [(copy no. mRNA/copy no. GAPDH)  100]. The reduction of variation using relative data is 13.8 F 2.1% (n = 5). S.D.: standard deviation; CV: coefficient of variation=(standard deviation/mean)  100.

34

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

Fig. 4. Relative SREBP-1c expression in relation to the relative expression of SREBP-1a in the PBMNC of normolipemic individuals. The unit of both parameters is shown in percent of GAPDH expression. The regression line was calculated according to the method of least squares (r = 0.97, p < 0.001). Each data point represents the mean of duplicate experiments.

( p < 0.001, and p < 0.02, respectively) (Fig. 4). All correlations were positive.

4. Discussion Herein we describe a technically simple competitive RT-PCR quantitation method for the measurement of the absolute and relative expression levels of genes that are involved in the cellular regulation of the cholesterol metabolism. With this assay, we were able to quantify the expression of the SREBP-1a, -1c, -2, LDL receptor, and HMG-CoA reductase genes in the PBMNC of healthy, normolipemic individuals in an easy, quick, and reliable manner. The results obtained for the LDL receptor and HMG-CoA reductase mRNA copy numbers were within the range of those reported previously by Powell and Kroon [15,16], who quantitated these parameters with a chemiluminescence technique. Studying 10 separately prepared lymphocyte and RNA samples, they found a variation of 13% and 2%, respectively, and in duplicate measurements of approximately 30%. In comparison, the variations of our experiments ranged from 8% to 30% (data not shown). With a different type of mRNA analysis, Petersen et al. [17] found that the intra- and intersubject biological variations of the LDL receptor mRNA from normal PBMNC were approximately 22% and 14%, respectively, with an analytical imprecision of approximately 23%. Powell and Kroon [15]

also evaluated the effect of the cycle number on the precision of quantitative PCR. Up to 30 cycles, they obtained a CV of approximately 8%. The cycle numbers of our analyses ranged from 32 (GAPDH) up to 38 (LDL receptor) and the respective CVs from 4% to 8% (data not shown). In accordance with our experimental set-up, Gilliland et al. [18] used agarose gels, but radiolabeled PCR products for the quantitation of GM-CSF mRNA levels. However, they performed 45 cycles to amplify 1.5  104 to 9.0  107 copies of target and competitor RNA per RT reaction. The fact that the equivalence points remained constant in our experiments indicates that the target and competitor sequences amplified with a similar efficiency (Fig. 2). Gilliland et al. [18] compared two different types of competitor sequences and obtained very similar results. In line with the genomic situation, one competitor sequence contained an intron and was 48% longer than the target RNA, whereas the other one had only a single nucleotide exchange, which made the PCR product suitable for restriction enzyme digestion. Particular in the latter case, however, heteroduplex formation may occur during the amplification process [18]. As Gebhardt et al. [19] pointed out, this is not a trivial problem. They experienced a considerable amount of heteroduplex formation when using such modified competitor sequences for the quantification of the LDL receptor, HMG-CoA reductase, and GAPDH [19]. In our analyses, the length difference between competitor and target RNA never exceeded 23%. Moreover, by using an unrelated

