Quantitative detection and identification of tyramine-producing enterococci and lactobacilli in cheese by multiplex qPCR

Food Microbiology 27 (2010) 933e939

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Quantitative detection and identification of tyramine-producing enterococci and lactobacilli in cheese by multiplex qPCR Victor Ladero, María Fernández, Isabel Cuesta, Miguel A. Alvarez* Instituto de Productos Lácteos de Asturias (IPLA-CSIC), Carretera de Infiesto s/n, 33300 Villaviciosa, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 March 2010 Received in revised form 25 May 2010 Accepted 25 May 2010 Available online 2 June 2010

Tyramine is the most abundant biogenic amine in fermented dairy products, in which it is produced through the microbial enzymatic decarboxylation of tyrosine. This activity has been detected in a variety of lactic acid bacteria mainly belonging to the genera Enterococcus and Lactobacillus. This paper describes a culture-independent qPCR method, based on the specific amplification of the tdc gene, for the detection, quantification and identification of bacteria with the ability to produce tyramine. This method was found to be specific and to show a wide dynamic range, thus allowing the quantification of these tdc þ bacterial groups among the complex microbiota of cheese. tdc qPCR was used to follow the development of tdcþ microbiota during the manufacture of a blue-veined cheese (Cabrales) made from raw milk. In this type of cheese, tdcþ enterococci seem to be responsible for the high concentrations of tyramine detected. The method was also used to identify and quantify tdcþ enterococci and lactobacilli in 18 commercially available cheeses. Different types and numbers of these microorganisms were found. Their relationships with the concentration of tyramine and technological factors are discussed. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Biogenic amines Tyramine Enterococci Lactobacilli Cheese RP-HPLC qPCR

1. Introduction Cheeses possess very rich, diverse and complex microbiota that invests them with their organoleptic properties and affect their quality. This microbiota is initially derived from starter bacteria, the main function of which is to produce lactic acid at an appropriate rate. However, during manufacture and ripening a complex secondary microbiota (non-starter lactic acid bacteria [NSLAB]) develops (Beresford and Williams, 2004). Both starter and NSLAB microorganisms contribute to the physico-chemical changes that occur in ripening cheese, which gradually acquires the organoleptic characteristics desired (Jany and Barbier, 2008). The influence of the starter and NSLAB strain characteristics (acidification capacity, phage insensitivity, antimicrobial activity and flavour production) on the final quality of cheese has been the subject of several studies. The presence of strains that produce toxic compounds such as tyramine, however, means the consumption of a final product may not be recommendable, especially by certain sectors of the population. Tyramine is the most important biogenic amine (BA) in fermented dairy products, both in terms of the frequency with which it is detected and the concentrations it reaches. In addition, it is also one of the most biologically active of all BAs. In fact, the term * Corresponding author. Tel.: þ34 985 89 21 31; fax: þ34 985 89 22 32. E-mail address: [email protected] (M.A. Alvarez). 0740-0020/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fm.2010.05.026

“cheese reaction” was coined to refer to it (ten Brink et al., 1990). Cheese can accumulate tyramine at concentrations surpassing 1 g kg1 (Fernández et al., 2007). The ingestion of foods containing large amounts of tyramine has toxicological effects (Stratton et al., 1991), causing symptoms such as migraine and hypertension. These may be especially severe in individuals with an impaired detoxification system (Bodmer et al., 1999). Tyramine is produced in dairy products through the microbial enzymatic decarboxylation of tyrosine. Tyramine biosynthesis capability has been detected in a variety of LAB, including several strains of enterococci and lactobacilli that are present during the manufacture of most cheeses (Joosten and Northolt, 1987; Rea et al., 2004; Komprda et al., 2008). These can be present in the raw milk or in the starter culture, and develop as secondary microbiota during the fermentation process (Novella-Rodríguez et al., 2002). Some authors relate high enterococci counts in milk to the later presence of large quantities of tyramine in cheese (Joosten and Northolt, 1987). In fact, the capacity to decarboxylate tyrosine to tyramine is a general characteristic of the strains belonging to the species Enterococcus faecalis (Marcobal et al., 2004). In addition, several isolates of Lactobacillus brevis and Lactobacillus curvatus, both considered to be NSLAB, have been identified as tyramine producers in fermented products (Roig-Sagués et al., 1999, 2002; Komprda et al., 2008). So far, the relative contribution of each genus e Enterococcus and Lactobacillus e remains unknown.

