- Email: [email protected]
Quantitative analyses of genes associated with mucin synthesis of broiler chickens with induced necrotic enteritis
Quantitative analyses of genes associated with mucin synthesis of broiler chickens with induced necrotic enteritis R. E. A. Forder,*1 G. S. Nattrass,† M. S. Geier,*‡ R. J. Hughes,*‡ and P. I. Hynd* *School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy, South Australia 5371; †South Australian Research and Development Institute (SARDI), Livestock and Farming Systems, Roseworthy, South Australia 5371; and ‡South Australian Research and Development Institute (SARDI), Pig and Poultry Production Institute, Roseworthy, South Australia 5371 KGF, TLR4, TFF2, TNF-α, MUC2, MUC4, MUC5ac, MUC5b, MUC13, and MUC16). The only genes that were differentially expressed in the intestine among treatment groups were MUC2, MUC13, and MUC5ac. Expression of MUC2 and MUC13 was depressed by co-challenge with Eimeria spp. and Clostridium perfringens. Antimicrobial treatment prevented an NEinduced decrease in MUC2 expression but did not affect MUC13. The expression of MUC5ac was elevated in birds challenged with Eimeria spp./C. perfringens compared with unchallenged controls and antimicrobial treatment. Changes to MUC gene expression in challenged birds is most likely a consequence of severe necrosis of the jejunal mucosa.
Key words: necrotic enteritis, mucin, mucosa, intestine, chicken 2012 Poultry Science 91:1335–1341 http://dx.doi.org/10.3382/ps.2011-02062
INTRODUCTION Necrotic enteritis (NE) is one of the world’s most prevalent poultry diseases (Van Immerseel et al., 2009). It is characterized by inflammation and necrosis of the intestinal tract, causing losses in productivity and reduced welfare, with significant flock morbidity and mortality in acute cases (Keyburn et al., 2008; Cooper and Songer, 2009). Necrotic enteritis outbreaks and prevention cost the global poultry industry an estimated $2 billion per year (Lovland and Kaldhusdal, 2001; Van Immerseel et al., 2009) A causative agent of NE is Clostridium perfringens, a spore-forming, gram-positive anaerobe that is a resident of the intestinal tract (Cooper and Songer, 2009). The onset of NE is thought to occur when C. perfringens proliferates to high numbers in the small intestine, releasing toxins that damage the gut. It is well accepted ©2012 Poultry Science Association Inc. Received November 30, 2011. Accepted February 3, 2012. 1 Corresponding author: [email protected]
that predisposing factors, such as coccidial infection and diets high in meatmeal or indigestible soluble fiber, are required to initiate C. perfringens proliferation (AlSheikhly and Al-Saieg, 1980; Williams, 2005; McDevitt et al., 2006). Until recently, intestinal C. perfringens numbers have been controlled by the inclusion of in-feed antimicrobials The legislated removal of in-feed antimicrobials in the United Kingdom and European Union has increased the incidence of NE (Grave et al., 2004; McDevitt, et al., 2006), consequently there is a need for the identification of effective nonantibiotic alternatives for NE prevention (Cooper and Songer, 2009). The first line of defense that bacteria encounter when trying to traverse the intestinal mucosa is the overlying mucus-gel layer. The formation of the mucus-gel is through goblet cell secretion of mucin glycoproteins (Allen et al., 1982; Forstner and Forstner, 1994). Mucins are heterogeneous, highly O-glycosylated glycoproteins with high molecular weights (Claustre et al., 2002; Freitas et al., 2002). They are characterized by a peptide core (coded by the MUC gene family) with 2 regions: a major domain, densely glycosylated O-linked oligosaccharide branches, rich in the amino acids serine,
1335
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
ABSTRACT Clostridial infection of the intestine can result in necrotic enteritis (NE), compromising production and health of poultry. Mucins play a major role in protecting the intestinal epithelium from infection. The relative roles of different mucins in gut pathology following bacterial challenge are unclear. This study was designed to quantify the expression of mucin and mucin-related genes, using intestinal samples from an NE challenge trial where birds were fed diets with or without in-feed antimicrobials. A method for quantifying mucin gene expression was established using a suite of reference genes to normalize expression data. This method was then used to quantify the expression of 11 candidate genes involved in mucin, inflammatory cytokine, or growth factor biosynthesis (IL-18,
1336
Forder et al.
birds were fed starter diets, except for CZ birds that received zinc bacitracin and monensin. Between d 8 and 15 inclusive (before C. perfringens inoculation), birds were fed a 50% (wt/wt) fish meal-based diet (CZ, with antimicrobials included). After d 15, original diets were returned.
Eimeria and C. perfringens Inoculation On d 9, all birds (except unchallenged controls) were given an oral suspension of 2,500 oocysts of E. acervulina, E. maxima, and E. tenella, respectively (Bioproperties Pty Ltd., Glenorie, New South Wales, Australia) in 1 mL of PBS. Unchallenged control birds received sterile PBS in place of Eimeria. On d 15, birds in challenged groups were individually inoculated with 1 mL of C. perfringens EHE-NE18 (CSIRO Australian Animal Health Laboratory, Geelong, Victoria, Australia) suspended in thioglycollate broth (USP alternative, Oxoid, Hampshire, UK) at a concentration of 3.5 × 108 cfu/mL. Unchallenged control birds received 1 mL of sterile thioglycollate broth.
Tissue Collection On d 18, from 36 birds (n = 12 birds/treatment), a 2-cm segment from the midpoint of the jejunum was removed, rinsed in PBS, with 1 cm placed in 2 mL of RNAlater (Ambion, Carlsbad, CA) for gene expression analyses.
Isolation and Quantification of Total RNA from Chicken Intestine Samples
In total, 1,200 male Cobb 500 broiler chickens (Baiada Hatchery, Kootingal, New South Wales, Australia) were raised in floor pens in a temperature-controlled room at the University of New England (Armidale, New South Wales, Australia). All procedures were approved by the Animal Ethics Committee of the University of New England. All experimental diets were based on a standard commercial starter diet with no added in-feed antimicrobials or coccidiostats (Ridley Agriproducts, Tamworth, New South Wales, Australia) and met or exceeded NRC guidelines (NRC, 1994). The 3 experimental groups were an unchallenged control (UU), an Eimeria spp./C. perfringens-challenged control (CU), and Eimeria spp./C. perfringens-challenged groups treated with antimicrobials (45 ppm zinc bacitracin and 100 ppm monensin; CZ).
Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany). Intestinal samples were removed from RNAlater (Ambion) and 50 to 100 mg of each sample homogenized with an Ultra-Turrax (T25; IKA-Werke GmbH and Co. KG, Staufen, Germany) in 2 mL of Trizol reagent (Invitrogen, Carlsbad, CA). The upper aqueous phase of Trizol was recovered from the homogenized samples as per the manufacturer’s instructions. The aqueous phase was mixed with an equivalent volume of 70% ethanol, loaded onto RNeasy mini columns, and centrifuged at 8,000 × g for 1 min at room temperature (Mikro200; Andreas Hettich GmbH and Co. KG, Tuttlingen, Germany). Following this centrifugation step, RNeasy columns were processed according to the manufacturer’s instructions. An on-column RNase-free DNase treatment step (Qiagen) was included and the RNA was eluted in 50 μL of EB buffer (Qiagen). The concentration and purity of total RNA was determined using UV spectrophotometry (Nanodrop 1000; Thermo Scientific, Wilmington, DE). The integrity of all RNA samples was confirmed via agarose-gel elctrophoresis.
