- Email: [email protected]
Quantitative molecular diagnosis of axillary drainage fluid for prediction of locoregional failure in patients with one to three positive axillary nodes after mastectomy without adjuvant radiotherapy
Int. J. Radiation Oncology Biol. Phys., Vol. 64, No. 2, pp. 505–511, 2006 Copyright © 2006 Elsevier Inc. Printed in the USA. All rights reserved 0360-3016/06/$–see front matter
doi:10.1016/j.ijrobp.2005.07.984
CLINICAL INVESTIGATION
Breast
QUANTITATIVE MOLECULAR DIAGNOSIS OF AXILLARY DRAINAGE FLUID FOR PREDICTION OF LOCOREGIONAL FAILURE IN PATIENTS WITH ONE TO THREE POSITIVE AXILLARY NODES AFTER MASTECTOMY WITHOUT ADJUVANT RADIOTHERAPY YONG ZHANG, M.D., PH.D.,*‡ QING YONG MA, M.D., PH.D.,* CHENG XUE DANG, M.D., PH.D.,† M. MOUREAU-ZABOTTO, M.D., PH.D.,§ AND WU KE CHEN, M.D., PH.D.† Departments of *Hepatobiliary Surgery and †Surgical Oncology, The First Hospital of Xi’an Jiaotong University, Xi’an, China; Department of Surgery and Clinical Oncology, Graduate School of Medicine, Osaka University, Osaka, Japan; §Department of Surgery and Surgical Basic Science, Kyoto University Graduate School of Medicine, Kyoto, Japan
‡
Purpose: A quantitative multiple-marker reverse transcriptase (RT)-polymerase chain reaction (PCR) assay for sensitive detection of cancer cells in axillary drainage fluid was developed to examine whether the presence of cancer cells in axillary drainage fluid can be used as a predictor of locoregional recurrence (LRR) in patients with breast cancer who had T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without adjuvant radiotherapy. Methods and Materials: Axillary drainage fluid was collected from 126 patients with invasive ductal carcinoma of the breast who were treated with modified radical mastectomy and were found to have one to three positive axillary nodes. Cancer cells in axillary drainage fluid were detected by RT-PCR assay using primers specific for carcinoembryonic antigen (CEA) and cytokeratin-19 (CK-19) together with numerous clinicopathologic and treatment-related factors and were analyzed for their impact on LRR. Results: A total of 38 patients suffered LRR during follow-up and the multimarker RT-PCR assays for CEA and CK-19 in the axillary drainage fluid both were positive in 34 patients (27.0%), of which 29 patients had LRR. In univariate analysis, the 5-year LRR-free survival showed higher rates in patients with PCR-negative findings in axillary drainage fluid (p < 0.0001), age >40 years old (p < 0.0001), tumor size <2.5 cm (p < 0.0001), negative lymph-vascular space invasion (p ⴝ 0.026), and T1 status (< 0.0001); in multivariate analysis, PCR-positive findings together with age and tumor size were found to be independent predictors of LRR (all p < 0.05). Conclusion: Multiplex RT-PCR assay for CEA and CK-19 was highly sensitive for detection and might be useful for prediction of LRR in such subgroup breast cancer patients. © 2006 Elsevier Inc. Locoregional recurrence, Axillary drainage fluid, RT-PCR, Radiotherapy, Molecular detection.
INTRODUCTION
able to hypothesize that a survival benefit from PMRT would be unlikely in a population of breast cancer patients who have a low probability of LRR after mastectomy, but the patients with some other high-risk features may benefit from PMRT. Therefore, there is an urgent need to explore strategies to distinguish subsets at high risk of LRR (justifying use of PMRT) from those at sufficiently low risk of LRR (who may be spared PMRT), because LRR can be mostly attributed to the residual tumor cells, and the proliferative potential of these cells determines the clinical outcomes (22–24). Conventional methods of detection, including morphology, flow cytometry, cytogenetic analyses, and immunocytochemistry, are all limited in sensitivity and
Postmastectomy radiotherapy (PMRT) is an important contributor to reduce locoregional recurrence (LRR) in breast cancer patients with T1/2 tumors and four or more positive axillary lymph nodes and, in doing so, improves overall survival (1– 8). However, the role of PMRT in the patients with T1/2 tumors and one to three positive axillary nodes is still a controversial issue and being debated (5, 9 –14), although two trials have recently shown the LRR rates in patients with one to three involved nodes were much higher than in other series (15–18) and that patients benefited from PMRT (2, 19 –21). Based on the inconsistencies in the available evidence observed in these patients, it is reasonReprint requests to: Qing Yong Ma, M.D., Ph.D., Department of Hepatobiliary Surgery, First Hospital of Xi’an Jiaotong University, 1 Jiankang Rd., Xi’an, China 710061. Tel: (⫹86) 29-532-4009; Fax: (⫹86) 29-526-3190; E-mail: [email protected] Supported by the Young Scientist Scholars Program, the Jointed
Chinese and Japanese Cancer Medicine Society, New Investigator Award. Received May 20, 2005, and in revised form July 26, 2005. Accepted for publication July 27, 2005. 505
506
I. J. Radiation Oncology
● Biology ● Physics
specificity (25, 26). More recently, molecular diagnosis with reverse transcriptase-polymerase chain reaction (RTPCR) has been developed as a sensitive method for detecting circulating tumor cells and led to an explosion of studies analyzing novel genetic markers as prognostic indicators of breast cancer (27, 28). Some previous studies have demonstrated that RT-PCR amplification of carcinoembryonic antigen (CEA) mRNA is an efficient means of detecting abdominal cancer or breast cancer cells in the bone marrow or in peripheral blood and was a prognostic indicator (29, 30). Recently, cytokeratin-19 (CK-19) has also been successfully used as an index of disseminated tumor cells in blood, bone marrow, and lymph nodes in patients with breast cancer (31, 32) and other epithelial cancers including, lung, pancreas, and stomach (33–35). However, to the best of our knowledge, there are no prospective studies in the literature evaluating the value of the residual tumor cells in the fluid that accumulates in the axilla after breast operations. In an effort to define whether the presence of cancer cells in axillary drainage fluid can be used as a predictor of LRR in patients with breast cancer who had T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without PMRT, we have developed a combined multimarker (CEA and CK-19) quantitative real-time RT-PCR analysis to provide a more precise and powerful tool for the detection of residual tumor cells in the axillary drainage fluid, and, moreover, to evaluate their ability for identifying patients at high risk for LRR. PATIENTS AND METHODS Patient population, collection of axillary drainage fluid, treatment, and follow-up Between May 1996 and December 1999, 126 consecutive female patients referred with pT1/T2 breast cancer with one to three positive axillary nodes were treated with modified radical mastectomy followed by adjuvant chemotherapy using different chemotherapy regimens beginning 2– 4 weeks after surgery at our department. All axillae were drained postoperatively by closed vacuum drains (Ch-14, Biometrix, Chelmsford, MA). The output of the drain was collected and measured every 24 h, and the drains were removed when the output was less than 25 mL/24 h. The presence of CEA, CK-19, and -actin was assessed in the fluid collected during the second postoperative day, because the fluid collected in the first 24 h can contain large quantities of erythrocytes and debris. Moreover, to confirm the absence of CEA and CK-19 in the axillary drainage fluid of non– breast cancer patients, 10 patients with malignant melanoma who underwent axillary sentinel lymph node biopsy in addition to wide local excision were recruited as control group. The chemotherapy regimens consisted of three combinations: cyclophosphamide (600 mg/m2 body surface area), methotrexate (60 mg/m2), and fluorouracil (600 mg/m2) (CMF regimen) in 54 patients; cyclophosphamide (500 mg/m2), doxorubicin (50 mg/m2), and fluorouracil (500 mg/m2) (CAF regimen) in 30 patients; and paclitaxel (150 mg/m2) in 42 patients. Informed consent was obtained from each patient, and the study was approved by the ethics committees at our institution. Clinicopathologic characteristics of the 126 patients are summarized in
Volume 64, Number 2, 2006
Table 1. Clinical characteristics of patients undergoing modified radical mastectomy without PMRT Variable
n
Total Age (y) ⬍40 ⱖ40 Menopausal status Premenopausal Postmenopausal* Tumor location Outer quadrants Center/inner quadrants T classification T1 T2 Tumor size (cm) ⬍2.5 ⱖ2.5 Involved lymph nodes (n) 1 2 3 Estrogen receptor protein status Positive Negative Progesterone receptor protein status Positive Negative CEA mRNA Positive Negative CK-19 mRNA Positive Negative
126
% 100
44 82
34.9 65.1
87 39
69.0 31.0
56 70
44.4 55.6
59 67
46.8 53.2
77 49
61.1 38.9
34 44 48
27.0 34.9 38.1
41 85
32.5 67.5
53 73
42.1 57.9
46 80
36.5 63.5
39 87
31.0 69.0
Abbreviations: PMRT ⫽ postmastectomy radiotherapy; CEA ⫽ carcinoembryonic antigen. * Postmenopausal status was defined as ⱖ12 months of amenorrhea or, for women who had undergone hysterectomy, age ⬎55 years.