934

V. Ladero et al. / Food Microbiology 27 (2010) 933e939

The interest in producing safer and higher quality dairy foods explains the effort made in recent years to develop methods for detecting tyramine-producing microorganisms (Marcobal et al., 2006). However, these methods are commonly long and tedious, require the isolation of microorganisms, and do not allow for the identification of microorganisms without several extra microbiological or enzymatic tests being performed. Fortunately, the increasing number of sequences and genomes deposited in public databases, especially those regarding the tyrosine decarboxylation genes of the LAB, has allowed the development of molecular methods to detect their presence (Landete et al., 2007). These culture-independent methods are specific, sensitive and rapid, and are subject to less variability than phenotypic characterization. They suffer the drawback that they are not quantitative, but recently a quantitative Real Time PCR (qPCR) assay was described that allows the quantification of tyramine-producing microorganisms in cheese (Ladero et al., 2010). This method does not, however, provide the taxonomic identification of the bacteria found e information of obvious interest in the design of protocols to reduce BA accumulation in foods. The present study proposes a qPCR method for the identification and quantification of tyramine-producing LAB directly in media, milk and dairy products. The proposed method was used to quantify the presence and relative numbers of enterococci and lactobacilli tyramine-producing strains during the manufacture of different commercial cheeses. Their relationship with the concentration of tyramine and the production process is discussed. 2. Materials and methods 2.1. Bacterial strains and culture conditions Table 1 lists the reference bacterial strains tested in this work. Lactobacilli were grown at 37  C in MRS (Oxoid, UK), while Enterococcus and Lactococcus were grown at 30  C in M17 (Oxoid, UK) supplemented with 0.5% (w/v) glucose and lactose. Escherichia coli, used as the recipient for plasmid extraction, was grown at 37  C in LB with aeration. The individual capacity of each LAB strain to produce tyramine has been previously demonstrated (Ladero et al., 2010).

taken at different times over the manufacturing process, i.e., from milk, curd, and at different stages during ripening, from two independent batches. Eighteen commercially available cheeses (Table 2) were later selected based on the type of milk used in their production (raw or pasteurised) for analyses of the quantity and type of tyramineproducing microorganisms they contained, and the tyramine concentrations reached. 2.3. DNA extraction Total DNA of the LAB strains grown in broth was extracted using the Genomic DNA Purification Kit (Sigma, UK) according to the manufacturer’s recommendations. Plasmid DNA, used as a standard in qPCR, was extracted using the Plasmid Purification Kit (Roche, Germany) following the manufacturer’s instructions. Microbial DNA from milk, curd and cheese was extracted following the method of Ogier et al. (2002), as described by Fernández et al. (2006). 2.4. qPCR analysis qPCR was performed using the SYBR Green PCR Master Mix kit (Applied Biosystems, UK) with primers QtdcEF and QtdcER, QtdcLBF and QtdcLBR, and QtdcLcF and QtdcLCR. These were specifically designed to detect the Enterococcus sp, L. brevis and L. curvatus tyrosine decarboxylase (tdc) genes respectively. The reaction was performed in a 20 ml volume, which included 1 ml of template, 900 nM of each primer, and 10 ml of SYBR Green PCR Master Mix containing ROX as a passive reference. Amplification and detection were performed using an ABI Prism Fast 7500 sequence detection system (Applied Biosystems, UK) using the standard program, with the exception that the last step was performed at 55  C. To corroborate the linearity of the reaction, serial dilutions of the samples (total DNA, 1/10 and 1/100) were used to provide template material. The 1/10 dilutions were chosen for comparisons between samples given the cycle threshold (Ct) values they returned (automatically assigned by the thermocycler software). Samples were considered positive for the presence of tyramine producers if the Ct value was at least 2 units below the result for the negative control.

2.2. Samples 2.5. Analysis of biogenic amines by RP-HPLC Cabrales, a blue-veined cheese made from raw milk and ripened for three months was used as a cheese model to study the development of tyramine-producing microorganisms. Samples were

Cheese samples weighing 1 g were prepared as previously described (Ladero et al., 2008) and further derivatized following the

Table 1 Strains used in this study. The origin of the strains, their capacity to produce tyramine in broth, and the result of the specific tdc qPCR assays are indicated. Species

Enterococcus sp. Enterococcus durans Enterococcus faecalis Enterococcus faecium Lactobacillus brevis Lactobacillus curvatus Lactobacillus gasseri Lactobacillus ruminis Lactobacillus buchneri Lactobacillus plantarum Lactobacillus casei Lactococcus lactis subs lactis Lactococcus lactis subs cremoris

Strains

IPLA BA62, IPLA BA64 IPLA 655, IPLA 833, IPLA 984, IPLA 1567, IPLA 1584, IPLA L21; IPLA L37, IPLA L72, IPLA 181T CNRZ 1535, IPLA 148T IPLA 25, IPLA 67, IPLA 55 IPLA AA45, IPLA AA62 IPLA 7, IPLA 52 CECT 3810, CECT 3811 IPLA VI14, IPLA VI16 IPLA 29 IPLA 44 B301 LL441 ATCC 393 IL1403 MG1363

Origin

Tyramine production (HPLC)

qPCR QtdcE/R

QtdcLBF/R

QtdcLCF/R

Dairy Dairy

All þ All þ

All þ All þ

e e

e e

IPLA IPLA

Dairy Human Dairy Human Dairy Dairy Human Human Dairy Dairy Human Dairy Dairy

All All All All All All e e e e e e e

e e e e All þ e e e e e e e e

e e e e e All þ e e e e e e e

CNRZ & IPLA IPLA IPLA IPLA CECT IPLA IPLA IPLA NIZO IPLA ATCC Chopin et al., 1984 Gasson, 1983

þ þ þ þ þ þ

All All All All e e e e e e e e e

þ þ þ þ

Source

V. Ladero et al. / Food Microbiology 27 (2010) 933e939

935

Table 2 Commercial cheese samples analysed. The origin and main technological characteristics of each cheese are indicated. In the case of Manchego type cheeses, the ripening period is indicated. Tyramine-producing bacterial numbers (cfu g1) quantified by qPCR and the tyramine concentration (mg kg1) determined by RP-HPLC are also indicated. ND: not detected. Cheese sample