NE Challenge Procedure
Design and Testing of Real-Time PCR Assays Targeting Chicken Genes
The NE challenge was performed as described previously (Kocher et al., 1995). From placement until d 7,
The GenBank (National Centre for Biotechnology Information; NCBI) database and the Ensembl chick-
MATERIALS AND METHODS NE Challenge and Tissue Collection
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
threonine, and proline (Forstner and Forstner, 1994; Van Klinken et al., 1995), and a minor portion, poorly or nonglycosylated, rich in cysteine located at the Cand N-terminal regions of the core protein (Claustre et al., 2002). Mucins possess potential binding sites for both commensal and pathogenic organisms and can be discharged in response to a wide variety of stimuli with the potential for changes in the type and quality of mucin secreted (Van Klinken et al., 1995; Freitas et al., 2002). Increasing interest has been directed toward the protective properties of mucin as a barrier against epithelial attachment, and the mechanisms by which bacteria can utilize these mucin glycoproteins to facilitate adhesion and colonization (Deplancke and Gaskins, 2001; Robbe et al., 2003). This is important as a means to understand their involvement in the pathogenesis of intestinal diseases and to use and optimize their protective properties for enhanced intestinal barrier function. To maximize the efficacies of potential nonantibiotic alternatives, it is necessary to understand how C. perfringens colonize the gut and how it affects mucosal dynamics, especially the interaction with the mucus layer. Currently, the role of mucins and the mucus layer in C. perfringens infection is still elusive, with studies suggesting that specific mucin structures provide a growth advantage to the species (Ashida et al., 2008; Collier et al., 2008). The present study aimed to develop a series of real-time PCR-based assays to study intestinal MUC gene expression as well as genes involved in intestinal inflammation and regulation of MUC gene expression and goblet cell mucin secretion in broiler chickens challenged with C. perfringens.
1337
GENES ASSOCIATED WITH MUCIN SYNTHESIS
Synthesis of cDNA from Chicken Intestine RNA The concentration of all chicken intestine RNA samples was normalized to 40 ng/μL with the aid of a liquid-handling robotics system (EpMotion 5075; Eppendorf, Hamberg, Germany). Complementary DNA was synthesized from 400 ng of total RNA using the High Capacity cDNA Synthesis kit (Applied Biosystems, Carlsbad, CA). The cDNA synthesis reactions were set up according to the manufacturer’s instructions. In addition to the components supplied in the kit, 20 U of RNase inhibitor (RNaseOUT; Invitrogen) and 500 nM of oligodTV primer (5′-TTTTTTTTTTTTTTTTV-3′, where V = A, C, and G) were included in the cDNA synthesis reactions. The cDNA synthesis reactions were
incubated at 39°C for 2 h and the reverse transcriptase was subsequently inactivated at 65°C for 20 min. The cDNA stocks were diluted 1:4 with 10 mM Tris (pH 8.0) (Ambion) and stored at −80°C until required.
Real-time PCR Assessment of Gene Expression Levels in Chicken Intestine The stock cDNA (1:4) was diluted a further 5-fold with 10 mM Tris (pH 8.0; Ambion) immediately before use in real-time PCR. For each chicken intestine sample, 10 μL of 1:20 diluted cDNA was combined with 30 μL of SYTO9-based PCR reagent [200 nM dNTPs, 1.33 nM SYTO9, and 1× ROX passive reference dye (Invitrogen), 3.5 mM MgCl2, 1× AmpliTaq Gold buffer, and 0.2 μL AmpliTaq Gold DNA polymerase (Applied Biosystems)]. A 10-μL volume of the cDNA/ SYTO9 mixture was transferred in triplicate to a 384well MicroAmp plate (Applied Biosystems). For each gene assay, the chicken intestine cDNA preparations were examined in conjunction with a 7-point standard curve and a no template control. The standard curve was prepared by pooling a portion of all the 1:4 chicken intestine stock cDNA samples. Standard curves were prepared fresh before each real-time PCR run using 7 consecutive 2-fold dilutions in 10 mM Tris (pH 8.0; Ambion). The dilution series consisted of 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, and 1:512 dilutions of pooled cDNA. Quantitative PCR measurements were performed on 384-well real-time PCR machines (7900HT; Applied Biosystems) using the following cycling parameters: 95°C for 10 min for 1 cycle, 95°C for 15 s, 60°C for 20 s, and 72°C for 40 s for 40 cycles, with data acquisition occurring at the 72°C step.
Table 1. Human reference sequence (Refseq) gene names were used to search the Ensembl and GenBank databases to identify chicken homologs RNA Target2
Gene name
Direction3
Oligonucleotide sequence (5′–3′)
Accession no.
KGF
Keratinocyte growth factor Interleukin 18
TFF2
Trefoil factor 2
TNF-α
Tumour necrosis factor α
MUC2
Mucin 2
MUC5ac
Mucin 5ac
kMUC13
Mucin 13
GAPDH
Glyceraldehyde-3-phosphate dehyrogenase
TBP
TATA-binding protein
GGATTGATAAGCGAGGCAAA CCACTCCTTTGATTGCCACT TGTGTGTGCAGTACGGCTTAG CTTACAAAAGGCATCGCATTC GCTGTAGCCCTCATCAGCTC CTGGCAGCTATTTTGCACTG GAGCGTTGACTTGGCTGTC AAGCAACAACCAGCTATGCAC ATGCGATGTTAACACAGGACTC GTGGAGCACAGCAGACTTTG TGTGGTTGCTATGAGAATGGA TTGCCATGGTTTGTGCAT GCATTCCTCAAGCAGAGGTG CTCAGGCTGCCGTGATATTT TGTGACTTCAATGGTGACAGC GCTATATCCAAACTCATTGTCATACC TCAGCAGCTATGAGCCAGAA CTGCTCGAACTTTAGCACCA
NM_001012525
IL18
F R F R F R F R F R F R F R F R F R
1Real-time
NM_204608 XM_416743 NM_204267 BX930545 ENSGALT000000108674 XM_422104 NM_204305 NM_205103
PCR primers were then designed against the chicken cDNA and genomic DNA sequences identified from these searches. Refseq Gene Symbol. 3F = forward primer; R = reverse primer. 4Ensembl accession number. 2Human
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
en genome browser (Gallus gallus; Build 56 September 2009) were used to design oligonucleotides for the quantitative PCR assays for the following genes: TLR4, KGF, IL-18, TFF2, TNF-α, MUC1, MUC2, MUC4, MUC5ac, MUC5b, MUC13, MUC16 (Table 1). Keyword searches were performed using human reference sequence (Refseq) gene names to identify the corresponding chicken cDNA and genomic DNA sequences. Exon-intron boundaries were manually marked on the chicken cDNA sequences, and suitable pairs of exonintron spanning real-time PCR primers were selected with the Universal Probe Library design software (https://www.roche-appliedscience.com/sis/rtpcr/upl/ index.jsp?id = UP030000). In general, amplicon sizes were kept below 100 base pairs (bp), and primer pairs spanned exon-intron boundaries that were greater than 500 bp in length (Table 1).
1338
Forder et al.
Processing, Normalization, and Statistical Analysis of the Real-Time PCR Data
Mucin Gene Expression Prior to undertaking the qRT-PCR measurements on the intestine samples, several of the genes for which assays were designed were found not to be expressed in the jejunum, these included MUC1, MUC4, MUC5b, and MUC16. Three separate assays were designed for each MUC gene so it is likely that none of these genes are expressed in the jejunum of these birds. The MUC2, MUC5ac, and MUC13 were the only genes examined in this study that were differentially expressed in the jejunum among the treatment groups. Expression of MUC2 was similar between the unchallenged controls and challenged birds treated with antimicrobials. Challenged control birds had MUC2 mRNA levels that were 40 to 54% lower than the unchallenged controls and challenged birds treated with antimicrobials (Figure 1). The intestinal MUC13 mRNA level of unchallenged control birds was 20 to 35% higher compared with challenged groups (Figure 1). Expression of MUC5ac was elevated in birds challenged with Eimeria spp./C. perfringens compared with unchallenged controls (54%). Treatment with antimicrobials resulted in MUC5ac mRNA levels similar to unchallenged controls (Figure 1).
RESULTS
DISCUSSION
Reference Genes Appropriate normalization of the data to a stable set of reference genes is an important consideration for gene expression studies. A total of 7 reference genes were included in this study, 6 of which were quite stably expressed. Out of the 7 reference genes, TATA-binding protein (TBP) was the most stably expressed, and elongation factor 2 (EEF2) the least stably expressed. This analysis identified TBP and GADPH as the best 2 genes for data normalization. Data normalized against these 2 genes were compared with data normalized against the least variable 3 or 6 reference genes and there was little difference between the statistical analyses (data not shown). Therefore, TBP and GAPDH were used to normalize the data.