Table 1. Patient follow-up consisted of chest X-rays, mammograms, bone scans, abdominal ultrasound examinations, and blood tests. The median follow-up period was 46 months (range 2– 68 months). All LRRs, including those concurrent with or after a distant metastasis, were recorded. Sites of LRR included the ipsilateral chest wall and axillary, supraclavicular, infraclavicular, or internal mammary lymph nodes. Evidence of disease at any other site was considered distant metastasis. Survival times were calculated as the time from surgery to the date of the event or the end of the follow-up period. Details of patients lost to follow-up (7 patients) were inserted in the analysis as censored data.
Real-time quantitative RT-PCR The collection of axillary drainage fluid was centrifuged at 300 ⫻ g for 5 min; the cell pellet was dissolved with 1 mL of TRIZOL Reagent (Invitrogen, Carlsbad, CA) for extracting total RNA according to the manufacturer’s instructions. The amount of extracted RNA was quantified by measuring the absorbance at 260 nm. The purity of the RNA was checked by the ratio between the absorbance values at 260 and 280 nm, and ranged between 1.83 and 2.00, demonstrating the high quality of the RNA. Moreover, the absence of
Quantitative molecular diagnosis for axillary drainage fluid
● Y. ZHANG et al.
507
positive samples is set at CEA, CK-19/-actin ⱖ4 according to our previous pilot study. With the use of this cutoff for CEA and CK-19 quantitative RT-PCR gives a sensitivity of 76.3% and a specificity of 100%. These results are in agreement with previous studies that show that CK19 and CEA RT-PCR assays are powerful methods for detecting disseminated breast cancer cells in bone marrow aspirates of patients with operable breast cancer (35, 36).
Statistical analysis
Fig. 1. Total RNA was extracted from the axillary drainage fluid which was not degraded and showed clear 18S and 28S bands under ultraviolet light by electrophoresis on 1.5% agarose gel containing ethidium bromide. degradation of the RNA was confirmed by electrophoresis on a 1.5% agarose gel containing ethidium bromide. Only samples that were not degraded and showed clear 18S and 28S bands under ultraviolet light were used for real-time RT-PCR (Fig. 1). cDNA was generated with avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI) using the protocol recommended by the manufacturer. Briefly, 1 g of RNA, mixed with RT reaction reagents including oligo-(dT)15 primer, was incubated at 42°C for 15 min, followed by heating at 95°C for 5 min for enzyme inactivation. Quantitative PCR was performed using real-time PCR with a LightCycler (Idaho Tech Inc., Salt Lake City, UT). PCR reagents contained 1x LightCycler DNA Master SYBR Green I (Roche Diagnostics, Mannheim, Germany), 0.2 M of each primer, 3 mM MgCl2, and 2 L of cDNA template. PCR conditions for -actin, CEA, and CK-19 were as follows: 1 cycle of denaturing at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 62°C for 5 s, and 72°C for 10 s. To verify the integrity of RNA and to improve the diagnostic quality, the housekeeping gene -actin was amplified quantitatively. Because the SYBR Green will detect any double-stranded DNA, including primer dimers, contaminating DNA, and PCR product from misannealed primer, melting curves were generated for all samples after each run to characterize the amplified products. The intensity of fluorescence was calculated at each cycle and the standard curve was constructed with threefold serial dilutions of cDNA obtained from human mammary carcinoma cell line T47D. The primer sequences for PCR amplification were as follows: -actin sense: 5= CTCTTCCAGCCTTCCTTCCT3=, -actin anti-sense: 5= AGCACTGTGTTGGCGTACAG3=, CEA sense: 5=-TCTGGAACTTCTCCTGGTCTCTCTCAGCTGG-3=, CEA anti-sense: 5=-TGTAGCTGTTGCAAATGCTTTAAGGAAGAAGC-3=, CK-19 sense: 5=-CATGAAAGCTGCCTTGGAAGA-3=, CK-19 anti-sense: 5=-TGATTCTGCCGCTCACTATCAG-3=. The amplified product size was 116 base pairs (bp) for -actin mRNA, 160 bp for CEA mRNA, and 121 bp for CK-19 mRNA. The optimal cutoff value of
The following endpoints were studied: the occurrence of isolated LRR (coming before distant relapse) for isolated LRR-free survival; locoregional or distant relapse (whichever came first) for disease-free survival; and death from breast cancer, other malignancy, or death without cancer for overall survival. Survival and recurrence rates were estimated by the Kaplan-Meier method and compared by the log–rank test (37). Regression analyses were done according to the methods of Cox (38). Relative risks (RR) and associated confidence intervals (CI) were calculated from the proportional regression coefficients. The patient characteristics of those who did and did not experience LRR were compared using chi-square tests. All analyses were conducted using Statistical Package for Social Sciences, version 13.0 (SPSS, Chicago, IL). p values of less than 0.05 were considered to be statistically significant.
RESULTS Quantitative genetic diagnosis and clinicopathologic factors All axillary drainage fluid from non– breast cancer surgery (n ⫽ 10) were negative for quantitative RT-PCR of CEA and CK-19 expression with the exception of 1 case of surgery for cholelithiasis that was positive for CK-19 mRNA (Fig. 2). On the other hand, 46 of 126 (36.5%) patients were positive for CEA expression and 39 (31.0%) were positive for CK-19. Fifty-one (40.5%) patients were positive for at least one marker. A total of 38 patients
Fig. 2. Quantitative results of reverse transcriptase-polymerase chain reaction on axillary drainage fluid. Ratio of marker expression/-actin expression is shown as dots in non– breast cancer controls (left two lanes) and breast cancer patients (right two lanes).
508
I. J. Radiation Oncology
● Biology ● Physics
Volume 64, Number 2, 2006
Table 2. Univariate analyses for 5-year LRR-free survival Variable Age (y) ⬍40 ⱖ40 Menopausal status Premenopausal Postmenopausal* Tumor location Outer quadrants Center/inner quadrants T classification T1 T2 Tumor size (cm) ⬍2.5 ⱖ2.5 Involved lymph nodes (n) 1 2 3 Estrogen receptor protein status Positive Negative Progesterone receptor protein status Positive Negative LVI Present Absent Chemotherapy agents CMF CAF Paclitaxel CEA mRNA and/or CK-19 mRNA Both CEA mRNA and CK-19 mRNA positive Any one of CEA mRNA and CK-19 mRNA negative
No. (n)
LRR (n)
5-year LRR-free survival rate (%)
44 82
34 4
15 95
87 39
25 13
71 59
56 70
16 22
66 68
59 67
4 34
93 41
77 49
2 36
97 20
34 44 48
12 14 12
63 59 74
41 85
7 31
83 60
53 73
15 23
70 64
61 65
24 14
57 77
54 30 42
12 12 14
76 56 65
34
29
8
92
9
91
p ⬍0.0001 0.970 0.552 ⬍0.0001 ⬍0.0001 0.323
0.147 0.630 0.026 0.158
⬍0.0001
Abbreviations: LRR ⫽ locoregional recurrence; LVI ⫽ lymphovascular invasion; CEA ⫽ carcinoembryonic antigen; CAF ⫽ cyclophosphamide, doxorubicin (Adriamycin), and fluorouracil; CMF ⫽ cyclophosphamide, methotrexate, and fluorouracil. * Postmenopausal status was defined as ⱖ12 months of amenorrhea or, for women who had undergone hysterectomy, age ⬎55 years.
suffered LRR during fellow-up, and the multimarker RTPCR assays for CEA and CK-19 in the axillary drainage fluid were both positive in 34 patients (27.0%), of which 29 patients had LRR.
Mathematical model of predicting survival With the significant predictive variables obtained in the multivariate analysis, the relative risk of LRR was calculated
Univariate and multivariate analyses for prognostic factors of LRR Table 2 presents the univariate analyses for risk factors of LRR. The factors of significance for LRR were age ⬍40 years (p ⬍ 0.0001), tumor size ⱖ2.5 cm (p ⬍ 0.0001), presence of lymph-vascular space invasion (LVI) (p ⫽ 0.026), both molecular markers diagnosis positive (p ⬍ 0.0001), and T2 tumor state (p ⬍ 0.0001). In multivariate analysis, tumor size ⱖ2.5 cm, age ⬍40 years, and both molecular markers diagnosis positive were statistically significant independent predictors of LRR (Table 3).
Table 3. Multivariate analyses for 5-year LRR-free survival Variable Age (y) (⬍40 vs. ⱖ40) Tumor size (ⱖ2.5 vs. ⬍2.5 cm) Both CEA mRNA and CK-19 mRNA positive vs. any one of CEA mRNA and CK-19 mRNA negative
Relative risk (95% CI)
p
3.38 (0.96–11.76) 8.33 (1.42–48.75)
0.046 0.019
3.65 (1.53–8.67)
0.003
Abbreviations: LRR ⫽ locoregional recurrence; CI ⫽ confidence interval; CEA ⫽ carcinoembryonic antigen.