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

competitor RNA we also avoided the potentially interfering formation of heteroduplices. The sequences we chose for the amplification of the SREBP gene family transcripts were approximately 3200 to 3600 bp away from the respective poly-A tails. Owing to the limited efficacy of the reverse transcriptase, sequences distant from or near to the 5V end of the transcript might not amplify as well as those near the poly-A tract. Moreover, oligo-dT primers hybridize only to mRNA with a poly-A tail on the 3V end. Compared to oligo-dT primers, random hexamers are supposed to intensify the amplification by hybridizing randomly also to internal regions of the gene transcripts [20]. To avoid any potential problems with oligo-dT or specific reverse primers, we therefore decided to employ random hexanucleotides for the RT. In addition, the use of random hexanucleotides also enabled us to perform all six different PCRs within the same RT reaction. For the determination of the absolute mRNA copy numbers and normalization, we chose to use the housekeeping gene GAPDH. It has only a single coding gene that is almost invariantly expressed under diverse conditions [21,22]. Some of the up to 100 closely related and potentially transcribed pseudogenes most likely contribute to a heterogeneous cellular GAPDH mRNA pool, but the only functional transcript is always present in great excess [23,24]. Although we did not note any obvious negative effects in our analyses, the use of processed pseudogenes, such as GAPDH or h-actin, as internal controls in quantitative RT-PCR assays may be of concern and has been extensively debated [25]. When comparing copy numbers per cell, we achieved a CV of approximately 13% (data not shown). Furthermore, normalization resulted in an overall reduction of the variation of approximately 14% (Table 3). With our method we can detect at least twofold difference in the mRNA copy numbers per RT reaction in the range between approximately 1  104 (SREBP-1c in 100-ng total RNA) and 1  107 (GAPDH in 200-ng total RNA) (Table 2, Fig. 3). Although the sensitivity was not investigated further, it seems nevertheless likely that its potential limits have not yet been completely exploited. PBMNC were not only one of the first tissues in 1976 in which the cholesterol metabolism had been studied, but they still continue to remain the focus of

35

interest in this context [26 – 30]. Although SREBPs were already identified in 1993, their function in PBMNC has not been investigated in detail so far [5– 7,31,32]. In particular, no specific information is as yet available about their expression patterns in PBMNC. In cultured cells, the SREBP-1a transcript predominates over that of SREBP-1c, whereas in mouse and human tissues it is the other way round [33]. In human organs, the ratio of SREBP-1c to SREBP-1a mRNA ranges from approximately 1 in kidney to roughly 6 in liver [33]. In contrast, we found that the amount of SREBP-1a mRNA in normal human PBMNC is approximately 10-fold higher than that of SREBP-1c (Fig. 4, data not shown). In a previous study, a comparable ratio was only found in mouse spleen [33]. This puzzling similarity may at least partly be caused by the large number of lymphocytes that are present in addition to its normal stromal and parenchymal constituents in this organ. SREBP-2 expression is approximately twice as high as that of SREBP-1. It is therefore the most abundant SREBP mRNA (Table 3). It was suggested that SREBP-1a and -2 regulate the transcription of genes involved in the cholesterol biosynthesis pathway, but SREBP-2 seems to be a more potent regulator than SREBP-1a [34,35]. Moreover, it was postulated that SREBP-1c should predominantly regulate genes that encode enzymes in the fatty acid biosynthesis pathway. To a lesser degree, enzymes involved in cholesterol biosynthesis are also regulated by SREBP-1c [36]. The positive correlation of SREBP-1a and -2 expression with that of the LDL receptor as well as HMG-CoA reductase genes in PBMNC supports the hypothesis that SREBP-1a and -2 are involved in cholesterol biosynthesis and the external supply. In contrast, SREBP-1c transcription does not correlate with that of LDL receptor and HMG-CoA reductase in this tissue type. This finding, on the other hand, supports the hypothesis that SREBP-1c is mainly involved in fatty acid biosynthesis. More importantly, however, our findings also indicate that, despite their continuous exposure to a considerable concentration of exogenous serum cholesterol, PBMNC most likely synthesize their own cholesterol. This notion is corroborated by the observation that the plasma cholesterol level did not influence the expression level of the studied genes (data not shown). The expression of SREBP-1a and -1c

36

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

seems to be coordinately regulated, because the amount of these mRNA species correlated in a highly significant manner (Fig. 4). One of the reasons for this association may be that these transcripts derive from a single gene locus, although the transcription is under control of different promoters [8]. Finally, the confirmation of the previously already well-established coordinated expression of the LDL receptor and HMG-CoA reductase genes further substantiated the validity of our quantification system [16,30]. We now intend to apply this gene expression assay to investigate various forms of hematological neoplasms, in particular those in which a disturbed cellular cholesterol metabolisms has already been documented.