Proinflammatory Cytokine Response to Eimeria spp./C. perfringens Challenge Genes that regulate goblet cell development, migration, and mucin exocytosis, including trefoil factor 2 (TFF2), keratinocyte growth factor (KGF), IL-18, and TNF-α, and genes involved in microbe-host signaling (toll-like receptor 4; TLR4) were selected for this study. The expression of IL-18, KGF, TFF2, and TNF-α showed no altered response to Eimeria spp./C. perfringens infection or within-feed antimicrobials (P > 0.05; Figure 1). Toll-lie receptor 4 was found to be expressed below the limit of detection threshold and, hence, was not quantified in the intestinal tissue.
It has long been accepted that mucin glycoproteins have been involved in mucosal barrier function through their adhesive properties (Forstner and Forstner, 1994; Freitas et al., 2002) and participation in cell surface signal transduction (Singh and Hollingsworth, 2006; McAuley et al., 2007); however, there have been few studies directed toward their involvement in host defense against NE infection. Elevated mucus secretion as a consequence of Eimeria inoculation was demonstrated to increase the incidence of C. perfringens colonization in chickens, implying that the mucus layer provides a nutritional substrate, favoring growth of the bacterium (Collier et al., 2008). Mucin core peptide genes are responsible for expression of the mucin peptide backbone (Forstner and Forstner, 1994). In the chicken genome, 3 transmembrane mucins (MUC4, MUC13, and MUC16) and 4 secretory mucins (MUC2, MUC5ac, MUC5B, and MUC6) have been identified as sharing homology with human MUC genes (Lang et al., 2006). Expression of these genes is regulated in a tissue-specific manner. For example, MUC2 is observed to be widely expressed in goblet cells of the small intestine and colon, whereas MUC5ac is weakly expressed in the intestine and colon but widely expressed in the stomach (Van Klinken et al., 1995). The differences in expression in regions of the intestinal tract suggest that each mucin has its own specific function in maintaining mucosal integrity. In the present study, MUC2, MUC5ac, and MUC13 were the only genes examined that were differentially expressed among treatments. The MUC2 mucin has
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Real-time PCR data were processed and normalized using in-house computer software, qEXPRESS, which was modeled on the qBase software package (Hellemans et al., 2007). Tab delimitated text files from each realtime PCR run were exported from the SDS 2.3 software (Applied Biosystems) and imported into qEXPRESS. In brief, the reaction efficiency of each gene assay was determined from the standard curve and applied to a ∆Ct quantification model to calculate relative quantities between samples. The nonnormalized relative quantification data were exported from qEXPRESS and imported into the GenEx software package (MultiD, Gothenburg, Sweden), where reference gene stability analyses were performed using the NormFinder application (Andersen et al., 2004). This analysis identified the best pair of reference genes, which were then used to normalize the target gene measurements within qEXPRESS using geometric averaging (Vandesompele et al., 2002). Statistical analyses of the normalized realtime PCR data were performed with a GLM in SAS (v9.1; SAS Institute, Cary, NC). P < 0.05 was considered statistically significant.
GENES ASSOCIATED WITH MUCIN SYNTHESIS
1339
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Figure 1. Relative expression of keratinocyte growth factor (KGF), trefoil factor 2 (TFF2), interleukin 18 (IL-18), TNF-α, mucin (MUC)2, MUC5ac, and MUC13 mRNA levels in the jejunum of the unchallenged/untreated (UU) control chickens and 2 challenged groups: challenged/ untreated (CU) and challenged/zinc bacitracin and monensin (CZ). The UU control group was assigned an arbitrary value of 1.00 and the other 2 groups of challenged chickens were expressed relative to this value. All values are least squares means and the SEM for each treatment group is shown. *Significantly different from UU control group (P < 0.05).
been shown to be important in the establishment of the mucus layer (Johansson et al., 2008). Mice deficient in MUC2 were observed to have aberrant intestinal crypt morphology with altered cell maturation and migration (Van Klinken et al., 1995; Claustre et al., 2002) as well
as increased bacterial adherence to colonocytes spanning deep within the crypts (Johansson et al., 2008). In past poultry studies, expression of ileal MUC2 was increased 2 to 4 d after C. perfringens inoculation and during peak NE infection (Collier et al., 2008). In mice
1340
Forder et al.
(Kim et al., 2008; Park et al., 2008). These findings emphasize the need to measure temporal gene expression during pre- and early C. perfringens infection with and without Eimeria inoculation to determine the precise mechanisms involved in initiating inflammation and mucosal repair. Additionally, as an experimental model of NE was used in the current study, further studies should also focus on understanding the gene expression patterns from birds with field cases of NE. In summary, we have characterized the expression patterns of MUC genes and modulatory genes involved in mucin synthesis in an NE model. Further studies of MUC gene expression and the expression of other genes involved in mucin synthesis and secretion during NE challenge are necessary to advance our understanding of the pathogenesis of this disease and for the development of novel, effective treatments.
ACKNOWLEDGMENTS This research was conducted within the Poultry CRC, established and supported under the Australian Government’s Cooperative Research Centres Program.
REFERENCES Al-Sheikhly, F., and A. Al-Saieg. 1980. Role of Coccidia in the occurrence of necrotic enteritis of chickens. Avian Dis. 24:324–333. Allen, A., A. Bell, M. Mantle, and J. P. Pearson. 1982. The structure and physiology of gastrointestinal mucus. Adv. Exp. Med. Biol. 144:115–133. Andersen, C. L., J. L. Jensen, and T. F. Orntoft. 2004. Normalization of real-time quantitative reverse-transcription PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64:5245–5250. Ashida, H., R. Maki, H. Ozawa, Y. Tani, M. Kiyohara, M. Fujita, A. Imamura, H. Ishida, M. Kiso, and K. Yamamoto. 2008. Characterization of two different endo-alpha-N-acetylgalactosaminidases from probiotic and pathogenic enterobacteria, Bifidobacterium longum and Clostridium perfringens. Glycobiology 18:727–734. Chauhan, S. C., K. Vannatta, M. C. Ebeling, N. Vinayek, A. Watanabe, K. K. Pandey, M. C. Bell, M. D. Koch, H. Aburatani, Y. Lio, and M. Jaggi. 2009. Expression and functions of transmembrane mucin MUC13 in ovarian cancer. Cancer Res. 69:765–774. Claustre, J., F. Toumi, A. Trompette, G. Jourdan, H. Guignard, J. A. Chayvialle, and P. Plaisancie. 2002. Effects of peptides derived from dietary proteins on mucus secretion in rat jejunum. Am. J. Physiol. Gastrointest. Liver Physiol. 283:G521–G528. Collier, C. T., C. L. Hofacre, A. M. Payne, D. B. Anderson, P. Kaiser, R. I. Mackie, and H. R. Gaskins. 2008. Coccidia-induced mucogenesis promotes the onset of necrotic enteritis by supporting Clostridium perfringens growth. Vet. Immunol. Immunopathol. 122:104–115. Cooper, K. K., and J. G. Songer. 2009. Necrotic enteritis in chickens: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15:55–60. Deplancke, B., and H. R. Gaskins. 2001. Microbial modualtion of innate defence: Goblet cells and the intestinal mucus layer. Am. J. Clin. Nutr. 73:1131S–1141S. Forgue-Lafitte, M. E., B. Fabiani, P. P. Levy, N. Maurin, J. F. Flejou, and J. Bara. 2007. Abnormal expression of M1/MUC5AC mucin in distal colon of patients with diverticulitis, ulcerative colitis and cancer. Int. J. Cancer 121:1543–1549. Forstner, G., and J. F. Forstner. 1994. Gastrointestinal mucus. Pages 1255–1283 in Physiology of the Gastrointestinal Tract. 3rd ed. R. Johnson and P. Leonard, ed. New York, NY.