Quantitative molecular diagnosis for axillary drainage fluid
Fig. 3. Probability of locoregional recurrence (LRR)-free survival of breast cancer patients with T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without adjuvant radiotherapy divided into three groups according to their relative risk of LRR. Group A, a prognostic index ⬍1.5 (57 patients); group B, a prognostic index 1.5–3.0 (30 patients); and group C, a prognostic index ⬎3.0 (39 patients). Plus marks indicate censored cases. p ⬍ 0.0001.
based on the regression coefficients for each patient using the equation: (LRR) ⫽ exp (tumor size ⱖ2.5 cm ⫻ 2.12 ⫹ age ⬍40 years ⫻ 1.22 ⫹ both molecular markers diagnosis positive ⫻ 1.30). Higher values of LRR indicate earlier locoregional recurrence and worse prognosis. Detailed information about this method was provided in previous reports (39). The LRR of each patient was calculated and ranged between 0.000 and 4.64; it was feasible to divide the series into three groups according to the prognostic index, as follows: group A, a LRR index ⬍1.5 (57 patients); group B, a LRR index 1.5–3.0 (30 patients); and group C, a LRR index ⬎3.0 (39 patients). The recurrence curves for these groups are shown in Fig. 3. There was a significant difference among the three groups in the LRR-free time (mean LRR time, group A, 61.4 months; group B, 35.2 months; and group C, 13.1 months) (p ⬍ 0.0001). DISCUSSION Postmastectomy irradiation in more advanced disease clearly reduces the risk of LRR (1–7). However, debates concerning prognostic factors to indicate adjuvant locoregional radiotherapy in addition to adjuvant systemic therapy still continue. Reasons for the use of PMRT in women with node-positive breast cancer include a reduction of the risks for LRR and distant relapse (3– 8, 14, 15). The current consensus about the indication for postmastectomy irradiation is that it should be recommended to patients with four or more positive nodes and patients with T3 tumors (4, 6, 8), but whether or not to use it in patients with one to three
● Y. ZHANG et al.
509
involved nodes is still being debated (5, 7–14). In addition, few data are available to demonstrate accurate factors predictive of LRR for patients who receive postmastectomy radiation. Such data might be useful for determining subsets of patients for whom different locoregional treatment strategies should be considered and may benefit from PMRT. Immunocytology is regarded as the standard method for tumor cell detection in body cavity fluids, including peritoneal fluid, pleural fluid, and pericardial effusions. However, this observer-dependent method is hampered by a low sensitivity and is always a subjective decision in defining what is positive or negative. In our pilot study, although we found specificity of axillary drainage fluid cytologic examination as high as 91%, the sensitivity is only 35% (data not shown). The low sensitivity and specificity of this methodology are not unexpected and are consistent with other previous reports studied regarding tumor cell detection in other postsurgical body cavity drainage fluids (25, 26, 33– 36). This has led to the deployment of molecular techniques in the hope of enhancing the sensitivity. Previous researchers have successfully demonstrated that CEA and CK-19 were good target genes for detecting breast cancer cells in the bone marrow or peripheral blood using RT-PCR and can be used as a sound predictor for both LRR and prognosis (29 –33). However, one problem with this method is that a finding of CEA mRNA merely indicates the presence of epithelial cells, not just only cancer cells. Because CEA is not a specific marker for breast cancer cells, this technique does not provide absolute identification. Moreover, CK-19 has also been controversial because of false-positive results in normal blood attributed to contamination with skin cells at venipuncture or to illegitimate transcription in peripheral blood leukocytes (36). Considering this background and to reduce these false-positive cases, we introduced a multiplemarker RT-PCR assay and quantitative PCR technique to improve the sensitivity and specificity of this method to test whether tumor cell detection in axillary drainage fluid by means of both CEA and CK-19 mRNA RT-PCR was an exact indicator for LRR, because LRR can be mostly attributed to the residual tumor cells, and the proliferative potential of these cells determines the clinical outcomes (22–24). The ability to identify patients with T1/T2 breast cancer and one to three positive nodes at high risk for LRR may be used to select patients for PMRT. Our multiple-marker quantitative RT-PCR assay for detecting the residual cancer cells in the axillary drainage fluid showed high sensitivity and specificity considering that all the axillary drainage fluid from control cases was negative for CEA mRNA and only one case was positive for CK-19 mRNA. Therefore, a 41.3% improvement in sensitivity and a 9% improvement in specificity are achieved by our quantitative RT-PCR assay compared with immunocytology. In this study, we found age ⬍40 years (p ⬍ 0.0001), tumor size ⱖ2.5 cm (p ⬍ 0.0001), presence of LVI (p ⫽ 0.026), and T2 tumor state (p ⬍ 0.0001) were factors of significance for LRR. These findings are consistent with
510
I. J. Radiation Oncology
● Biology ● Physics
results from univariate analyses reported in previous studies (33, 35, 40 – 47). Younger age at the time of breast cancer diagnosis has been associated with an increased risk of LRR, although different definitions for younger age have been used and also been thoroughly discussed in previous studies (40 – 47). Tumor size 1 cm or smaller has been shown with a very favorable prognosis and low LRR (48, 49). In node-negative breast cancer patients, tumor size has been considered the most important single prognostic factor for LRR and overall survival; however, tumor size has also been correlated closely with axillary lymph node metastases (50). In some studies, patients with tumors larger than 2 cm on histologic examination were at increased risk of developing local recurrence, particularly those who were not given radiotherapy (51–53). We found tumor size to be an independent risk factor for the development of LRR; we used 2.5 cm as a cutoff because that was the median tumor size in our population. The result was constant with other reports defining a cutoff of 3 cm in those patients who suffered T1/2 primary tumors together with one to three positive axillary lymph nodes (40 – 45). A predictive index of LRR proposed in the present investigation was used based on regression coefficients of the three independent prognostic factors. Patients could be clas-
Volume 64, Number 2, 2006
sified into three groups: low risk (Group A), intermediate (Group B), and high risk (Group C). This index can be easily calculated because it is based on variables obtained during routine clinical examinations. This index, therefore, may be helpful in making LRR assessments and determining treatment strategies for patients with pT1/2 breast cancer and one to three positive axillary nodes. Accordingly, it could be concluded that patients with LRR ⬎1.5 should be enrolled in some therapeutic assay such as PMRT because of their extremely earlier affected LRR after the surgery. In conclusion, this is the first report to show that molecular detection of residual cancer cells using RT-PCR amplifying CEA and CK-19mRNA in axillary drainage fluid is an independent predictive factor for LRR in patients with pT1/2 breast cancer and with one to three positive axillary nodes treated with modified radical mastectomy without adjuvant radiotherapy. Although larger studies still are needed to explore whether this surrogate marker is of value in the adjuvant setting, we believe that evidence is increasing for its use in detecting occult, potentially recurrent cells as part of the follow-up of cancer patients. This approach might provide a better estimate of such subgroup patients’ risk for LRR and might facilitate individualization of treatment.
REFERENCES 1. Overgaard M, Hansen PS, Overgaard J, et al. Postoperative radiotherapy in high-risk premenopausal women with breast cancer who receive adjuvant chemotherapy. N Engl J Med 1997; 337:949 –955. 2. Ragaz J, Jackson SM, Le N, et al. Adjuvant radiotherapy and chemotherapy in node-positive premenopausal women with breast cancer. N Engl J Med 1997;337:956 –962. 3. Early Breast Cancer Trialists’ Collaborative Group. Favourable and unfavourable effects on long-term survival of radiotherapy for early breast cancer: an overview of the randomized trials. Lancet 2000;355:1757–1770. 4. Recht A, Bartelink H, Fourquet A, et al. Postmastectomy radiotherapy: questions for the twenty-first century. J Clin Oncol 1998;16:2886 –2889. 5. Recht A, Edge SB, Solin LJ, et al. Postmastectomy radiotherapy: Clinical practice guidelines of the American Society of Clinical Oncology. J Clin Oncol 2001;19:1539 –1569. 6. Griem KL, Henderson IC, Gelman R, et al. The 5-year results of a randomized trial of adjuvant radiation therapy after chemotherapy in breast cancer patients treated with mastectomy. J Clin Oncol 1987;5:1546 –1555. 7. Liljegren G, Holmberg L, Adami HO, et al. Sector resection with or without postoperative radiotherapy for Stage I breast cancer: Five-year results of a randomized trial. Uppsala-Orebro Breast Cancer Study Group. J Natl Cancer Inst 1994;86: 717–722. 8. Overgaard M, Christensen JJ, Johansen H, et al. Evaluation of radiotherapy in high-risk breast cancer patients: Report from the Danish Breast Cancer Cooperative Group (DBCG 82) trial. Int J Radiat Oncol Biol Phys 1990;19:1121–1124. 9. Fowble B. Postmastectomy radiation in patients with one to three positive axillary nodes receiving adjuvant chemotherapy: An unresolved issue. Semin Radiat Oncol 1999;9:230 – 240. 10. Goldhirsch A, Glick JH, Gelber RD, et al. Meeting highlights:
11. 12. 13. 14. 15.