Origin

Elaboration

Cheese type

Milk type

Milk treatment

Enterococci Manchego Manchego type Manchego type Manchego type Idiazabal Goat cheese Gamonedo (Blue) Cabrales (Blue) Blue veined Manchego type Manchego type Soft Smoked Smoked Blue veined Blue veined Blue veined Blue veined

Spain Spain Spain Spain Spain Spain Spain Spain France Spain Spain Spain Spain Spain Denmark Spain Spain Spain

Industrial Industrial Industrial Industrial Industrial Artisanal Artisanal Artisanal Industrial Industrial Industrial Artisanal Artisanal Artisanal Industrial Industrial Industrial Industrial

(8 months) (10 months) (12 months)

(4 months) (8 months)

Hard Hard Hard Hard Semi-hard Hard Semi-hard Semi-hard Semi-hard Semi-hard Hard Soft Semi-hard Semi-hard Semi-hard Semi-hard Semi-hard Semi-hard

Sheep Sheep Sheep Sheep Sheep Goat Cow Cow, sheep, goat Cow, sheep Cow, sheep Cow, sheep Cow Cow, sheep Cow, sheep, goat Cow Cow Cow Cow, sheep

protocol described by Krause et al. (1995). The separation and quantitative analysis of the BA content extracted was performed by reverse-phase high performance liquid chromatography (RP-HPLC) using a Waters Nova-pack C18 column (150  3.9 mm) in a Waters liquid chromatograph controlled by Millenium 32 Software (Waters Milford, USA), under the conditions described by Krause et al. (1995). 3. Results 3.1. Design of LAB tdc specific primers The tdc was selected as the target in the design of consensus primers for the detection, identification and quantification of tyramine-producing bacteria. The tdc genes from L. brevis IOEB 9809 (AF446085), ATCC 367 (NC_008497) and CECT 3810 (FN392118), L. curvatus HSCC1737 (AB086652), IPLA VI6 (FN392115) and IPLA VI14 (FN392116), Enterococcus durans IPLA 655 (AJ630043), IPLA 983 (FN392108), IPLA 984 (FN392109), IPLA 1567(FN392110) and IPLA L37 (FN392113), E. faecalis V583 (AE016830), JH2-2 (AF354231), CNRZ 1535 (FN392111) and IPLA 148T (FN393178), Enterococcus faecium DO (NZ_AAAK00000000) and RM58 (AJ630043) and Enterococcus hirae (AY303667) were aligned using the CLUSTAL W algorithm. The sequences were divided into three groups based on the divergence of the nucleotide sequence, (i) L. brevis, (ii) L. curvatus, and (iii) those belonging to the genus Enterococcus. Conserved regions in the alignments within each group that were not present or different in the other groups were selected for the design of primers. QtdcLBF (50 - AAAGAAATACATCAAACCAGAAGTC-30 ) and QtdcLBR (50 GAATATCTTGAATGACAATGCC -30 ) were used to amplify the L. brevis tdc gene; QtdcLCF (50 - ATTCCCAGAAGCAGAATCAGTTAC -30 ) and QtdcLCR (50 - GCGAATATCTTGGATGGCAATC -30 ) were used to amplify the tdc gene of producer strains from the L. curvatus group, and QtdcEF (50 -GGTGTTGTCGGTGTAGTTGGTT -30 ) and QtdcER (50 ATGAAGTTGTTGTCTTCGTCTAGAA-30 ) were used to amplify the tdc gene of any tyramine-producing enterococcus. 3.2. Assay specificity To test the specificity of the primers, total DNA extracted from tyramine-producing bacteria (23 strains belonging to five different species) and non tyramine-producing cultures (seven strains

Raw Raw Raw Raw Raw Raw Raw Raw Raw Pasteurised Pasteurised Pasteurised Pasteurised Pasteurised Pasteurised Pasteurised Pasteurised Pasteurised

Tyramine

Tyramine-producing microorganism (cfu gr1)

1.2 1.8 1.1 3.5 2.7 4.0 2.5 4.7 1.2 3.4 3.5 3.4 1.7 1.6 4.0 2.0 6.1 9.1

                 

5

10 105 105 104 105 104 103 104 105 101 101 103 102 105 101 105 103 101

L. curvatus 1.5 4.1 2.9 5.3 2.6 5.6 1.1 1.2 1.2 7.5 1.0 1.1 1.5 1.7 8.3 3.3 6.1 2.7

                 

3

10 105 103 102 105 103 101 103 106 101 102 103 102 104 101 106 102 102

(mg kg1)

L. brevis 2.9 4.5 9.7 3.5 1.3 6.5 4.2 3.8 8.8 1.7 2.9 1.0 3.5 1.0 1.9 7.3 1.1 3.1

                 