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
infected with C. rodentium, there was no change in MUC2 gene expression in the small intestine, cecum, and proximal colon; however, expression was decreased in the distal colon where inflammation was the greatest (Linden et al., 2008). This decline has also been observed in human cases of Crohn’s disease and ulcerative colitis (Longman et al., 2006; Moehle et al., 2006). Bird mortality in the present trial was 36% from d 14 to 21 (Geier et al., 2010), whereas mortality reported by Collier et al. (2008) was 3.4% for the entire study. Histological analysis of these tissues revealed that Eimeria spp./C. perfringens challenge induced a greater severity of NE resulting in a large shedding of both epithelial and goblet cells (Golder et al., 2011). It could therefore be speculated that as the intestinal mucosa deteriorates, MUC2 expression decreases, preventing mucus layer replenishment and increasing the chance of further infection. Similarly, MUC13, a transmembrane mucin, also exhibited a decrease in mRNA expression in response to Eimeria spp./C. perfringens infection. The MUC13 mucin contains 3 epithelial growth factor-like domains and a cytoplasmic domain containing potential phosphorylation sites, which may play a role in cell signaling, although the exact role of MUC13 in cell signaling pathways is not fully understood (Chauhan et al., 2009; Maher et al., 2011). Expression of MUC13 is reduced in patients with inflammatory bowel disease (Moehle et al., 2006). In this instance, the decrease in expression is likely a consequence of severe shedding of the jejunal mucosa, similar to what was observed for MUC2. In contrast, MUC5ac expression was increased in expression compared with unchallenged controls. Expression of MUC5ac is observed predominantly in the stomach, with little expression observed in the small intestine of healthy humans and rats (Van Klinken et al., 1995). This pattern was also similar in chicken, with the proventriculus having higher expression than the small intestine (Smirnov et al., 2004). It has been demonstrated that under severe stress, there is an abnormal elevation of expression of MUC5ac, as reported in patients with colon cancer and to a lesser extent ulcerative colitis (Forgue-Lafitte et al., 2007). The severity of necrosis detected in these birds may be causative of this change in gene expression, however, further investigation is needed on a larger sample set to determine the validity of these findings. The interaction between MUC genes, TLR genes, IL18, KGF, TFF, and TNF-α during clostridial infection is still unclear. It is known that certain strains of C. perfringens are more pathogenic than others (Timbermont et al., 2009; Keyburn et al., 2010), with secretory toxins having differing effects on inflammatory gene expression (Nagahama et al., 2008; Park et al., 2008; Zhou et al., 2009). It has also been speculated that exposure to Eimeria represses the ability of C. perfringens to induce an effective inflammatory cytokine response, which may consequently contribute to the intensified intestinal damage observed during experimental NE
GENES ASSOCIATED WITH MUCIN SYNTHESIS
McAuley, J. L., S. K. Linden, C. W. Png, R. M. King, H. L. Pennington, S. J. Gendler, T. H. Florin, G. R. Hill, V. Korolik, and M. A. McGuckin. 2007. MUC1 cell surface mucin is a critical element of the mucosal barrier to infection. J. Clin. Invest. 117:2313–2324. McDevitt, R. M., J. D. Brooker, T. Acamovic, and N. H. Sparks. 2006. Necrotic enteritis; A continuing challenge for the poultry industry. World’s Poult. Sci. J. 62:221–247. Moehle, C., N. Ackermann, T. Langmann, C. Aslanidis, A. Kel, O. Kel-Margoulis, A. Schmitz-Madry, A. Zahn, W. Stremmel, and G. Schmitz. 2006. Aberrant intestinal expression and allelic variants of mucin genes associated with inflammatory bowel disease. J. Mol. Med. 84:1055–1066. Nagahama, M., A. Kihara, H. Kintoh, M. Oda, and J. Sakurai. 2008. Involvement of tumour necrosis factor-alpha in Clostridium perfringens beta-toxin-induced plasma extravasation in mice. Br. J. Pharmacol. 153:1296–1302. NRC. 1994. Nutrient Requirements of Poultry. 9th rev. ed. Natl. Acad. Press, Washington, DC. Park, S. S., H. S. Lillehoj, P. C. Allen, D. W. Park, S. FitzCoy, D. A. Bautista, and E. P. Lillehoje. 2008. Immunopathology and cytokine responses in broiler chickens coinfected with Eimeria maxima and Clostridium perfringens with the use of an animal model of necrotic enteritis. Avian Dis. 52:14–22. Robbe, C., C. Capon, E. Maes, M. Rousset, A. Zweibaum, J. P. Zanetta, and J. C. Michalski. 2003. Evidence of regio-specific glycosylation in human intestinal mucins: Presence of an acidic gradient along the intestinal tract. J. Biol. Chem. 278:46337–46348. Singh, P. K., and M. A. Hollingsworth. 2006. Cell surface-associated mucins in signal transduction. Trends Cell Biol. 16:467–476. Smirnov, A., D. Sklan, and Z. Uni. 2004. Mucin dynamics in the chick small intestine are altered by starvation. J. Nutr. 134:736– 742. Timbermont, L., A. Lanckriet, F. Pasmans, F. Haesebrouck, R. Ducatelle, and F. Van Immerseel. 2009. Intra-species growthinhibition by Clostridium perfringens is a possible virulence trait in necrotic enteritis in broilers. Vet. Microbiol. 137:388–391. Van Immerseel, F., J. L. Rood, R. J. Moore, and R. W. Titball. 2009. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 17:32–36. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:1–11. Van Klinken, B. J., B. Jan-Willem, J. Dekker, H. A. Buller, and A. W. C. Einerhand. 1995. Mucin gene structure and expression: Protection vs. adhesion. Am. J. Physiol. 269:G613–G627. Williams, R. B. 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: Rational, integrated disease management by maintenance of gut integrity. Avian Pathol. 34:159–180. Zhou, H., J. Gong, J. Brisbin, H. Yu, A. J. Sarson, W. Si, S. Sharif, and Y. Han. 2009. Transcriptional profiling analysis of host response to Clostridium perfringens infection in broilers. Poult. Sci. 88:1023–1032.
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Freitas, M., L. G. Axelsson, C. Cayuela, T. Midtvedt, and G. Trugnan. 2002. Microbial-host interactions specifically control the glycosylation pattern in intestinal mouse mucosa. Histochem. Cell Biol. 118:149–161. Geier, M. S., L. L. Mikkelsen, V. A. Torok, G. E. Allison, C. G. Olnood, M. Boulianne, R. J. Hughes, and M. Choct. 2010. Comparison of alternatives to in-feed antimicrobials for the prevention of clinical necrotic enteritis. J. Appl. Microbiol. 109:1329–1338. Golder, H. M., M. S. Geier, R. E. A. Forder, P. I. Hynd, and R. J. Hughes. 2011. Effects of necrotic enteritis challenge on intestinal micro-architecture and mucin profile. Br. Poult. Sci. 52:500–506. Grave, K., M. C. Kaldhusdal, H. Kruse, L. M. Harr, and K. Flatlandsmo. 2004. What has happened in Norway after the ban of avoparcin? Consumption of antimicrobials by poultry. Prev. Vet. Med. 62:59–72. Hellemans, J., G. Mortier, A. De Paepe, F. Speleman, and J. Vandesompele. 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 8:R19. Johansson, M. E., M. Phillipson, J. Petersson, A. Velcich, L. Holm, and G. C. Hansson. 2008. The inner of the two Muc2 mucindependent mucus layers in colon is devoid of bacteria. Proc. Natl. Acad. Sci. USA 105:15064–15069. Keyburn, A. L., J. D. Boyce, P. Vaz, T. L. Bannam, M. E. Ford, D. Parker, A. Di Rubbo, J. I. Rood, and R. J. Moore. 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog. 4:e26. Keyburn, A. L., X. X. Yan, T. L. Bannam, F. Van Immerseel, J. I. Rood, and R. J. Moore. 2010. Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin. Vet. Res. 41:21. Kim, D. K., Y. H. Hong, D. W. Park, S. J. Lamont, and H. S. Lillehoj. 2008. Differential immune-related gene expression in two genetically disparate chicken lines during infection by Eimeria maxima. Dev. Biol. (Basel) 132:131–140. Kocher, A., M. Choct, A. Y. Teo, H. M. Tan, and R. R. Carter. 1995. Effectiveness of alternative feed supplements to broiler diets using a necrotic enteritis challenge model. Pages 84–87 in Proc. Aust. Poult. Sci. Symp. Cowieson, A, Camden, NSW, Australia. Lang, T., G. C. Hansson, and T. Samuelsson. 2006. An inventory of mucin genes in the chicken genome shows that the mucin domain of Muc13 is encoded by multiple exons and that ovomucin is part of a locus of related gel-forming mucins. BMC Genomics 7:197. Lindén, S. K., T. H. Florin, and M. A. McGuckin. 2008. Mucin dynamics in intestinal bacterial infection. PLoS ONE 3:e3952. Longman, R. J., R. Poulsom, A. P. Corfield, B. F. Warren, N. A. Wright, and M. G. Thomas. 2006. Alterations in the composition of the supramucosal defense barrier in relation to disease severity of ulcerative colitis. J. Histochem. Cytochem. 54:1335–1348. Lovland, A., and M. Kaldhusdal. 2001. Severely impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathol. 30:73–81. Maher, D. M., B. K. Gupta, S. Nagata, M. Jaggi, and S. C. Chauhan. 2011. Mucin 13: Structure, function and potential roles in cancer pathogenesis. Mol. Cancer Res. 9:531–537.