16. 17.
18.
19. 20.
International Consensus Panel on the Treatment of Primary Breast Cancer. J Clin Oncol 2001;19:3817–3827. Harris JR, Halpin-Murphy P, McNeese M, et al. Consensus statement on postmastectomy radiation therapy. Int J Radiat Oncol Biol Phys 1999;44:989 –990. Pierce LJ. Treatment guidelines and techniques in delivery of postmastectomy radiotherapy in management of operable breast cancer. J Natl Cancer Inst Monogr 2001;30:117–124. Sauer R, Schulz KD, Hellriegel KP. [Radiation therapy after mastectomy—interdisciplinary consensus puts an end to a controversy.] Strahlenther Onkol 2001;177:1–9. Host H, Brennhovd IO, Loeb ML. Postoperative radiotherapy in breast cancer—Long-term results from the Oslo study. Int J Radiat Oncol Biol Phys 1986;12:727–732. Sykes HF, Sim DA, Wong CJ, et al. Local-regional recurrence in breast cancer after mastectomy and adriamycin-based adjuvant chemotherapy: Evaluation of the role of postoperative radiotherapy. Int J Radiat Oncol Biol Phys 1989;16:641– 647. Buzdar A, McNeese MD, Hortobagyi GN, et al. Is chemotherapy effective in reducing the local failure rate in patients with operable breast cancer? Cancer 1990;65:394 –399. Fowble B, Gray R, Gilchrist K, et al. Identification of a subgroup of patients with breast cancer and histologically positive axillary nodes receiving adjuvant chemotherapy who may benefit from postoperative radiotherapy. J Clin Oncol 1988;6:1107–1117. Kaufmann M, Jonat W, Abel U, et al. Adjuvant randomized trials of doxorubicin/cyclophosphamide/tamoxifen and CMF chemotherapy versus tamoxifen in women with node-positive breast cancer. J Clin Oncol 1993;11:454 – 460. van der Hage JA, Putter H, Bonnema J, et al. Impact of locoregional treatment on early-stage breast cancer patients: A retrospective analysis. Eur J Cancer 2003;39:2192–2199. Overgaard M, Jensen M, Overgaard J, et al. Postoperative radiotherapy in high-risk postmenopausal breast-cancer pa-
Quantitative molecular diagnosis for axillary drainage fluid
21.
22. 23.
24. 25. 26.
27. 28. 29. 30.
31. 32. 33. 34.
35.
36.
37. 38. 39.
tients given adjuvant tamoxifen: Danish Breast Cancer Cooperative Group DBCG 82c randomised trial. Lancet 1999;353:1641–1648. Evron E, Barzily L, Rakowsky E, et al. Postoperative locoregional radiation therapy for breast cancer patients with four or more involved lymph nodes or extracapsular extension. Isr J Med Assoc J 2005;7:439 – 442. Hellman S. Natural history of small breast cancers. J Clin Oncol 1994;12:2229 –2234. Boland GP, Chan KC, Knox WF, et al. Value of the Van Nuys Prognostic Index in prediction of recurrence of ductal carcinoma in situ after breast-conserving surgery. Br J Surg 2003; 90:426 – 432. Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2886 –2990. Frank JA, Ling A, Patronas NJ. Detection of malignant bone tumors: MR imaging vs scintigraphy. AJR Am J Roentgenol 1990;55:1043–1048. Molino A, Colombatti M, Bonetti F, et al. A comparative analysis of three different techniques for the detection of breast cancer cell in bone marrow. Cancer 1991;67:1033– 1036. Mattano LA, Moss T, Emerson SG. Sensitive detection of rare circulating neuroblastoma cells by the reverse transcriptase polymerase chain reaction. Cancer Res 1992;52:4701– 4705. Campana D, Pui CH. Detection of minimal residual disease in acute leukemias: Methodological advances and clinical significance. Blood 1995;85:1416 –1434. Mori M, Mimori K, Ueo H, et al. Molecular detection of circulating solid carcinoma cells in the peripheral blood: The concept of early systemic disease. Int J Cancer 1996;68:739 –743. Gerhard M, Juhl H, Kalthoff H, et al. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994;12:725–729. Datta YH, Adams PT, Drobyski WR, et al. Sensitive detection of occult breast cancer by reverse-transcriptase polymerase chain reaction. J Clin Oncol 1994;12:475– 482. Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2886 –2990. Peck K, Sher Y-P, Shih J-Y, et al. Detection and quantitation of circulating cancer cells in peripheral blood of lung cancer patients. Cancer Res 1998;58:2761–2765. Aihara T, Noguchi S, Ishikawa O, et al. Detection of pancreatic and gastric cancer cells in peripheral and portal blood by amplification of keratin 19 mRNA with reverse transcriptasepolymerase chain reaction. Int J Cancer 1997;72:408 – 411. Berois N, Varangot M, Aizen B, et al. Molecular detection of cancer cells in bone marrow and peripheral blood of patients with operable breast cancer. Comparison of CK19, MUC1 and CEA using RT-PCR. Eur J Cancer 2000;36:717–723. Dingemans A-MC, Brakenhoff RH, Postmus PE, et al. Detection of cytokeratin-19 transcripts by reverse transcriptasepolymerase chain reaction in lung cancer cell lines and blood of lung cancer patients. Lab Invest 1997;77:213–220. Kaplan El, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457– 481. Cox DR. Regression models and life table. J R Stat Soc B 1972;34:197–220. Gines P, Quintero E, Arroyo V, et al. Compensated cirrhosis:
40.
41.
42.
43.
44.
45.
46.
47.
48. 49.
50. 51.
52. 53.
● Y. ZHANG et al.
511
Natural history and prognostic factors. Hepatology 1987;7:122–128. Solin LJ, Fourquet A, Vicini FA, et al. Mammographically detected ductal carcinoma in situ of the breast treated with breastconserving surgery and definitive irradiation: Long-term outcome and prognostic significance of patient age and margin status. Int J Radiat Oncol Biol Phys 2001;50:991–1002. Garg AK, Strom EA, McNeese MD, et al. T3 disease at presentation or pathologic involvement of four or more lymph nodes predict for locoregional recurrence in Stage II breast cancer treated with neoadjuvant chemotherapy and mastectomy without radiotherapy. Int J Radiat Oncol Biol Phys 2004;59:138 –145. Truong PT, Olivotto IA, Kader HA, et al. Selecting breast cancer patients with T1-T2 tumors and one to three positive axillary nodes at high postmastectomy locoregional recurrence risk for adjuvant radiotherapy. Int J Radiat Oncol Biol Phys 2005;61:1337–1347. Woodward WA, Strom EA, Tucker SL, et al. Locoregional recurrence after doxorubicin-based chemotherapy and postmastectomy: Implications for breast cancer patients with early-stage disease and predictors for recurrence after postmastectomy radiation. Int J Radiat Oncol Biol Phys 2003;57:336 –344. Cheng JC, Chen CM, Liu MC, et al. Locoregional failure of postmastectomy patients with 1–3 positive axillary lymph nodes without adjuvant radiotherapy. Int J Radiat Oncol Biol Phys 2002;52:980 –988. Bijker N, Peterse JL, Duchateau L, et al. Risk factors for recurrence and metastasis after breast-conserving therapy for ductal carcinoma-in-situ: Analysis of European Organization for Research and Treatment of Cancer Trial 10853. J Clin Oncol 2001;19:2263–2271. Kestin LL, Goldstein NS, Lacerna MD, et al. Factors associated with local recurrence of mammographically detected ductal carcinoma in situ in patients given breast-conserving therapy. Cancer 2000;88:596 – 607. Fisher B, Dignam J, Wolmark N, et al. Tamoxifen in treatment of intraductal breast cancer: National Surgical Adjuvant Breast and Bowel Project B-24 randomised controlled trial. Lancet 1999;353:1993–2000. Ries LA, Henson DE, Harras A. Survival from breast cancer according to tumor size and nodal status. Surg Oncol Clin North Am 1994;3:35–52. Carter CL, Allen C, Henson DE. Relation of tumor size, lymph node status, and survival in 24,740 breast cancer cases. The Surveillance, Epidemiology, End Results (SEER) program of the National Cancer Institute. Cancer 1989;63:181–187. Rosen PP, Groshen S, Saigl PE, et al. A long-term follow-up study of survival in Stage I (T1N0M0) and Stage II (T1N1M0) breast carcinoma. J Clin Oncol 1989;7:355–366. van Dongen JA, Bartelink H, Fentiman IS, et al. Randomized clinical trial to assess the value of breast-conserving therapy in stage I and II breast cancer, EORTC 10801 trial. J Natl Cancer Inst Monogr 1992;11:15–18. Borger JH. The impact of surgical and pathological findings on radiotherapy of early breast cancer. Radiother Oncol 1991; 22:230 –236. Fisher B, Anderson S. Conservative surgery for the management of invasive and noninvasive carcinoma of the breast: NSABP trials. National Surgical Adjuvant Breast and Bowel Project. World J Surg 1994;18:63– 69.