2

10 102 101 102 103 101 101 101 101 101 101 101 101 104 101 102 103 102

160.4 296.9 203.2 28.5 103.6 453.7 188.4 957.6 1051.1 ND ND 80.9 21.7 216.8 ND 227.7 67.4 ND

belonging to different LAB species) were used in qPCR reactions. Amplification was obtained only when DNA from tyramineproducing bacteria belonging to the selected target group was included in the reaction (Table 1). Since the method could be used to screen large culture collections, the assay was also performed using isolated colonies picked from plates instead of using purified DNA. In this case, the colonies were resuspended in 50 ml of sterile water and 1 ml was directly used in the qPCR assay. Again, amplification was seen only in those reactions in which tyramineproducing strains were present (data not shown). 3.3. Sensitivity and quantification range To determine the sensitivity and linearity of each of the qPCR assays, calibration curves were prepared for each of the pairs of primers using specific targets. The quantification limits of the assay were determined using DNA from the plasmids pVMB1, pVMC1 and pVME1 as a template (Ladero et al., 2010). These plasmids contain internal fragments of the tdc genes of L. brevis, L. curvatus and E. durans respectively. The assay was repeated three times for each plasmid (Fig. 1). The qPCR reactions were performed within a range of 101 to 1012 target molecules, calculated for each plasmid depending on its molecular size and concentration (determined by spectrophotometry). The dynamic range of the three assays was established between 102 and 1010 target molecules. The standard curve showed a linear relationship as between log input DNA and Ct within this range in the three assays (Fig. 1). The slope of the curves and the regression coefficient (R2) were very acceptable and similar in all three reactions (Fig. 1), thus allowing for the direct quantification of tdcþ microorganisms present in the analysed samples. Based on these regression lines, the way in which the cheese DNA was obtained, and the dilution used, the Ct limit values obtained in the dynamic range e Ct ¼ 30 and Ct ¼ 5 e represent the presence of at least 102 and 1010 cfu of tyramine-producing bacteria per gram of cheese respectively. It is important to notice that these numbers are minimum values since they depend on the DNA extraction efficiency. Up to 200 ng of total DNA from tyramine producers from the non-target groups and from the non tyramine producers were included in each reaction to test the influence of the background DNA on the efficacy of the reactions. The inclusion of this non-

936

a

V. Ladero et al. / Food Microbiology 27 (2010) 933e939

35 30 25

Ct

20 15 10 y = -3.0194x + 34.615 R² = 0.998

5 0 0

2

4

6

8

10

12

Log DNA copy number

b

35 30

600 mg kg1. Since the values obtained for both batches were similar, mean data are provided (Fig. 2). qPCR analysis detected tyramine-producing bacteria belonging to all three groups analysed, i.e., L. brevis, L. curvatus and enterococci, in all the analysed samples, including the milk, curd and cheese; they were, however, detected in different numbers (Fig. 2). With respect to L. brevis and L. curvatus, the samples showed concentrations below the linear range of determination (i.e., they were present but in numbers below 102 cfu g1). Of these two lactobacilli, only L. brevis increased in numbers compared to those recorded for the starting milk, showing an increment of about 1 log at 90 days of ripening. Tyramine-producing enterococci were the prevalent group in all the samples analysed. In the milk they were present at some 8.6  102 cfu ml1; from this point the concentration remained stable until the end of the first month of ripening, when the population increased to 2.4  104 cfu g1. This increase coincided with the great increase seen in the concentration of tyramine (Fig. 2). 3.5. Quantification and identification of tyramine-producing LAB in commercial cheese samples

25

Ct

20 15 10 y = -3.0892x + 35.963 R² = 0.996

5 0 0

2

4

6

8

10

12

10

12

Log DNA copy number

c

35 30 25

Ct

20 15 10 y = -3.0177x + 37.282 R² = 0.999

5 0 0

2

4

6

8

Log DNA copy number Fig. 1. qPCR analysis of 10-fold serial dilutions of control plasmid DNA: (a) pVMB1 with the QtdcLBF/R primers, (b) pVMC1 with the QtdcLCF/R primers, and (c) pVME1 with the QtdcEF/R primers. Cycle threshold values (Ct) are plotted against the calculated plasmid copy numbers. The equation and R2 value of the regression line are indicated in each panel.

target DNA did not reduce either the efficiency of the assay or the dynamic range (data not shown). 3.4. qPCR quantification and identification of tyramine-producing LAB during cheese manufacture Cabrales, a blue-veined cheese made from raw milk was used as a cheese model to detect, identify and follow the growth and appearance of tyramine-producing strains during manufacturing. Samples of two independent batches were taken at different points during the manufacturing process and analysed by qPCR and RPHPLC. No tyramine was detected in either batch until day 15, after which point it increased in concentration until the end of the ripening period. The final concentration reached was over