1341
Key words: necrotic enteritis, mucin, mucosa, intestine, chicken 2012 Poultry Science 91:1335–1341 http://dx.doi.org/10.3382/ps.2011-02062
INTRODUCTION Necrotic enteritis (NE) is one of the world’s most prevalent poultry diseases (Van Immerseel et al., 2009). It is characterized by inflammation and necrosis of the intestinal tract, causing losses in productivity and reduced welfare, with significant flock morbidity and mortality in acute cases (Keyburn et al., 2008; Cooper and Songer, 2009). Necrotic enteritis outbreaks and prevention cost the global poultry industry an estimated $2 billion per year (Lovland and Kaldhusdal, 2001; Van Immerseel et al., 2009) A causative agent of NE is Clostridium perfringens, a spore-forming, gram-positive anaerobe that is a resident of the intestinal tract (Cooper and Songer, 2009). The onset of NE is thought to occur when C. perfringens proliferates to high numbers in the small intestine, releasing toxins that damage the gut. It is well accepted ©2012 Poultry Science Association Inc. Received November 30, 2011. Accepted February 3, 2012. 1 Corresponding author: [email protected]
that predisposing factors, such as coccidial infection and diets high in meatmeal or indigestible soluble fiber, are required to initiate C. perfringens proliferation (AlSheikhly and Al-Saieg, 1980; Williams, 2005; McDevitt et al., 2006). Until recently, intestinal C. perfringens numbers have been controlled by the inclusion of in-feed antimicrobials The legislated removal of in-feed antimicrobials in the United Kingdom and European Union has increased the incidence of NE (Grave et al., 2004; McDevitt, et al., 2006), consequently there is a need for the identification of effective nonantibiotic alternatives for NE prevention (Cooper and Songer, 2009). The first line of defense that bacteria encounter when trying to traverse the intestinal mucosa is the overlying mucus-gel layer. The formation of the mucus-gel is through goblet cell secretion of mucin glycoproteins (Allen et al., 1982; Forstner and Forstner, 1994). Mucins are heterogeneous, highly O-glycosylated glycoproteins with high molecular weights (Claustre et al., 2002; Freitas et al., 2002). They are characterized by a peptide core (coded by the MUC gene family) with 2 regions: a major domain, densely glycosylated O-linked oligosaccharide branches, rich in the amino acids serine,
1335
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
ABSTRACT Clostridial infection of the intestine can result in necrotic enteritis (NE), compromising production and health of poultry. Mucins play a major role in protecting the intestinal epithelium from infection. The relative roles of different mucins in gut pathology following bacterial challenge are unclear. This study was designed to quantify the expression of mucin and mucin-related genes, using intestinal samples from an NE challenge trial where birds were fed diets with or without in-feed antimicrobials. A method for quantifying mucin gene expression was established using a suite of reference genes to normalize expression data. This method was then used to quantify the expression of 11 candidate genes involved in mucin, inflammatory cytokine, or growth factor biosynthesis (IL-18,
1336
Forder et al.
birds were fed starter diets, except for CZ birds that received zinc bacitracin and monensin. Between d 8 and 15 inclusive (before C. perfringens inoculation), birds were fed a 50% (wt/wt) fish meal-based diet (CZ, with antimicrobials included). After d 15, original diets were returned.
Eimeria and C. perfringens Inoculation On d 9, all birds (except unchallenged controls) were given an oral suspension of 2,500 oocysts of E. acervulina, E. maxima, and E. tenella, respectively (Bioproperties Pty Ltd., Glenorie, New South Wales, Australia) in 1 mL of PBS. Unchallenged control birds received sterile PBS in place of Eimeria. On d 15, birds in challenged groups were individually inoculated with 1 mL of C. perfringens EHE-NE18 (CSIRO Australian Animal Health Laboratory, Geelong, Victoria, Australia) suspended in thioglycollate broth (USP alternative, Oxoid, Hampshire, UK) at a concentration of 3.5 × 108 cfu/mL. Unchallenged control birds received 1 mL of sterile thioglycollate broth.
Tissue Collection On d 18, from 36 birds (n = 12 birds/treatment), a 2-cm segment from the midpoint of the jejunum was removed, rinsed in PBS, with 1 cm placed in 2 mL of RNAlater (Ambion, Carlsbad, CA) for gene expression analyses.
Isolation and Quantification of Total RNA from Chicken Intestine Samples
In total, 1,200 male Cobb 500 broiler chickens (Baiada Hatchery, Kootingal, New South Wales, Australia) were raised in floor pens in a temperature-controlled room at the University of New England (Armidale, New South Wales, Australia). All procedures were approved by the Animal Ethics Committee of the University of New England. All experimental diets were based on a standard commercial starter diet with no added in-feed antimicrobials or coccidiostats (Ridley Agriproducts, Tamworth, New South Wales, Australia) and met or exceeded NRC guidelines (NRC, 1994). The 3 experimental groups were an unchallenged control (UU), an Eimeria spp./C. perfringens-challenged control (CU), and Eimeria spp./C. perfringens-challenged groups treated with antimicrobials (45 ppm zinc bacitracin and 100 ppm monensin; CZ).
Total RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany). Intestinal samples were removed from RNAlater (Ambion) and 50 to 100 mg of each sample homogenized with an Ultra-Turrax (T25; IKA-Werke GmbH and Co. KG, Staufen, Germany) in 2 mL of Trizol reagent (Invitrogen, Carlsbad, CA). The upper aqueous phase of Trizol was recovered from the homogenized samples as per the manufacturer’s instructions. The aqueous phase was mixed with an equivalent volume of 70% ethanol, loaded onto RNeasy mini columns, and centrifuged at 8,000 × g for 1 min at room temperature (Mikro200; Andreas Hettich GmbH and Co. KG, Tuttlingen, Germany). Following this centrifugation step, RNeasy columns were processed according to the manufacturer’s instructions. An on-column RNase-free DNase treatment step (Qiagen) was included and the RNA was eluted in 50 μL of EB buffer (Qiagen). The concentration and purity of total RNA was determined using UV spectrophotometry (Nanodrop 1000; Thermo Scientific, Wilmington, DE). The integrity of all RNA samples was confirmed via agarose-gel elctrophoresis.
NE Challenge Procedure
Design and Testing of Real-Time PCR Assays Targeting Chicken Genes
The NE challenge was performed as described previously (Kocher et al., 1995). From placement until d 7,
The GenBank (National Centre for Biotechnology Information; NCBI) database and the Ensembl chick-
MATERIALS AND METHODS NE Challenge and Tissue Collection
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
threonine, and proline (Forstner and Forstner, 1994; Van Klinken et al., 1995), and a minor portion, poorly or nonglycosylated, rich in cysteine located at the Cand N-terminal regions of the core protein (Claustre et al., 2002). Mucins possess potential binding sites for both commensal and pathogenic organisms and can be discharged in response to a wide variety of stimuli with the potential for changes in the type and quality of mucin secreted (Van Klinken et al., 1995; Freitas et al., 2002). Increasing interest has been directed toward the protective properties of mucin as a barrier against epithelial attachment, and the mechanisms by which bacteria can utilize these mucin glycoproteins to facilitate adhesion and colonization (Deplancke and Gaskins, 2001; Robbe et al., 2003). This is important as a means to understand their involvement in the pathogenesis of intestinal diseases and to use and optimize their protective properties for enhanced intestinal barrier function. To maximize the efficacies of potential nonantibiotic alternatives, it is necessary to understand how C. perfringens colonize the gut and how it affects mucosal dynamics, especially the interaction with the mucus layer. Currently, the role of mucins and the mucus layer in C. perfringens infection is still elusive, with studies suggesting that specific mucin structures provide a growth advantage to the species (Ashida et al., 2008; Collier et al., 2008). The present study aimed to develop a series of real-time PCR-based assays to study intestinal MUC gene expression as well as genes involved in intestinal inflammation and regulation of MUC gene expression and goblet cell mucin secretion in broiler chickens challenged with C. perfringens.