doi:10.1016/j.ijrobp.2005.07.984
CLINICAL INVESTIGATION
Breast
QUANTITATIVE MOLECULAR DIAGNOSIS OF AXILLARY DRAINAGE FLUID FOR PREDICTION OF LOCOREGIONAL FAILURE IN PATIENTS WITH ONE TO THREE POSITIVE AXILLARY NODES AFTER MASTECTOMY WITHOUT ADJUVANT RADIOTHERAPY YONG ZHANG, M.D., PH.D.,*‡ QING YONG MA, M.D., PH.D.,* CHENG XUE DANG, M.D., PH.D.,† M. MOUREAU-ZABOTTO, M.D., PH.D.,§ AND WU KE CHEN, M.D., PH.D.† Departments of *Hepatobiliary Surgery and †Surgical Oncology, The First Hospital of Xi’an Jiaotong University, Xi’an, China; Department of Surgery and Clinical Oncology, Graduate School of Medicine, Osaka University, Osaka, Japan; §Department of Surgery and Surgical Basic Science, Kyoto University Graduate School of Medicine, Kyoto, Japan
‡
Purpose: A quantitative multiple-marker reverse transcriptase (RT)-polymerase chain reaction (PCR) assay for sensitive detection of cancer cells in axillary drainage fluid was developed to examine whether the presence of cancer cells in axillary drainage fluid can be used as a predictor of locoregional recurrence (LRR) in patients with breast cancer who had T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without adjuvant radiotherapy. Methods and Materials: Axillary drainage fluid was collected from 126 patients with invasive ductal carcinoma of the breast who were treated with modified radical mastectomy and were found to have one to three positive axillary nodes. Cancer cells in axillary drainage fluid were detected by RT-PCR assay using primers specific for carcinoembryonic antigen (CEA) and cytokeratin-19 (CK-19) together with numerous clinicopathologic and treatment-related factors and were analyzed for their impact on LRR. Results: A total of 38 patients suffered LRR during follow-up and the multimarker RT-PCR assays for CEA and CK-19 in the axillary drainage fluid both were positive in 34 patients (27.0%), of which 29 patients had LRR. In univariate analysis, the 5-year LRR-free survival showed higher rates in patients with PCR-negative findings in axillary drainage fluid (p < 0.0001), age >40 years old (p < 0.0001), tumor size <2.5 cm (p < 0.0001), negative lymph-vascular space invasion (p ⴝ 0.026), and T1 status (< 0.0001); in multivariate analysis, PCR-positive findings together with age and tumor size were found to be independent predictors of LRR (all p < 0.05). Conclusion: Multiplex RT-PCR assay for CEA and CK-19 was highly sensitive for detection and might be useful for prediction of LRR in such subgroup breast cancer patients. © 2006 Elsevier Inc. Locoregional recurrence, Axillary drainage fluid, RT-PCR, Radiotherapy, Molecular detection.
INTRODUCTION
able to hypothesize that a survival benefit from PMRT would be unlikely in a population of breast cancer patients who have a low probability of LRR after mastectomy, but the patients with some other high-risk features may benefit from PMRT. Therefore, there is an urgent need to explore strategies to distinguish subsets at high risk of LRR (justifying use of PMRT) from those at sufficiently low risk of LRR (who may be spared PMRT), because LRR can be mostly attributed to the residual tumor cells, and the proliferative potential of these cells determines the clinical outcomes (22–24). Conventional methods of detection, including morphology, flow cytometry, cytogenetic analyses, and immunocytochemistry, are all limited in sensitivity and
Postmastectomy radiotherapy (PMRT) is an important contributor to reduce locoregional recurrence (LRR) in breast cancer patients with T1/2 tumors and four or more positive axillary lymph nodes and, in doing so, improves overall survival (1– 8). However, the role of PMRT in the patients with T1/2 tumors and one to three positive axillary nodes is still a controversial issue and being debated (5, 9 –14), although two trials have recently shown the LRR rates in patients with one to three involved nodes were much higher than in other series (15–18) and that patients benefited from PMRT (2, 19 –21). Based on the inconsistencies in the available evidence observed in these patients, it is reasonReprint requests to: Qing Yong Ma, M.D., Ph.D., Department of Hepatobiliary Surgery, First Hospital of Xi’an Jiaotong University, 1 Jiankang Rd., Xi’an, China 710061. Tel: (⫹86) 29-532-4009; Fax: (⫹86) 29-526-3190; E-mail: [email protected] Supported by the Young Scientist Scholars Program, the Jointed
Chinese and Japanese Cancer Medicine Society, New Investigator Award. Received May 20, 2005, and in revised form July 26, 2005. Accepted for publication July 27, 2005. 505
506
I. J. Radiation Oncology
● Biology ● Physics
specificity (25, 26). More recently, molecular diagnosis with reverse transcriptase-polymerase chain reaction (RTPCR) has been developed as a sensitive method for detecting circulating tumor cells and led to an explosion of studies analyzing novel genetic markers as prognostic indicators of breast cancer (27, 28). Some previous studies have demonstrated that RT-PCR amplification of carcinoembryonic antigen (CEA) mRNA is an efficient means of detecting abdominal cancer or breast cancer cells in the bone marrow or in peripheral blood and was a prognostic indicator (29, 30). Recently, cytokeratin-19 (CK-19) has also been successfully used as an index of disseminated tumor cells in blood, bone marrow, and lymph nodes in patients with breast cancer (31, 32) and other epithelial cancers including, lung, pancreas, and stomach (33–35). However, to the best of our knowledge, there are no prospective studies in the literature evaluating the value of the residual tumor cells in the fluid that accumulates in the axilla after breast operations. In an effort to define whether the presence of cancer cells in axillary drainage fluid can be used as a predictor of LRR in patients with breast cancer who had T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without PMRT, we have developed a combined multimarker (CEA and CK-19) quantitative real-time RT-PCR analysis to provide a more precise and powerful tool for the detection of residual tumor cells in the axillary drainage fluid, and, moreover, to evaluate their ability for identifying patients at high risk for LRR. PATIENTS AND METHODS Patient population, collection of axillary drainage fluid, treatment, and follow-up Between May 1996 and December 1999, 126 consecutive female patients referred with pT1/T2 breast cancer with one to three positive axillary nodes were treated with modified radical mastectomy followed by adjuvant chemotherapy using different chemotherapy regimens beginning 2– 4 weeks after surgery at our department. All axillae were drained postoperatively by closed vacuum drains (Ch-14, Biometrix, Chelmsford, MA). The output of the drain was collected and measured every 24 h, and the drains were removed when the output was less than 25 mL/24 h. The presence of CEA, CK-19, and -actin was assessed in the fluid collected during the second postoperative day, because the fluid collected in the first 24 h can contain large quantities of erythrocytes and debris. Moreover, to confirm the absence of CEA and CK-19 in the axillary drainage fluid of non– breast cancer patients, 10 patients with malignant melanoma who underwent axillary sentinel lymph node biopsy in addition to wide local excision were recruited as control group. The chemotherapy regimens consisted of three combinations: cyclophosphamide (600 mg/m2 body surface area), methotrexate (60 mg/m2), and fluorouracil (600 mg/m2) (CMF regimen) in 54 patients; cyclophosphamide (500 mg/m2), doxorubicin (50 mg/m2), and fluorouracil (500 mg/m2) (CAF regimen) in 30 patients; and paclitaxel (150 mg/m2) in 42 patients. Informed consent was obtained from each patient, and the study was approved by the ethics committees at our institution. Clinicopathologic characteristics of the 126 patients are summarized in
Volume 64, Number 2, 2006
Table 1. Clinical characteristics of patients undergoing modified radical mastectomy without PMRT Variable
n
Total Age (y) ⬍40 ⱖ40 Menopausal status Premenopausal Postmenopausal* Tumor location Outer quadrants Center/inner quadrants T classification T1 T2 Tumor size (cm) ⬍2.5 ⱖ2.5 Involved lymph nodes (n) 1 2 3 Estrogen receptor protein status Positive Negative Progesterone receptor protein status Positive Negative CEA mRNA Positive Negative CK-19 mRNA Positive Negative
126
% 100
44 82
34.9 65.1
87 39
69.0 31.0
56 70
44.4 55.6
59 67
46.8 53.2
77 49
61.1 38.9
34 44 48
27.0 34.9 38.1
41 85
32.5 67.5
53 73
42.1 57.9
46 80
36.5 63.5
39 87
31.0 69.0
Abbreviations: PMRT ⫽ postmastectomy radiotherapy; CEA ⫽ carcinoembryonic antigen. * Postmenopausal status was defined as ⱖ12 months of amenorrhea or, for women who had undergone hysterectomy, age ⬎55 years.