The proposed method was used to study the distribution of tyramine-producing LAB in 18, commercially available cheeses. The tyramine concentration was first determined by RP-HPLC. This BA was detected in 77% of the samples tested; 50% of the latter had a concentration of over 200 mg kg1. Such a high concentration would be considered unsafe and certainly over the legal upper limit if it were for histamine (the only BA regulated by law) in fish products. Tyramine-producing bacteria of all the studied groups were detected in all the cheese samples analysed, but in different concentrations (Table 2). In some cheeses, the numbers for some bacterial groups were below the dynamic range established (i.e., they were present but in numbers below 102 cfu g1). Tyramineproducing enterococci were the most abundant in most of the samples, followed by L. curvatus and L. brevis. Only in two samples, corresponding to blue-veined cheeses made with raw milk, was L. curvatus the prevalent tyramine producer, with numbers 10 times those recorded for the enterococci (Table 2). The good relationship between the number of tyramine producers and the tyramine concentration is noteworthy. The cheeses with the highest tyramine producer numbers also had the highest tyramine concentrations; those with low tyramine producers numbers had lower concentrations of tyramine (sometimes below the detection limit of HPLC) (Table 2). In addition, most of the samples with tyramine producer numbers over the previously proposed threshold concentration of 104 cfu g1 (Ladero et al., 2010) had a tyramine concentration of over 200 mg kg1. When cheese samples were grouped by the milk type used in their production (cow, sheep or a mixture), or by cheese type (Manchego type or blue veined), no differences in the numbers of tyramine-producing microorganisms were found, although the tyramine concentration in blue-veined cheeses was higher. This may be due to a more elevated proteolysis due to the presence of fungi in these cheeses (Fernández et al., 2007). When the samples were grouped by their production method e artisanal or industrial e the industrial cheeses were found to have higher numbers of tyramine-producing enterococci and lactobacilli (Table 3). Both the enterococci and lactobacilli reached an average concentration of about 105 cfu g1. Within the group of artisanal cheeses, the tyramine-producing enterococci (more abundant than the lactobacilli) reached up to 104 cfu g1. In the group of cheeses made from raw milk, tyramine-producing enterococci were detected in the largest numbers (105 compared to 104 cfu g1 lactobacilli). Conversely, the number of tyramineproducing lactobacilli, i.e., both species of lactobacilli together, was

937

8

700

7

600

6

500

5

400

4 300

3

200

2

Tyrami ne (m g kg-1)

log (cfu gr-1)

V. Ladero et al. / Food Microbiology 27 (2010) 933e939

100

1 0

0 Curd

Milk

3d

15d

30d

90d

Fig. 2. qPCR analysis of the different tyramine-producing populations during cheese manufacture. Data were obtained from two independent batches. Mean cfu g1 values, calculated by regression analysis of the Ct values for the 1/10 dilutions for each of the specific tdc qPCR assays, are indicated as bars: grey L. brevis, white L. curvatus and dashed Enterococcus. The average tyramine content (mg kg1) quantified by RP-HPLC is indicated by the continuous line.

greater in the cheeses made from pasteurised milk (Table 3). As previously reported (Novella-Rodríguez et al., 2004; Fernández et al., 2007), the cheeses made from raw milk showed higher concentrations of tyramine than those made from pasteurised milk. 4. Discussion The presence of microorganisms with the capacity to produce toxic compounds e such as BAs e in dairy products is an important food quality and safety issue. Methods that can rapidly detect BAproducing strains in foodstuffs are therefore required. Such a capability would also help the dairy industry in its inspection of raw materials destined for use in food production. The conventional microbiological methods that could be used to monitor the presence of BA-producing organism are slow and tedious and usually require the isolation of microorganisms prior to determining their characteristics. Culture-independent methods based on microbial DNA detection have therefore risen in favour as a rapid and reliable alternative (Jany and Barbier, 2008). If properly designed, these methods could also allow the identification and quantification of the detected microorganisms. Apart from the technological interest evoked, these methods could be used as a tool for studying the population dynamics of the microbiota present during food manufacture. Tyramine is the most commonly detected and abundant BA in fermented dairy products, in which it is produced by the action of microbial tyrosine decarboxylase. Several tdc genes belonging to different species of LAB strains, present in a variety of fermented foodstuffs, have been described (Lucas and Lonvaud-Funel, 2002; Fernández et al., 2004; Aymerich et al., 2006). The gene sequences from these strains have been used as targets for the design of a variety of PCR- and qPCR-based assays (Landete et al., 2007; Nannelli et al., 2008; Ladero et al., 2010). All these methods are devoted to the general detection of tyramine-producing microorganism present in different types of food matrix, but do not distinguish among genera or species. In the present work, a qPCR assay is described that, in addition to detecting and quantifying tyramine producers, can actually Table 3 Tyramine concentration and tyramine-producing bacterial numbers in the commercial cheeses of Table 2, based on milk treatment. Only those cheeses in which tyramine was detected were included. n: numbers of cheeses analysed in the category. The average tyramine concentration (mg kg1) detected by RP-HPLC is indicated.

Artisanal Industrial Raw milk Pasteurised milk

n

Tyramine (mg Kg1)

Tyramine-producing enterococci

6 8 9 5

319.8 267.4 382.6 122.9

4.1 1.3 1.1 3.7

   

104 105 105 104

Tyramine-producing lactobacilli 2.9 3.2 4.4 3.3

   