1337
GENES ASSOCIATED WITH MUCIN SYNTHESIS
Synthesis of cDNA from Chicken Intestine RNA The concentration of all chicken intestine RNA samples was normalized to 40 ng/μL with the aid of a liquid-handling robotics system (EpMotion 5075; Eppendorf, Hamberg, Germany). Complementary DNA was synthesized from 400 ng of total RNA using the High Capacity cDNA Synthesis kit (Applied Biosystems, Carlsbad, CA). The cDNA synthesis reactions were set up according to the manufacturer’s instructions. In addition to the components supplied in the kit, 20 U of RNase inhibitor (RNaseOUT; Invitrogen) and 500 nM of oligodTV primer (5′-TTTTTTTTTTTTTTTTV-3′, where V = A, C, and G) were included in the cDNA synthesis reactions. The cDNA synthesis reactions were
incubated at 39°C for 2 h and the reverse transcriptase was subsequently inactivated at 65°C for 20 min. The cDNA stocks were diluted 1:4 with 10 mM Tris (pH 8.0) (Ambion) and stored at −80°C until required.
Real-time PCR Assessment of Gene Expression Levels in Chicken Intestine The stock cDNA (1:4) was diluted a further 5-fold with 10 mM Tris (pH 8.0; Ambion) immediately before use in real-time PCR. For each chicken intestine sample, 10 μL of 1:20 diluted cDNA was combined with 30 μL of SYTO9-based PCR reagent [200 nM dNTPs, 1.33 nM SYTO9, and 1× ROX passive reference dye (Invitrogen), 3.5 mM MgCl2, 1× AmpliTaq Gold buffer, and 0.2 μL AmpliTaq Gold DNA polymerase (Applied Biosystems)]. A 10-μL volume of the cDNA/ SYTO9 mixture was transferred in triplicate to a 384well MicroAmp plate (Applied Biosystems). For each gene assay, the chicken intestine cDNA preparations were examined in conjunction with a 7-point standard curve and a no template control. The standard curve was prepared by pooling a portion of all the 1:4 chicken intestine stock cDNA samples. Standard curves were prepared fresh before each real-time PCR run using 7 consecutive 2-fold dilutions in 10 mM Tris (pH 8.0; Ambion). The dilution series consisted of 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, and 1:512 dilutions of pooled cDNA. Quantitative PCR measurements were performed on 384-well real-time PCR machines (7900HT; Applied Biosystems) using the following cycling parameters: 95°C for 10 min for 1 cycle, 95°C for 15 s, 60°C for 20 s, and 72°C for 40 s for 40 cycles, with data acquisition occurring at the 72°C step.
Table 1. Human reference sequence (Refseq) gene names were used to search the Ensembl and GenBank databases to identify chicken homologs RNA Target2
Gene name
Direction3
Oligonucleotide sequence (5′–3′)
Accession no.
KGF
Keratinocyte growth factor Interleukin 18
TFF2
Trefoil factor 2
TNF-α
Tumour necrosis factor α
MUC2
Mucin 2
MUC5ac
Mucin 5ac
kMUC13
Mucin 13
GAPDH
Glyceraldehyde-3-phosphate dehyrogenase
TBP
TATA-binding protein
GGATTGATAAGCGAGGCAAA CCACTCCTTTGATTGCCACT TGTGTGTGCAGTACGGCTTAG CTTACAAAAGGCATCGCATTC GCTGTAGCCCTCATCAGCTC CTGGCAGCTATTTTGCACTG GAGCGTTGACTTGGCTGTC AAGCAACAACCAGCTATGCAC ATGCGATGTTAACACAGGACTC GTGGAGCACAGCAGACTTTG TGTGGTTGCTATGAGAATGGA TTGCCATGGTTTGTGCAT GCATTCCTCAAGCAGAGGTG CTCAGGCTGCCGTGATATTT TGTGACTTCAATGGTGACAGC GCTATATCCAAACTCATTGTCATACC TCAGCAGCTATGAGCCAGAA CTGCTCGAACTTTAGCACCA
NM_001012525
IL18
F R F R F R F R F R F R F R F R F R
1Real-time
NM_204608 XM_416743 NM_204267 BX930545 ENSGALT000000108674 XM_422104 NM_204305 NM_205103
PCR primers were then designed against the chicken cDNA and genomic DNA sequences identified from these searches. Refseq Gene Symbol. 3F = forward primer; R = reverse primer. 4Ensembl accession number. 2Human
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
en genome browser (Gallus gallus; Build 56 September 2009) were used to design oligonucleotides for the quantitative PCR assays for the following genes: TLR4, KGF, IL-18, TFF2, TNF-α, MUC1, MUC2, MUC4, MUC5ac, MUC5b, MUC13, MUC16 (Table 1). Keyword searches were performed using human reference sequence (Refseq) gene names to identify the corresponding chicken cDNA and genomic DNA sequences. Exon-intron boundaries were manually marked on the chicken cDNA sequences, and suitable pairs of exonintron spanning real-time PCR primers were selected with the Universal Probe Library design software (https://www.roche-appliedscience.com/sis/rtpcr/upl/ index.jsp?id = UP030000). In general, amplicon sizes were kept below 100 base pairs (bp), and primer pairs spanned exon-intron boundaries that were greater than 500 bp in length (Table 1).
1338
Forder et al.
Processing, Normalization, and Statistical Analysis of the Real-Time PCR Data
Mucin Gene Expression Prior to undertaking the qRT-PCR measurements on the intestine samples, several of the genes for which assays were designed were found not to be expressed in the jejunum, these included MUC1, MUC4, MUC5b, and MUC16. Three separate assays were designed for each MUC gene so it is likely that none of these genes are expressed in the jejunum of these birds. The MUC2, MUC5ac, and MUC13 were the only genes examined in this study that were differentially expressed in the jejunum among the treatment groups. Expression of MUC2 was similar between the unchallenged controls and challenged birds treated with antimicrobials. Challenged control birds had MUC2 mRNA levels that were 40 to 54% lower than the unchallenged controls and challenged birds treated with antimicrobials (Figure 1). The intestinal MUC13 mRNA level of unchallenged control birds was 20 to 35% higher compared with challenged groups (Figure 1). Expression of MUC5ac was elevated in birds challenged with Eimeria spp./C. perfringens compared with unchallenged controls (54%). Treatment with antimicrobials resulted in MUC5ac mRNA levels similar to unchallenged controls (Figure 1).
RESULTS
DISCUSSION
Reference Genes Appropriate normalization of the data to a stable set of reference genes is an important consideration for gene expression studies. A total of 7 reference genes were included in this study, 6 of which were quite stably expressed. Out of the 7 reference genes, TATA-binding protein (TBP) was the most stably expressed, and elongation factor 2 (EEF2) the least stably expressed. This analysis identified TBP and GADPH as the best 2 genes for data normalization. Data normalized against these 2 genes were compared with data normalized against the least variable 3 or 6 reference genes and there was little difference between the statistical analyses (data not shown). Therefore, TBP and GAPDH were used to normalize the data.
Proinflammatory Cytokine Response to Eimeria spp./C. perfringens Challenge Genes that regulate goblet cell development, migration, and mucin exocytosis, including trefoil factor 2 (TFF2), keratinocyte growth factor (KGF), IL-18, and TNF-α, and genes involved in microbe-host signaling (toll-like receptor 4; TLR4) were selected for this study. The expression of IL-18, KGF, TFF2, and TNF-α showed no altered response to Eimeria spp./C. perfringens infection or within-feed antimicrobials (P > 0.05; Figure 1). Toll-lie receptor 4 was found to be expressed below the limit of detection threshold and, hence, was not quantified in the intestinal tissue.