Acknowledgements This work was supported by grant no. 5478 of the ‘‘Jubila¨umsfonds des Bu¨rgermeisters der Stadt Wien’’ ¨ sterreichische Kinderkrebshilfe’’. We and by the ‘‘O are grateful to the St. Anna Kinderspital laboratory staff members R. Kornmu¨ller, U. Stalze, and E. Neidhart for their support and for providing normal PBMNC specimens. We also acknowledge the excellent technical assistance and theoretical support of M. Ko¨nig and Dr. A. Weinha¨usel, and, in particular, the extensive help of Dr. Thomas Bo¨hm in preparing this project.

References [1] Yamamoto T, Davis CG, Brown MS, Schneider WJ, Casey ML, Goldstein JL, et al. The human LDL receptor: a cysteinerich protein with multiple Alu sequences in its mRNA. Cell 1984;39:27 – 38. [2] Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34 – 47. [3] Luskey KL, Stevens B. Human 3-hydroxy-3-methylglutaryl coenzyme A reductase. Conserved domains responsible for catalytic activity and sterol-regulated degradation. J Biol Chem 1985;260:10271 – 7. [4] Osborne TF, Goldstein JL, Brown MS. 5Vend of HMG CoA reductase gene contains sequences responsible for cholesterolmediated inhibition of transcription. Cell 1985;42:203 – 12. [5] Briggs MR, Yokoyama C, Wang X, Brown MS, Goldstein JL. Nuclear protein that binds sterol regulatory element of low density lipoprotein receptor promoter: I. Identification of

[6]

[7]

[8]

[9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

the protein and delineation of its target nucleotide sequence. J Biol Chem 1993;268:14490 – 6. Wang X, Briggs MR, Hua X, Yokoyama C, Goldstein JL, Brown MS. Nuclear protein that binds sterol regulatory element of low density lipoprotein receptor promoter: II. Purification and characterization. J Biol Chem 1993;268: 14497 – 504. Yokoyama C, Wang X, Briggs MR, Admon A, Wu J, Hua X, et al. SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell 1993;75:187 – 97. Hua X, Wu J, Goldstein JL, Brown MS, Hobbs HH. Structure of the human gene encoding sterol regulatory element binding protein-1 (SREBF1) and localization of SREBF1 and SREBF2 to chromosomes 17p11.2 and 22q13. Genomics 1995;25: 667 – 73. Hua X, Yokoyama C, Wu J, Briggs MR, Brown MS, Goldstein JL, et al. SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element. Proc Natl Acad Sci U S A 1993;90: 11603 – 7. Miserez AR, Cao G, Probst LC, Hobbs HH. Structure of the human gene encoding sterol regulatory element binding protein 2 (SREBF2). Genomics 1997;40:31 – 40. Brown MS, Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 1997;89:331 – 40. Orlando C, Pinzani P, Pazzagli M. Developments in quantitative PCR. Clin Chem Lab Med 1998;36:255 – 69. Wang AM, Doyle MV, Mark DF. Quantitation of mRNA by the polymerase chain reaction. Proc Natl Acad Sci U S A 1989;86:9717 – 21. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate – phenol – chloroform extraction. Anal Biochem 1987;162:156 – 9. Powell EE, Kroon PA. Measurement of mRNA by quantitative PCR with a nonradioactive label. J Lipid Res 1992;33: 609 – 14. Powell EE, Kroon PA. Low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl coenzyme A reductase gene expression in human mononuclear leukocytes is regulated coordinately and parallels gene expression in human liver. J Clin Invest 1994;93:2168 – 74. Petersen NE, Larsen LK, Nissen H, Jensen LG, Jensen A, Hyltoft Petersen P, et al. Improved RNase protection assay for quantifying LDL-receptor mRNA; estimation of analytical imprecision and biological variance in peripheral blood mononuclear cells. Clin Chem 1995;41:1605 – 13. Gilliland G, Perrin S, Blanchard K, Bunn HF. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc Natl Acad Sci U S A 1990;87:2725 – 9. Gebhardt A, Peters A, Gerding D, Niendorf A. Rapid quantitation of mRNA species in ethidium bromide-stained gels of competitive RT-PCR products. J Lipid Res 1994;35:976 – 81. Maas-Szabowski N. Modification of the reverse transcription procedure guarantees representative cDNA templates for RT-