103 105 104 105

identify them. The three pairs of primer sets were used are able to selectively detect the tdc genes belonging to the most common tyramine producers in cheeses (Linares et al., in press). Enterococci form an important proportion of the bacterial population of several types of cheese (Giraffa, 2002; Psoni et al., 2007; Martín-Platero et al., 2009), reaching numbers of up to 106e108 cfu g1. Among them, the species most commonly isolated are E. faecalis and E. faecium, followed by E. durans (Giraffa, 2003; Ogier and Serror, 2008). In some varieties of cheese other species such as E. hirae, Enterococcus galliniarum, Enterococcus casseliflavus and Enterococcus devriesei have been isolated, although in smaller numbers (Martín-Platero et al., 2009). The qPCR reaction to detect tyramine producers belonging to this genus was designed based on genetic sequences from all tyramine-producing Enterococcus species (E. faecalis, E. faecium, E. durans and E. hirae). With respect to the genus Lactobacillus, a great variety of species are commonly identified in dairy products (Beresford and Williams, 2004). Although most are not described as tyramine producers, strains belonging to L. brevis and L. curvatus are known to produce tyramine in cheese (RoigSagués et al., 2002). However, their presence and distribution varies in different types of cheese (Beresford and Williams, 2004). Although the objective of this study was to discriminate between enterococci and lactobacilli tyramine-producing strains, the weaker conservation of the tdc sequence between L. brevis and L. curvatus made it necessary to design separate qPCR reactions able to differentiate them. The three tdc qPCR reactions described in this work all have an internal fragment of the tdc gene as their target, but no cross amplification was detected. Positive results were only returned when the DNA of a tyramine producer belonging to the target group was present in the reaction (Table 1); the DNA of tyramineproducing strains from non-target groups or from non tyramineproducing bacteria was not amplified (Table 1). For all three qPCR reactions, a good correlation was seen between the gene copy number and the Ct value recorded (R2 > 0.99; Fig. 1). In addition, the slopes for the reactions were similar (Fig. 1), allowing for accurate quantification and the comparison of Ct values. The proposed method was used to analyse the growth and appearance of tyramine-producing microorganisms over the manufacture of a blue-veined cheese made from raw milk. The results show that the numbers of all three groups increased during the early stages. This increase was very small in the case of tdc þ L. curvatus (indeed, not only at this stage but over the entire process). This was expected since this species is not usually present in this type of cheese (Flórez et al., 2006). The greatest increase in tyramine-producing microorganisms, although their numbers were high in the raw milk, was seen among the enterococci, especially at the final stages of ripening, coinciding with the greatest increase in tyramine concentration (Fig. 2). These results suggest that

938

V. Ladero et al. / Food Microbiology 27 (2010) 933e939

tyramine-producing enterococci are present in the milk and are mainly responsible for the accumulation of tyramine in this type of cheese. This proposed method was also used to examine 18 commercially available cheeses. Great variation in the number and distribution of the different groups of tyramine-producing bacteria was seen in these cheeses, in agreement with the great differences in the composition and growth of the microbiota seen between cheese types. In addition, cheese has a complex and diverse microbiota that can differ even within a variety due to factors such as the factory where the cheese is made, the microbial composition of the raw milk, post-contamination of this raw milk, and even the time of year (Bertoni et al., 2001). Enterococci formed the prevalent group of tyramine producers in most of the present samples analysed. Indeed, many enterococci strains have been described as tyramine producers, and this genus is always present in dairy products. Certainly, it is one of the most prevalent groups in products such as Manchego type cheeses (Foulquié-Moreno et al., 2006). Pasteurisation is one of the main technological factors that reduces the accumulation of tyramine in dairy products (NovellaRodríguez et al., 2004; Fernández et al., 2007). As expected, the tyramine content was higher in the cheeses made from raw milk (382.6 compared to 122.9 mg kg1) (Table 2). Accordingly, the number of tyramine producers was much higher in these cheeses. The greater presence of tyramine-producing enterococci in samples made from raw milk could be related to their higher concentrations in milk. Enterococci are one of the most common bacteria in milk, making up to some 40.8% of the LAB microbiota (Samelis et al., 2009). A higher average number of tyramine-producing enterococci than members of the lactobacillus groups were detected in the cheeses made from raw milk. However, in the cheeses made from pasteurised milk, the average number of tyramine-producing lactobacilli was higher than that of tyramine-producing enterococci. It is reported that the number of lactobacilli at the end of ripening in most cheeses is very high (Beresford and Williams, 2004), indicating their better performance than other bacterial groups under these conditions. In pasteurised milk cheeses, the milk microbiota, including the enterococci, is drastically reduced and the production of tyramine would be mainly left to lactobacilli at the end of the ripening period. Moreover, lactobacilli are usually identified as contaminants during the manufacturing processes (they colonising dairy equipment) and no enterococci are usually found at the end of ripening (NovellaRodríguez et al., 2004). Contamination with BA-producing bacteria at different points during the manufacturing process has been reported (Novella-Rodríguez et al., 2004; Ladero et al., 2009). Cheeses made on an industrial scale were compared with those made artisanally. Interestingly, the artisanal cheeses had smaller numbers of tyramine-producing microorganisms than the industrial cheeses, yet they had higher concentrations of tyramine (Table 3). It is well known that factors such as low temperatures, salinity and water activity influence the final content of BAs in dairy products (Stratton et al., 1991), and usually manufacturing and storage conditions are more homogeneous and better controlled in the industrial setting. The only cheeses in which no BAs were detected were industrial cheeses made from pasteurised milk (Table 2). As well as being able to identify the tyramine producers present in each cheese type, the proposed method provides a good way of estimating the concentration of tyramine or the capacity to gain it and the likelihood of its further accumulation. Clearly, the presence of strains with decarboxylase activity is necessary for the production of BAs in cheese. Recently, a threshold Ct value (Ct ¼ 28 equivalent to at least 104 cfu g1) was defined for qPCR analysis of histamine-producing bacteria in cheese (Ladero et al., 2008, 2009), below which most of the samples had BA contents over the recommended limit of 200 mg kg1 (ten Brink et al., 1990). In the