It has long been accepted that mucin glycoproteins have been involved in mucosal barrier function through their adhesive properties (Forstner and Forstner, 1994; Freitas et al., 2002) and participation in cell surface signal transduction (Singh and Hollingsworth, 2006; McAuley et al., 2007); however, there have been few studies directed toward their involvement in host defense against NE infection. Elevated mucus secretion as a consequence of Eimeria inoculation was demonstrated to increase the incidence of C. perfringens colonization in chickens, implying that the mucus layer provides a nutritional substrate, favoring growth of the bacterium (Collier et al., 2008). Mucin core peptide genes are responsible for expression of the mucin peptide backbone (Forstner and Forstner, 1994). In the chicken genome, 3 transmembrane mucins (MUC4, MUC13, and MUC16) and 4 secretory mucins (MUC2, MUC5ac, MUC5B, and MUC6) have been identified as sharing homology with human MUC genes (Lang et al., 2006). Expression of these genes is regulated in a tissue-specific manner. For example, MUC2 is observed to be widely expressed in goblet cells of the small intestine and colon, whereas MUC5ac is weakly expressed in the intestine and colon but widely expressed in the stomach (Van Klinken et al., 1995). The differences in expression in regions of the intestinal tract suggest that each mucin has its own specific function in maintaining mucosal integrity. In the present study, MUC2, MUC5ac, and MUC13 were the only genes examined that were differentially expressed among treatments. The MUC2 mucin has
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Real-time PCR data were processed and normalized using in-house computer software, qEXPRESS, which was modeled on the qBase software package (Hellemans et al., 2007). Tab delimitated text files from each realtime PCR run were exported from the SDS 2.3 software (Applied Biosystems) and imported into qEXPRESS. In brief, the reaction efficiency of each gene assay was determined from the standard curve and applied to a ∆Ct quantification model to calculate relative quantities between samples. The nonnormalized relative quantification data were exported from qEXPRESS and imported into the GenEx software package (MultiD, Gothenburg, Sweden), where reference gene stability analyses were performed using the NormFinder application (Andersen et al., 2004). This analysis identified the best pair of reference genes, which were then used to normalize the target gene measurements within qEXPRESS using geometric averaging (Vandesompele et al., 2002). Statistical analyses of the normalized realtime PCR data were performed with a GLM in SAS (v9.1; SAS Institute, Cary, NC). P < 0.05 was considered statistically significant.
GENES ASSOCIATED WITH MUCIN SYNTHESIS
1339
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Figure 1. Relative expression of keratinocyte growth factor (KGF), trefoil factor 2 (TFF2), interleukin 18 (IL-18), TNF-α, mucin (MUC)2, MUC5ac, and MUC13 mRNA levels in the jejunum of the unchallenged/untreated (UU) control chickens and 2 challenged groups: challenged/ untreated (CU) and challenged/zinc bacitracin and monensin (CZ). The UU control group was assigned an arbitrary value of 1.00 and the other 2 groups of challenged chickens were expressed relative to this value. All values are least squares means and the SEM for each treatment group is shown. *Significantly different from UU control group (P < 0.05).
been shown to be important in the establishment of the mucus layer (Johansson et al., 2008). Mice deficient in MUC2 were observed to have aberrant intestinal crypt morphology with altered cell maturation and migration (Van Klinken et al., 1995; Claustre et al., 2002) as well
as increased bacterial adherence to colonocytes spanning deep within the crypts (Johansson et al., 2008). In past poultry studies, expression of ileal MUC2 was increased 2 to 4 d after C. perfringens inoculation and during peak NE infection (Collier et al., 2008). In mice
1340
Forder et al.
(Kim et al., 2008; Park et al., 2008). These findings emphasize the need to measure temporal gene expression during pre- and early C. perfringens infection with and without Eimeria inoculation to determine the precise mechanisms involved in initiating inflammation and mucosal repair. Additionally, as an experimental model of NE was used in the current study, further studies should also focus on understanding the gene expression patterns from birds with field cases of NE. In summary, we have characterized the expression patterns of MUC genes and modulatory genes involved in mucin synthesis in an NE model. Further studies of MUC gene expression and the expression of other genes involved in mucin synthesis and secretion during NE challenge are necessary to advance our understanding of the pathogenesis of this disease and for the development of novel, effective treatments.
ACKNOWLEDGMENTS This research was conducted within the Poultry CRC, established and supported under the Australian Government’s Cooperative Research Centres Program.
REFERENCES Al-Sheikhly, F., and A. Al-Saieg. 1980. Role of Coccidia in the occurrence of necrotic enteritis of chickens. Avian Dis. 24:324–333. Allen, A., A. Bell, M. Mantle, and J. P. Pearson. 1982. The structure and physiology of gastrointestinal mucus. Adv. Exp. Med. Biol. 144:115–133. Andersen, C. L., J. L. Jensen, and T. F. Orntoft. 2004. Normalization of real-time quantitative reverse-transcription PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64:5245–5250. Ashida, H., R. Maki, H. Ozawa, Y. Tani, M. Kiyohara, M. Fujita, A. Imamura, H. Ishida, M. Kiso, and K. Yamamoto. 2008. Characterization of two different endo-alpha-N-acetylgalactosaminidases from probiotic and pathogenic enterobacteria, Bifidobacterium longum and Clostridium perfringens. Glycobiology 18:727–734. Chauhan, S. C., K. Vannatta, M. C. Ebeling, N. Vinayek, A. Watanabe, K. K. Pandey, M. C. Bell, M. D. Koch, H. Aburatani, Y. Lio, and M. Jaggi. 2009. Expression and functions of transmembrane mucin MUC13 in ovarian cancer. Cancer Res. 69:765–774. Claustre, J., F. Toumi, A. Trompette, G. Jourdan, H. Guignard, J. A. Chayvialle, and P. Plaisancie. 2002. Effects of peptides derived from dietary proteins on mucus secretion in rat jejunum. Am. J. Physiol. Gastrointest. Liver Physiol. 283:G521–G528. Collier, C. T., C. L. Hofacre, A. M. Payne, D. B. Anderson, P. Kaiser, R. I. Mackie, and H. R. Gaskins. 2008. Coccidia-induced mucogenesis promotes the onset of necrotic enteritis by supporting Clostridium perfringens growth. Vet. Immunol. Immunopathol. 122:104–115. Cooper, K. K., and J. G. Songer. 2009. Necrotic enteritis in chickens: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15:55–60. Deplancke, B., and H. R. Gaskins. 2001. Microbial modualtion of innate defence: Goblet cells and the intestinal mucus layer. Am. J. Clin. Nutr. 73:1131S–1141S. Forgue-Lafitte, M. E., B. Fabiani, P. P. Levy, N. Maurin, J. F. Flejou, and J. Bara. 2007. Abnormal expression of M1/MUC5AC mucin in distal colon of patients with diverticulitis, ulcerative colitis and cancer. Int. J. Cancer 121:1543–1549. Forstner, G., and J. F. Forstner. 1994. Gastrointestinal mucus. Pages 1255–1283 in Physiology of the Gastrointestinal Tract. 3rd ed. R. Johnson and P. Leonard, ed. New York, NY.