Table 1. Patient follow-up consisted of chest X-rays, mammograms, bone scans, abdominal ultrasound examinations, and blood tests. The median follow-up period was 46 months (range 2– 68 months). All LRRs, including those concurrent with or after a distant metastasis, were recorded. Sites of LRR included the ipsilateral chest wall and axillary, supraclavicular, infraclavicular, or internal mammary lymph nodes. Evidence of disease at any other site was considered distant metastasis. Survival times were calculated as the time from surgery to the date of the event or the end of the follow-up period. Details of patients lost to follow-up (7 patients) were inserted in the analysis as censored data.
Real-time quantitative RT-PCR The collection of axillary drainage fluid was centrifuged at 300 ⫻ g for 5 min; the cell pellet was dissolved with 1 mL of TRIZOL Reagent (Invitrogen, Carlsbad, CA) for extracting total RNA according to the manufacturer’s instructions. The amount of extracted RNA was quantified by measuring the absorbance at 260 nm. The purity of the RNA was checked by the ratio between the absorbance values at 260 and 280 nm, and ranged between 1.83 and 2.00, demonstrating the high quality of the RNA. Moreover, the absence of
Quantitative molecular diagnosis for axillary drainage fluid
● Y. ZHANG et al.
507
positive samples is set at CEA, CK-19/-actin ⱖ4 according to our previous pilot study. With the use of this cutoff for CEA and CK-19 quantitative RT-PCR gives a sensitivity of 76.3% and a specificity of 100%. These results are in agreement with previous studies that show that CK19 and CEA RT-PCR assays are powerful methods for detecting disseminated breast cancer cells in bone marrow aspirates of patients with operable breast cancer (35, 36).
Statistical analysis
Fig. 1. Total RNA was extracted from the axillary drainage fluid which was not degraded and showed clear 18S and 28S bands under ultraviolet light by electrophoresis on 1.5% agarose gel containing ethidium bromide. degradation of the RNA was confirmed by electrophoresis on a 1.5% agarose gel containing ethidium bromide. Only samples that were not degraded and showed clear 18S and 28S bands under ultraviolet light were used for real-time RT-PCR (Fig. 1). cDNA was generated with avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI) using the protocol recommended by the manufacturer. Briefly, 1 g of RNA, mixed with RT reaction reagents including oligo-(dT)15 primer, was incubated at 42°C for 15 min, followed by heating at 95°C for 5 min for enzyme inactivation. Quantitative PCR was performed using real-time PCR with a LightCycler (Idaho Tech Inc., Salt Lake City, UT). PCR reagents contained 1x LightCycler DNA Master SYBR Green I (Roche Diagnostics, Mannheim, Germany), 0.2 M of each primer, 3 mM MgCl2, and 2 L of cDNA template. PCR conditions for -actin, CEA, and CK-19 were as follows: 1 cycle of denaturing at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 62°C for 5 s, and 72°C for 10 s. To verify the integrity of RNA and to improve the diagnostic quality, the housekeeping gene -actin was amplified quantitatively. Because the SYBR Green will detect any double-stranded DNA, including primer dimers, contaminating DNA, and PCR product from misannealed primer, melting curves were generated for all samples after each run to characterize the amplified products. The intensity of fluorescence was calculated at each cycle and the standard curve was constructed with threefold serial dilutions of cDNA obtained from human mammary carcinoma cell line T47D. The primer sequences for PCR amplification were as follows: -actin sense: 5= CTCTTCCAGCCTTCCTTCCT3=, -actin anti-sense: 5= AGCACTGTGTTGGCGTACAG3=, CEA sense: 5=-TCTGGAACTTCTCCTGGTCTCTCTCAGCTGG-3=, CEA anti-sense: 5=-TGTAGCTGTTGCAAATGCTTTAAGGAAGAAGC-3=, CK-19 sense: 5=-CATGAAAGCTGCCTTGGAAGA-3=, CK-19 anti-sense: 5=-TGATTCTGCCGCTCACTATCAG-3=. The amplified product size was 116 base pairs (bp) for -actin mRNA, 160 bp for CEA mRNA, and 121 bp for CK-19 mRNA. The optimal cutoff value of
The following endpoints were studied: the occurrence of isolated LRR (coming before distant relapse) for isolated LRR-free survival; locoregional or distant relapse (whichever came first) for disease-free survival; and death from breast cancer, other malignancy, or death without cancer for overall survival. Survival and recurrence rates were estimated by the Kaplan-Meier method and compared by the log–rank test (37). Regression analyses were done according to the methods of Cox (38). Relative risks (RR) and associated confidence intervals (CI) were calculated from the proportional regression coefficients. The patient characteristics of those who did and did not experience LRR were compared using chi-square tests. All analyses were conducted using Statistical Package for Social Sciences, version 13.0 (SPSS, Chicago, IL). p values of less than 0.05 were considered to be statistically significant.
RESULTS Quantitative genetic diagnosis and clinicopathologic factors All axillary drainage fluid from non– breast cancer surgery (n ⫽ 10) were negative for quantitative RT-PCR of CEA and CK-19 expression with the exception of 1 case of surgery for cholelithiasis that was positive for CK-19 mRNA (Fig. 2). On the other hand, 46 of 126 (36.5%) patients were positive for CEA expression and 39 (31.0%) were positive for CK-19. Fifty-one (40.5%) patients were positive for at least one marker. A total of 38 patients
Fig. 2. Quantitative results of reverse transcriptase-polymerase chain reaction on axillary drainage fluid. Ratio of marker expression/-actin expression is shown as dots in non– breast cancer controls (left two lanes) and breast cancer patients (right two lanes).
508
I. J. Radiation Oncology
● Biology ● Physics
Volume 64, Number 2, 2006
Table 2. Univariate analyses for 5-year LRR-free survival Variable Age (y) ⬍40 ⱖ40 Menopausal status Premenopausal Postmenopausal* Tumor location Outer quadrants Center/inner quadrants T classification T1 T2 Tumor size (cm) ⬍2.5 ⱖ2.5 Involved lymph nodes (n) 1 2 3 Estrogen receptor protein status Positive Negative Progesterone receptor protein status Positive Negative LVI Present Absent Chemotherapy agents CMF CAF Paclitaxel CEA mRNA and/or CK-19 mRNA Both CEA mRNA and CK-19 mRNA positive Any one of CEA mRNA and CK-19 mRNA negative
No. (n)
LRR (n)
5-year LRR-free survival rate (%)
44 82
34 4
15 95
87 39
25 13
71 59
56 70
16 22
66 68
59 67
4 34
93 41
77 49
2 36
97 20
34 44 48
12 14 12
63 59 74
41 85
7 31
83 60
53 73
15 23
70 64
61 65
24 14
57 77
54 30 42
12 12 14
76 56 65
34
29
8
92
9
91
p ⬍0.0001 0.970 0.552 ⬍0.0001 ⬍0.0001 0.323
0.147 0.630 0.026 0.158
⬍0.0001
Abbreviations: LRR ⫽ locoregional recurrence; LVI ⫽ lymphovascular invasion; CEA ⫽ carcinoembryonic antigen; CAF ⫽ cyclophosphamide, doxorubicin (Adriamycin), and fluorouracil; CMF ⫽ cyclophosphamide, methotrexate, and fluorouracil. * Postmenopausal status was defined as ⱖ12 months of amenorrhea or, for women who had undergone hysterectomy, age ⬎55 years.
suffered LRR during fellow-up, and the multimarker RTPCR assays for CEA and CK-19 in the axillary drainage fluid were both positive in 34 patients (27.0%), of which 29 patients had LRR.
Mathematical model of predicting survival With the significant predictive variables obtained in the multivariate analysis, the relative risk of LRR was calculated
Univariate and multivariate analyses for prognostic factors of LRR Table 2 presents the univariate analyses for risk factors of LRR. The factors of significance for LRR were age ⬍40 years (p ⬍ 0.0001), tumor size ⱖ2.5 cm (p ⬍ 0.0001), presence of lymph-vascular space invasion (LVI) (p ⫽ 0.026), both molecular markers diagnosis positive (p ⬍ 0.0001), and T2 tumor state (p ⬍ 0.0001). In multivariate analysis, tumor size ⱖ2.5 cm, age ⬍40 years, and both molecular markers diagnosis positive were statistically significant independent predictors of LRR (Table 3).
Table 3. Multivariate analyses for 5-year LRR-free survival Variable Age (y) (⬍40 vs. ⱖ40) Tumor size (ⱖ2.5 vs. ⬍2.5 cm) Both CEA mRNA and CK-19 mRNA positive vs. any one of CEA mRNA and CK-19 mRNA negative
Relative risk (95% CI)
p
3.38 (0.96–11.76) 8.33 (1.42–48.75)
0.046 0.019
3.65 (1.53–8.67)
0.003
Abbreviations: LRR ⫽ locoregional recurrence; CI ⫽ confidence interval; CEA ⫽ carcinoembryonic antigen.