present Cabrales cheese, and in most of the commercial cheese samples analysed with a number of tyramine-producing microorganisms over the proposed threshold Ct value, the tyramine concentration was over the reasonable limit of 200 mg kg1. The production of tyramine in dairy products is a multifaceted process in which the presence of a minimum number of tyramineproducing microorganisms is a major requirement; its accumulation is then influenced by a variety of environmental and technological conditions. Since most of the influential technological factors are difficult to modify without affecting the quality and organoleptic properties of the final product, the proposed qPCR method could be a very useful tool for the early identification of tyramine-producing strains. This method allows the quantification and identification of the main tyramine-producing bacteria present in dairy products, and the present results throw light on the relative importance of enterococci and lactobacilli in different types of commercial cheeses. The data obtained by this method could be used to predict the tyramine concentration that will be found in final cheese products. Strategies to reduce this content might then be brought into play to improve cheese safety and quality. Acknowledgments This work was performed with the financial support of the Spanish Ministry of Education and Science (AGL2006-01024) and the European Community’s Seventh Framework Programme (KBBE-CT2007-211441). V. Ladero is the beneficiary of an I3P - CSIC contract financed by the European Social Fund. The authors thank Adrian Burton for linguistic assistance. References Aymerich, T., Martín, B., Garriga, M., Vidal-Carou, M.C., Bover-Cid, S., Hugas, M., 2006. Safety properties and molecular strain typing of lactic acid bacteria from slightly fermented sausages. J. Appl. Microbiol. 100, 40e49. Beresford, T., Williams, A., 2004. The microbiology of cheese ripening. In: Fox, P.F., McSweeney, P.L.H., Cogan, T.M., Guinee, T.P. (Eds.), Cheese Chemistry, Physics and Microbiology. Elsevier, Amsterdam, pp. 287e317. Bertoni, G., Calamari, L., Maianti, M.G., 2001. Producing specific milks for speciality cheeses. Proc. Nutr. Soc. 60, 231e246. Bodmer, S., Imark, C., Kneubühl, M., 1999. Biogenic amines in foods: histamine and food processing. Inflam. Res. 48, 296e300. Chopin, A., Chopin, M.C., Moillo-Batt, A., Langella, P., 1984. Two plasmid-determined restriction and modification systems in Streptococcus lactis. Plasmid 11, 260e263. Fernández, M., Linares, D.M., Alvarez, M.A., 2004. Sequencing of the tyrosine decarboxylase cluster of Lactococcus lactis IPLA 655 and the development of a PCR method for detecting tyrosine decarboxylating lactic acid bacteria. J. Food Protect. 67, 2521e2529. Fernández, M., del Río, B., Linares, D.M., Martín, M.C., Alvarez, M.A., 2006. Real-time polymerase chain reaction for quantitative detection of histamine-producing bacteria: use in cheese production. J. Dairy Sci. 89, 3763e3769. Fernández, M., Linares, D., del Río, B., Ladero, V., Alvarez, M.A., 2007. HPLC quantification of biogenic amines in cheeses: correlation with PCR-detection of tyramine-producing microorganisms. J. Dairy Res. 74, 276e282. Flórez, A.B., López-Díaz, T.M., Álvarez-Martín, P., Mayo, B., 2006. Microbial characterization of the traditional Spanish blue-veined Cabrales cheese: identification of dominant lactic acid bacteria. Eur. Food Res. Technol. 223, 503e508. Foulquié-Moreno, M.R., Sarantinopoulos, P., Tsakalidou, E., De Vuyst, L., 2006. The role and application of enterococci in food and health. Int. J. Food Microbiol. 106, 1e24. Gasson, M.J., 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bact. 154, 1e9. Giraffa, G., 2002. Enterococci from foods. FEMS Microbiol. Rev. 26, 163e171. Giraffa, G., 2003. Functionality of enterococci in dairy products. Int. J. Food Microbiol. 88, 215e222. Jany, J.L., Barbier, G., 2008. Culture-independent methods for identifying microbial communities in cheese. Food Microbiol. 25, 839e848. Joosten, H.M.L.J., Northolt, M.D., 1987. Conditions allowing the formation of biogenic amines in cheese. 1. Decarboxylative properties of some non-starter bacteria. Neth. Milk Dairy J. 41, 259e280. Komprda, T., Burdychová, R., Dohnal, V., Cwiková, O., Sládková, P., Dvorá cková, H., 2008. Tyramine production in Dutch-type semi-hard cheese from two different producers. Food Microbiol. 25, 219e227. Krause, I., Bockhardt, A., Neckermann, H., Henle, T., Klostermeyer, H., 1995. Simultaneous determination of amino acids and biogenic amines by reversed-phase