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
infected with C. rodentium, there was no change in MUC2 gene expression in the small intestine, cecum, and proximal colon; however, expression was decreased in the distal colon where inflammation was the greatest (Linden et al., 2008). This decline has also been observed in human cases of Crohn’s disease and ulcerative colitis (Longman et al., 2006; Moehle et al., 2006). Bird mortality in the present trial was 36% from d 14 to 21 (Geier et al., 2010), whereas mortality reported by Collier et al. (2008) was 3.4% for the entire study. Histological analysis of these tissues revealed that Eimeria spp./C. perfringens challenge induced a greater severity of NE resulting in a large shedding of both epithelial and goblet cells (Golder et al., 2011). It could therefore be speculated that as the intestinal mucosa deteriorates, MUC2 expression decreases, preventing mucus layer replenishment and increasing the chance of further infection. Similarly, MUC13, a transmembrane mucin, also exhibited a decrease in mRNA expression in response to Eimeria spp./C. perfringens infection. The MUC13 mucin contains 3 epithelial growth factor-like domains and a cytoplasmic domain containing potential phosphorylation sites, which may play a role in cell signaling, although the exact role of MUC13 in cell signaling pathways is not fully understood (Chauhan et al., 2009; Maher et al., 2011). Expression of MUC13 is reduced in patients with inflammatory bowel disease (Moehle et al., 2006). In this instance, the decrease in expression is likely a consequence of severe shedding of the jejunal mucosa, similar to what was observed for MUC2. In contrast, MUC5ac expression was increased in expression compared with unchallenged controls. Expression of MUC5ac is observed predominantly in the stomach, with little expression observed in the small intestine of healthy humans and rats (Van Klinken et al., 1995). This pattern was also similar in chicken, with the proventriculus having higher expression than the small intestine (Smirnov et al., 2004). It has been demonstrated that under severe stress, there is an abnormal elevation of expression of MUC5ac, as reported in patients with colon cancer and to a lesser extent ulcerative colitis (Forgue-Lafitte et al., 2007). The severity of necrosis detected in these birds may be causative of this change in gene expression, however, further investigation is needed on a larger sample set to determine the validity of these findings. The interaction between MUC genes, TLR genes, IL18, KGF, TFF, and TNF-α during clostridial infection is still unclear. It is known that certain strains of C. perfringens are more pathogenic than others (Timbermont et al., 2009; Keyburn et al., 2010), with secretory toxins having differing effects on inflammatory gene expression (Nagahama et al., 2008; Park et al., 2008; Zhou et al., 2009). It has also been speculated that exposure to Eimeria represses the ability of C. perfringens to induce an effective inflammatory cytokine response, which may consequently contribute to the intensified intestinal damage observed during experimental NE
GENES ASSOCIATED WITH MUCIN SYNTHESIS
McAuley, J. L., S. K. Linden, C. W. Png, R. M. King, H. L. Pennington, S. J. Gendler, T. H. Florin, G. R. Hill, V. Korolik, and M. A. McGuckin. 2007. MUC1 cell surface mucin is a critical element of the mucosal barrier to infection. J. Clin. Invest. 117:2313–2324. McDevitt, R. M., J. D. Brooker, T. Acamovic, and N. H. Sparks. 2006. Necrotic enteritis; A continuing challenge for the poultry industry. World’s Poult. Sci. J. 62:221–247. Moehle, C., N. Ackermann, T. Langmann, C. Aslanidis, A. Kel, O. Kel-Margoulis, A. Schmitz-Madry, A. Zahn, W. Stremmel, and G. Schmitz. 2006. Aberrant intestinal expression and allelic variants of mucin genes associated with inflammatory bowel disease. J. Mol. Med. 84:1055–1066. Nagahama, M., A. Kihara, H. Kintoh, M. Oda, and J. Sakurai. 2008. Involvement of tumour necrosis factor-alpha in Clostridium perfringens beta-toxin-induced plasma extravasation in mice. Br. J. Pharmacol. 153:1296–1302. NRC. 1994. Nutrient Requirements of Poultry. 9th rev. ed. Natl. Acad. Press, Washington, DC. Park, S. S., H. S. Lillehoj, P. C. Allen, D. W. Park, S. FitzCoy, D. A. Bautista, and E. P. Lillehoje. 2008. Immunopathology and cytokine responses in broiler chickens coinfected with Eimeria maxima and Clostridium perfringens with the use of an animal model of necrotic enteritis. Avian Dis. 52:14–22. Robbe, C., C. Capon, E. Maes, M. Rousset, A. Zweibaum, J. P. Zanetta, and J. C. Michalski. 2003. Evidence of regio-specific glycosylation in human intestinal mucins: Presence of an acidic gradient along the intestinal tract. J. Biol. Chem. 278:46337–46348. Singh, P. K., and M. A. Hollingsworth. 2006. Cell surface-associated mucins in signal transduction. Trends Cell Biol. 16:467–476. Smirnov, A., D. Sklan, and Z. Uni. 2004. Mucin dynamics in the chick small intestine are altered by starvation. J. Nutr. 134:736– 742. Timbermont, L., A. Lanckriet, F. Pasmans, F. Haesebrouck, R. Ducatelle, and F. Van Immerseel. 2009. Intra-species growthinhibition by Clostridium perfringens is a possible virulence trait in necrotic enteritis in broilers. Vet. Microbiol. 137:388–391. Van Immerseel, F., J. L. Rood, R. J. Moore, and R. W. Titball. 2009. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 17:32–36. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:1–11. Van Klinken, B. J., B. Jan-Willem, J. Dekker, H. A. Buller, and A. W. C. Einerhand. 1995. Mucin gene structure and expression: Protection vs. adhesion. Am. J. Physiol. 269:G613–G627. Williams, R. B. 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: Rational, integrated disease management by maintenance of gut integrity. Avian Pathol. 34:159–180. Zhou, H., J. Gong, J. Brisbin, H. Yu, A. J. Sarson, W. Si, S. Sharif, and Y. Han. 2009. Transcriptional profiling analysis of host response to Clostridium perfringens infection in broilers. Poult. Sci. 88:1023–1032.
Downloaded from http://ps.oxfordjournals.org/ at New York University on February 1, 2015
Freitas, M., L. G. Axelsson, C. Cayuela, T. Midtvedt, and G. Trugnan. 2002. Microbial-host interactions specifically control the glycosylation pattern in intestinal mouse mucosa. Histochem. Cell Biol. 118:149–161. Geier, M. S., L. L. Mikkelsen, V. A. Torok, G. E. Allison, C. G. Olnood, M. Boulianne, R. J. Hughes, and M. Choct. 2010. Comparison of alternatives to in-feed antimicrobials for the prevention of clinical necrotic enteritis. J. Appl. Microbiol. 109:1329–1338. Golder, H. M., M. S. Geier, R. E. A. Forder, P. I. Hynd, and R. J. Hughes. 2011. Effects of necrotic enteritis challenge on intestinal micro-architecture and mucin profile. Br. Poult. Sci. 52:500–506. Grave, K., M. C. Kaldhusdal, H. Kruse, L. M. Harr, and K. Flatlandsmo. 2004. What has happened in Norway after the ban of avoparcin? Consumption of antimicrobials by poultry. Prev. Vet. Med. 62:59–72. Hellemans, J., G. Mortier, A. De Paepe, F. Speleman, and J. Vandesompele. 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 8:R19. Johansson, M. E., M. Phillipson, J. Petersson, A. Velcich, L. Holm, and G. C. Hansson. 2008. The inner of the two Muc2 mucindependent mucus layers in colon is devoid of bacteria. Proc. Natl. Acad. Sci. USA 105:15064–15069. Keyburn, A. L., J. D. Boyce, P. Vaz, T. L. Bannam, M. E. Ford, D. Parker, A. Di Rubbo, J. I. Rood, and R. J. Moore. 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog. 4:e26. Keyburn, A. L., X. X. Yan, T. L. Bannam, F. Van Immerseel, J. I. Rood, and R. J. Moore. 2010. Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin. Vet. Res. 41:21. Kim, D. K., Y. H. Hong, D. W. Park, S. J. Lamont, and H. S. Lillehoj. 2008. Differential immune-related gene expression in two genetically disparate chicken lines during infection by Eimeria maxima. Dev. Biol. (Basel) 132:131–140. Kocher, A., M. Choct, A. Y. Teo, H. M. Tan, and R. R. Carter. 1995. Effectiveness of alternative feed supplements to broiler diets using a necrotic enteritis challenge model. Pages 84–87 in Proc. Aust. Poult. Sci. Symp. Cowieson, A, Camden, NSW, Australia. Lang, T., G. C. Hansson, and T. Samuelsson. 2006. An inventory of mucin genes in the chicken genome shows that the mucin domain of Muc13 is encoded by multiple exons and that ovomucin is part of a locus of related gel-forming mucins. BMC Genomics 7:197. Lindén, S. K., T. H. Florin, and M. A. McGuckin. 2008. Mucin dynamics in intestinal bacterial infection. PLoS ONE 3:e3952. Longman, R. J., R. Poulsom, A. P. Corfield, B. F. Warren, N. A. Wright, and M. G. Thomas. 2006. Alterations in the composition of the supramucosal defense barrier in relation to disease severity of ulcerative colitis. J. Histochem. Cytochem. 54:1335–1348. Lovland, A., and M. Kaldhusdal. 2001. Severely impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathol. 30:73–81. Maher, D. M., B. K. Gupta, S. Nagata, M. Jaggi, and S. C. Chauhan. 2011. Mucin 13: Structure, function and potential roles in cancer pathogenesis. Mol. Cancer Res. 9:531–537.
1341