Quantitative molecular diagnosis for axillary drainage fluid
Fig. 3. Probability of locoregional recurrence (LRR)-free survival of breast cancer patients with T1/2 primary tumors and one to three positive axillary lymph nodes treated with modified radical mastectomy without adjuvant radiotherapy divided into three groups according to their relative risk of LRR. Group A, a prognostic index ⬍1.5 (57 patients); group B, a prognostic index 1.5–3.0 (30 patients); and group C, a prognostic index ⬎3.0 (39 patients). Plus marks indicate censored cases. p ⬍ 0.0001.
based on the regression coefficients for each patient using the equation: (LRR) ⫽ exp (tumor size ⱖ2.5 cm ⫻ 2.12 ⫹ age ⬍40 years ⫻ 1.22 ⫹ both molecular markers diagnosis positive ⫻ 1.30). Higher values of LRR indicate earlier locoregional recurrence and worse prognosis. Detailed information about this method was provided in previous reports (39). The LRR of each patient was calculated and ranged between 0.000 and 4.64; it was feasible to divide the series into three groups according to the prognostic index, as follows: group A, a LRR index ⬍1.5 (57 patients); group B, a LRR index 1.5–3.0 (30 patients); and group C, a LRR index ⬎3.0 (39 patients). The recurrence curves for these groups are shown in Fig. 3. There was a significant difference among the three groups in the LRR-free time (mean LRR time, group A, 61.4 months; group B, 35.2 months; and group C, 13.1 months) (p ⬍ 0.0001). DISCUSSION Postmastectomy irradiation in more advanced disease clearly reduces the risk of LRR (1–7). However, debates concerning prognostic factors to indicate adjuvant locoregional radiotherapy in addition to adjuvant systemic therapy still continue. Reasons for the use of PMRT in women with node-positive breast cancer include a reduction of the risks for LRR and distant relapse (3– 8, 14, 15). The current consensus about the indication for postmastectomy irradiation is that it should be recommended to patients with four or more positive nodes and patients with T3 tumors (4, 6, 8), but whether or not to use it in patients with one to three
● Y. ZHANG et al.
509
involved nodes is still being debated (5, 7–14). In addition, few data are available to demonstrate accurate factors predictive of LRR for patients who receive postmastectomy radiation. Such data might be useful for determining subsets of patients for whom different locoregional treatment strategies should be considered and may benefit from PMRT. Immunocytology is regarded as the standard method for tumor cell detection in body cavity fluids, including peritoneal fluid, pleural fluid, and pericardial effusions. However, this observer-dependent method is hampered by a low sensitivity and is always a subjective decision in defining what is positive or negative. In our pilot study, although we found specificity of axillary drainage fluid cytologic examination as high as 91%, the sensitivity is only 35% (data not shown). The low sensitivity and specificity of this methodology are not unexpected and are consistent with other previous reports studied regarding tumor cell detection in other postsurgical body cavity drainage fluids (25, 26, 33– 36). This has led to the deployment of molecular techniques in the hope of enhancing the sensitivity. Previous researchers have successfully demonstrated that CEA and CK-19 were good target genes for detecting breast cancer cells in the bone marrow or peripheral blood using RT-PCR and can be used as a sound predictor for both LRR and prognosis (29 –33). However, one problem with this method is that a finding of CEA mRNA merely indicates the presence of epithelial cells, not just only cancer cells. Because CEA is not a specific marker for breast cancer cells, this technique does not provide absolute identification. Moreover, CK-19 has also been controversial because of false-positive results in normal blood attributed to contamination with skin cells at venipuncture or to illegitimate transcription in peripheral blood leukocytes (36). Considering this background and to reduce these false-positive cases, we introduced a multiplemarker RT-PCR assay and quantitative PCR technique to improve the sensitivity and specificity of this method to test whether tumor cell detection in axillary drainage fluid by means of both CEA and CK-19 mRNA RT-PCR was an exact indicator for LRR, because LRR can be mostly attributed to the residual tumor cells, and the proliferative potential of these cells determines the clinical outcomes (22–24). The ability to identify patients with T1/T2 breast cancer and one to three positive nodes at high risk for LRR may be used to select patients for PMRT. Our multiple-marker quantitative RT-PCR assay for detecting the residual cancer cells in the axillary drainage fluid showed high sensitivity and specificity considering that all the axillary drainage fluid from control cases was negative for CEA mRNA and only one case was positive for CK-19 mRNA. Therefore, a 41.3% improvement in sensitivity and a 9% improvement in specificity are achieved by our quantitative RT-PCR assay compared with immunocytology. In this study, we found age ⬍40 years (p ⬍ 0.0001), tumor size ⱖ2.5 cm (p ⬍ 0.0001), presence of LVI (p ⫽ 0.026), and T2 tumor state (p ⬍ 0.0001) were factors of significance for LRR. These findings are consistent with
510
I. J. Radiation Oncology
● Biology ● Physics
results from univariate analyses reported in previous studies (33, 35, 40 – 47). Younger age at the time of breast cancer diagnosis has been associated with an increased risk of LRR, although different definitions for younger age have been used and also been thoroughly discussed in previous studies (40 – 47). Tumor size 1 cm or smaller has been shown with a very favorable prognosis and low LRR (48, 49). In node-negative breast cancer patients, tumor size has been considered the most important single prognostic factor for LRR and overall survival; however, tumor size has also been correlated closely with axillary lymph node metastases (50). In some studies, patients with tumors larger than 2 cm on histologic examination were at increased risk of developing local recurrence, particularly those who were not given radiotherapy (51–53). We found tumor size to be an independent risk factor for the development of LRR; we used 2.5 cm as a cutoff because that was the median tumor size in our population. The result was constant with other reports defining a cutoff of 3 cm in those patients who suffered T1/2 primary tumors together with one to three positive axillary lymph nodes (40 – 45). A predictive index of LRR proposed in the present investigation was used based on regression coefficients of the three independent prognostic factors. Patients could be clas-
Volume 64, Number 2, 2006
sified into three groups: low risk (Group A), intermediate (Group B), and high risk (Group C). This index can be easily calculated because it is based on variables obtained during routine clinical examinations. This index, therefore, may be helpful in making LRR assessments and determining treatment strategies for patients with pT1/2 breast cancer and one to three positive axillary nodes. Accordingly, it could be concluded that patients with LRR ⬎1.5 should be enrolled in some therapeutic assay such as PMRT because of their extremely earlier affected LRR after the surgery. In conclusion, this is the first report to show that molecular detection of residual cancer cells using RT-PCR amplifying CEA and CK-19mRNA in axillary drainage fluid is an independent predictive factor for LRR in patients with pT1/2 breast cancer and with one to three positive axillary nodes treated with modified radical mastectomy without adjuvant radiotherapy. Although larger studies still are needed to explore whether this surrogate marker is of value in the adjuvant setting, we believe that evidence is increasing for its use in detecting occult, potentially recurrent cells as part of the follow-up of cancer patients. This approach might provide a better estimate of such subgroup patients’ risk for LRR and might facilitate individualization of treatment.
REFERENCES 1. Overgaard M, Hansen PS, Overgaard J, et al. Postoperative radiotherapy in high-risk premenopausal women with breast cancer who receive adjuvant chemotherapy. N Engl J Med 1997; 337:949 –955. 2. Ragaz J, Jackson SM, Le N, et al. Adjuvant radiotherapy and chemotherapy in node-positive premenopausal women with breast cancer. N Engl J Med 1997;337:956 –962. 3. Early Breast Cancer Trialists’ Collaborative Group. Favourable and unfavourable effects on long-term survival of radiotherapy for early breast cancer: an overview of the randomized trials. Lancet 2000;355:1757–1770. 4. Recht A, Bartelink H, Fourquet A, et al. Postmastectomy radiotherapy: questions for the twenty-first century. J Clin Oncol 1998;16:2886 –2889. 5. Recht A, Edge SB, Solin LJ, et al. Postmastectomy radiotherapy: Clinical practice guidelines of the American Society of Clinical Oncology. J Clin Oncol 2001;19:1539 –1569. 6. Griem KL, Henderson IC, Gelman R, et al. The 5-year results of a randomized trial of adjuvant radiation therapy after chemotherapy in breast cancer patients treated with mastectomy. J Clin Oncol 1987;5:1546 –1555. 7. Liljegren G, Holmberg L, Adami HO, et al. Sector resection with or without postoperative radiotherapy for Stage I breast cancer: Five-year results of a randomized trial. Uppsala-Orebro Breast Cancer Study Group. J Natl Cancer Inst 1994;86: 717–722. 8. Overgaard M, Christensen JJ, Johansen H, et al. Evaluation of radiotherapy in high-risk breast cancer patients: Report from the Danish Breast Cancer Cooperative Group (DBCG 82) trial. Int J Radiat Oncol Biol Phys 1990;19:1121–1124. 9. Fowble B. Postmastectomy radiation in patients with one to three positive axillary nodes receiving adjuvant chemotherapy: An unresolved issue. Semin Radiat Oncol 1999;9:230 – 240. 10. Goldhirsch A, Glick JH, Gelber RD, et al. Meeting highlights:
11. 12. 13. 14. 15.
16. 17.
18.
19. 20.