V. Ladero et al. / Food Microbiology 27 (2010) 933e939 high performance liquid chromatography of the dabsyl derivatives. J. Chromatography. A 715, 67e79. Ladero, V., Linares, D., Fernández, M., Alvarez, M.A., 2008. Real Time Quantitative PCR detection of histamine-producing lactic acid bacteria in cheese: relation with histamine content. Food Res. Int. 41, 1015e1019. Ladero, V., Fernández, M., Alvarez, M.A., 2009. Effect of post-ripening processing on the histamine and histamine-producing bacteria contents of different cheeses. Int. Dairy J. 12, 759e762. Ladero, V., Martínez, N., Martín, M.C., Fernández, M., Alvarez, M.A., 2010. qPCR for quantitative detection of tyramine-producing bacteria in dairy products. Food Res. Int. 43, 289e295. Landete, J.M., de Las Rivas, B., Marcobal, A., Muñoz, R., 2007. Molecular methods for the detection of biogenic amine-producing bacteria on foods. Int. J. Food Microbiol. 117, 258e269. in press Linares, D.M., Martín, M.C., Ladero, V., Alvarez, M.A., Fernández, M., Biogenic Amines in Dairy Products. Crit. Rev. Food Sci. Nutr., in press. Lucas, P., Lonvaud-Funel, A., 2002. Purification and partial gene sequence of the tyrosine decarboxylase of Lactobacillus brevis IOEB 9809. FEMS Microbiol. Lett. 211, 85e89. Marcobal, A., de las Rivas, B., García-Moreno, E., Muñoz, R., 2004. The tyrosine decarboxylation test does not differentiate Enterococcus faecalis from Enterococcus faecium. Syst. Appl. Microbiol. 2, 423e426. Marcobal, A., de las Rivas, B., Muñoz, R., 2006. Methods for the detection of bacteria producing biogenic amines on foods: a survey. J. Cons. Protect. Food Saf. 1, 187e196. Martín-Platero, A.M., Valdivia, E., Maqueda, M., Martínez-Bueno, M., 2009. Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int. J. Food Microbiol. 132, 24e32. Nannelli, F., Claisse, O., Gindreau, E., de Revel, G., Lonvaud-Funel, A., Lucas, P.M., 2008. Determination of lactic acid bacteria producing biogenic amines in wine by quantitative PCR methods. Lett. Appl. Microbiol. 47, 594e599. Novella-Rodríguez, S., Veciana-Nogués, M.T., Roig-Sagués, A.J., Trujillo-Mesa, A.J., Vidal-Carou, M.C., 2002. Influence of starter and non-starter on the formation of biogenic amine in goat cheese during ripening. J. Dairy Sci. 85, 2471e2478.

939

Novella-Rodríguez, S., Veciana-Nogués, M.T., Roig-Sagués, A.J., Trujillo-Mesa, A.J., Vidal-Carou, M.C., 2004. Evaluation of biogenic amines and microbial counts throughout the ripening of goat cheeses from pasteurized and raw milk. J. Dairy Res. 71, 245e252. Ogier, J.C., Serror, P., 2008. Safety assessment of dairy microorganisms: the Enterococcus genus. Int. J. Food Microbiol. 126, 291e301. Ogier, J.C., Son, O., Gruss, A., Tailliez, P., Delacroix-Buchet, A., 2002. Identification of the bacterial microflora in dairy products by temporal temperature gradient gel electrophoresis. Appl. Environ. Microbiol. 68, 3691e3701. Psoni, L., Kotzamanidis, C., Yiangou, M., Tzanetakis, N., Litopoulou-Tzanetaki, E., 2007. Genotypic and phenotypic diversity of Lactococcus lactis isolates from Batzos, a Greek PDO raw goat milk cheese. Int. J. Food Microbiol. 114, 211e220. Rea, M.C., Franz, C.M., Holzapfel, W.H., Cogan, T.M., 2004. Development of enterococci and production of tyramine during the manufacture and ripening of Cheddar cheese. Irish J. Agricult. Food Res. 43, 247e258. Roig-Sagués, A.X., Hernández-Herrero, M.M., López-Sabater, E.I., Rodríguez-Jerez, J. J., Mora-Ventura, M.T., 1999. Microbiological events during the elaboration of “fuet”, a Spanish ripened sausage. Relationships between the development of histidine- and tyrosine-decarboxylase-containing bacteria and pH and water activity. Eur. Food Res. Technol. 209, 108e112. Roig-Sagués, A.X., Molina, A.P., Hernández-Herrero, M.M., 2002. Histamine and tyramine-forming microorganisms in Spanish traditional cheeses. Eur. Food Res. Technol. 215, 96e100. Samelis, J., Lianou, A., Kakouri, A., Delbès, C., Rogelj, I., Bogovic-Matijasi c, B., Montel, M.C., 2009. Changes in the microbial composition of raw milk induced by thermization treatments applied prior to traditional Greek hard cheese processing. J. Food Prot. 72, 783e790. Stratton, J.E., Hutkins, R.W., Taylor, S.L., 1991. Biogenic-amines in cheese and other fermented foods e a review. J. Food Protect. 54, 460e470. ten Brink, B., Damink, C., Joosten, H.M.L.J., Huis in’t Veld, J.H.J., 1990. Occurrence and formation of biologically active amines in foods. Int. J. Food Microbiol. 11, 73e84.