C. Skarits et al. / Clinica Chimica Acta 336 (2003) 27–37

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

PCR of multiple genes. PCR-bibliograghie 1997. Biochemica information. Mannheim, Germany: Boehringer Mannheim; 1997. Bruns GA, Pierce P, Regina VM, Gerald PS. Expression of GAPDH and TPI in dog-rodent hybrids. Cytogenet Cell Genet 1978;22:547 – 51. Serville F, Junien C, Kaplan JC, Gachet M, Cadoux J, Broustet A. Gene dosage effect for human triosephosphate isomerase and glyceraldehyde-3-phosphate dehydrogenase in partial trisomy 12p13 and trisomy 18p. Hum Genet 1978;45:63 – 9. Piechaczyk M, Blanchard JM, Riaad-El Sabouty S, Dani C, Marty L, Jeanteur P. Unusual abundance of vertebrate 3-phosphate dehydrogenase pseudogenes. Nature 1984;312:469 – 71. Tso JY, Sun XH, Kao TH, Reece KS, Wu R. Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res 1985;13:2485 – 502. Watzinger F, Lion T. Multiplex PCR for quality control of template RNA/cDNA in RT-PCR assays. Leukemia 1998;12: 1984 – 6 [discussion 1987 – 93]. Ho YK, Brown MS, Bilheimer DW, Goldstein JL. Regulation of low density lipoprotein receptor activity in freshly isolated human lymphocytes. J Clin Invest 1976;58:1465 – 74. Ho YK, Smith RG, Brown MS, Goldstein JL. Low-density lipoprotein (LDL) receptor activity in human acute myelogenous leukemia cells. Blood 1978;52:1099 – 114. Vitols S, Gahrton G, Bjorkholm M, Peterson C. Hypocholesterolaemia in malignancy due to elevated low-density-lipoprotein-receptor activity in tumour cells: evidence from studies in patients with leukaemia. Lancet 1985;2:1150 – 4. Vitols S, Gahrton G, Ost A, Peterson C. Elevated low density

[30]

[31]

[32]

[33]

[34]

[35]

[36]

37

lipoprotein receptor activity in leukemic cells with monocytic differentiation. Blood 1984;63:1186 – 93. Vitols S, Norgren S, Juliusson G, Tatidis L, Luthman H. Multilevel regulation of low-density lipoprotein receptor and 3hydroxy-3-methylglutaryl coenzyme A reductase gene expression in normal and leukemic cells. Blood 1994;84:2689 – 98. Varma N, Varma S, Kaul D. Expression of receptor-Ck and SREBP genes in mononuclear cells from acute leukemia patients. Leuk Res 2000;24:913 – 6. Kaul D, Kaur M. Receptor-Ck regulates membrane-bound 125 kDa protein having affinity for genomic sterol regulatory sequence. Mol Cell Biochem 2001;216:141 – 3. Shimomura I, Shimano H, Horton JD, Goldstein JL, Brown MS. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 1997;99: 838 – 45. Shimano H, Horton JD, Hammer RE, Shimomura I, Brown MS, Goldstein JL. Overproduction of cholesterol and fatty acids causes massive liver enlargement in transgenic mice expressing truncated SREBP-1a. J Clin Invest 1996;98: 1575 – 84. Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, Shimano H. Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest 1998;101:2331 – 9. Shimano H, Horton JD, Shimomura I, Hammer RE, Brown MS, Goldstein JL. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest 1997;99:846 – 54.