International Consensus Panel on the Treatment of Primary Breast Cancer. J Clin Oncol 2001;19:3817–3827. Harris JR, Halpin-Murphy P, McNeese M, et al. Consensus statement on postmastectomy radiation therapy. Int J Radiat Oncol Biol Phys 1999;44:989 –990. Pierce LJ. Treatment guidelines and techniques in delivery of postmastectomy radiotherapy in management of operable breast cancer. J Natl Cancer Inst Monogr 2001;30:117–124. Sauer R, Schulz KD, Hellriegel KP. [Radiation therapy after mastectomy—interdisciplinary consensus puts an end to a controversy.] Strahlenther Onkol 2001;177:1–9. Host H, Brennhovd IO, Loeb ML. Postoperative radiotherapy in breast cancer—Long-term results from the Oslo study. Int J Radiat Oncol Biol Phys 1986;12:727–732. Sykes HF, Sim DA, Wong CJ, et al. Local-regional recurrence in breast cancer after mastectomy and adriamycin-based adjuvant chemotherapy: Evaluation of the role of postoperative radiotherapy. Int J Radiat Oncol Biol Phys 1989;16:641– 647. Buzdar A, McNeese MD, Hortobagyi GN, et al. Is chemotherapy effective in reducing the local failure rate in patients with operable breast cancer? Cancer 1990;65:394 –399. Fowble B, Gray R, Gilchrist K, et al. Identification of a subgroup of patients with breast cancer and histologically positive axillary nodes receiving adjuvant chemotherapy who may benefit from postoperative radiotherapy. J Clin Oncol 1988;6:1107–1117. Kaufmann M, Jonat W, Abel U, et al. Adjuvant randomized trials of doxorubicin/cyclophosphamide/tamoxifen and CMF chemotherapy versus tamoxifen in women with node-positive breast cancer. J Clin Oncol 1993;11:454 – 460. van der Hage JA, Putter H, Bonnema J, et al. Impact of locoregional treatment on early-stage breast cancer patients: A retrospective analysis. Eur J Cancer 2003;39:2192–2199. Overgaard M, Jensen M, Overgaard J, et al. Postoperative radiotherapy in high-risk postmenopausal breast-cancer pa-
Quantitative molecular diagnosis for axillary drainage fluid
21.
22. 23.
24. 25. 26.
27. 28. 29. 30.
31. 32. 33. 34.
35.
36.
37. 38. 39.
tients given adjuvant tamoxifen: Danish Breast Cancer Cooperative Group DBCG 82c randomised trial. Lancet 1999;353:1641–1648. Evron E, Barzily L, Rakowsky E, et al. Postoperative locoregional radiation therapy for breast cancer patients with four or more involved lymph nodes or extracapsular extension. Isr J Med Assoc J 2005;7:439 – 442. Hellman S. Natural history of small breast cancers. J Clin Oncol 1994;12:2229 –2234. Boland GP, Chan KC, Knox WF, et al. Value of the Van Nuys Prognostic Index in prediction of recurrence of ductal carcinoma in situ after breast-conserving surgery. Br J Surg 2003; 90:426 – 432. Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2886 –2990. Frank JA, Ling A, Patronas NJ. Detection of malignant bone tumors: MR imaging vs scintigraphy. AJR Am J Roentgenol 1990;55:1043–1048. Molino A, Colombatti M, Bonetti F, et al. A comparative analysis of three different techniques for the detection of breast cancer cell in bone marrow. Cancer 1991;67:1033– 1036. Mattano LA, Moss T, Emerson SG. Sensitive detection of rare circulating neuroblastoma cells by the reverse transcriptase polymerase chain reaction. Cancer Res 1992;52:4701– 4705. Campana D, Pui CH. Detection of minimal residual disease in acute leukemias: Methodological advances and clinical significance. Blood 1995;85:1416 –1434. Mori M, Mimori K, Ueo H, et al. Molecular detection of circulating solid carcinoma cells in the peripheral blood: The concept of early systemic disease. Int J Cancer 1996;68:739 –743. Gerhard M, Juhl H, Kalthoff H, et al. Specific detection of carcinoembryonic antigen-expressing tumor cells in bone marrow aspirates by polymerase chain reaction. J Clin Oncol 1994;12:725–729. Datta YH, Adams PT, Drobyski WR, et al. Sensitive detection of occult breast cancer by reverse-transcriptase polymerase chain reaction. J Clin Oncol 1994;12:475– 482. Schoenfeld A, Luqmani Y, Smith D, et al. Detection of breast cancer micrometastases in axillary lymph nodes by using polymerase chain reaction. Cancer Res 1994;54:2886 –2990. Peck K, Sher Y-P, Shih J-Y, et al. Detection and quantitation of circulating cancer cells in peripheral blood of lung cancer patients. Cancer Res 1998;58:2761–2765. Aihara T, Noguchi S, Ishikawa O, et al. Detection of pancreatic and gastric cancer cells in peripheral and portal blood by amplification of keratin 19 mRNA with reverse transcriptasepolymerase chain reaction. Int J Cancer 1997;72:408 – 411. Berois N, Varangot M, Aizen B, et al. Molecular detection of cancer cells in bone marrow and peripheral blood of patients with operable breast cancer. Comparison of CK19, MUC1 and CEA using RT-PCR. Eur J Cancer 2000;36:717–723. Dingemans A-MC, Brakenhoff RH, Postmus PE, et al. Detection of cytokeratin-19 transcripts by reverse transcriptasepolymerase chain reaction in lung cancer cell lines and blood of lung cancer patients. Lab Invest 1997;77:213–220. Kaplan El, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457– 481. Cox DR. Regression models and life table. J R Stat Soc B 1972;34:197–220. Gines P, Quintero E, Arroyo V, et al. Compensated cirrhosis:
40.
41.
42.
43.
44.
45.
46.
47.
48. 49.
50. 51.
52. 53.
● Y. ZHANG et al.
511
Natural history and prognostic factors. Hepatology 1987;7:122–128. Solin LJ, Fourquet A, Vicini FA, et al. Mammographically detected ductal carcinoma in situ of the breast treated with breastconserving surgery and definitive irradiation: Long-term outcome and prognostic significance of patient age and margin status. Int J Radiat Oncol Biol Phys 2001;50:991–1002. Garg AK, Strom EA, McNeese MD, et al. T3 disease at presentation or pathologic involvement of four or more lymph nodes predict for locoregional recurrence in Stage II breast cancer treated with neoadjuvant chemotherapy and mastectomy without radiotherapy. Int J Radiat Oncol Biol Phys 2004;59:138 –145. Truong PT, Olivotto IA, Kader HA, et al. Selecting breast cancer patients with T1-T2 tumors and one to three positive axillary nodes at high postmastectomy locoregional recurrence risk for adjuvant radiotherapy. Int J Radiat Oncol Biol Phys 2005;61:1337–1347. Woodward WA, Strom EA, Tucker SL, et al. Locoregional recurrence after doxorubicin-based chemotherapy and postmastectomy: Implications for breast cancer patients with early-stage disease and predictors for recurrence after postmastectomy radiation. Int J Radiat Oncol Biol Phys 2003;57:336 –344. Cheng JC, Chen CM, Liu MC, et al. Locoregional failure of postmastectomy patients with 1–3 positive axillary lymph nodes without adjuvant radiotherapy. Int J Radiat Oncol Biol Phys 2002;52:980 –988. Bijker N, Peterse JL, Duchateau L, et al. Risk factors for recurrence and metastasis after breast-conserving therapy for ductal carcinoma-in-situ: Analysis of European Organization for Research and Treatment of Cancer Trial 10853. J Clin Oncol 2001;19:2263–2271. Kestin LL, Goldstein NS, Lacerna MD, et al. Factors associated with local recurrence of mammographically detected ductal carcinoma in situ in patients given breast-conserving therapy. Cancer 2000;88:596 – 607. Fisher B, Dignam J, Wolmark N, et al. Tamoxifen in treatment of intraductal breast cancer: National Surgical Adjuvant Breast and Bowel Project B-24 randomised controlled trial. Lancet 1999;353:1993–2000. Ries LA, Henson DE, Harras A. Survival from breast cancer according to tumor size and nodal status. Surg Oncol Clin North Am 1994;3:35–52. Carter CL, Allen C, Henson DE. Relation of tumor size, lymph node status, and survival in 24,740 breast cancer cases. The Surveillance, Epidemiology, End Results (SEER) program of the National Cancer Institute. Cancer 1989;63:181–187. Rosen PP, Groshen S, Saigl PE, et al. A long-term follow-up study of survival in Stage I (T1N0M0) and Stage II (T1N1M0) breast carcinoma. J Clin Oncol 1989;7:355–366. van Dongen JA, Bartelink H, Fentiman IS, et al. Randomized clinical trial to assess the value of breast-conserving therapy in stage I and II breast cancer, EORTC 10801 trial. J Natl Cancer Inst Monogr 1992;11:15–18. Borger JH. The impact of surgical and pathological findings on radiotherapy of early breast cancer. Radiother Oncol 1991; 22:230 –236. Fisher B, Anderson S. Conservative surgery for the management of invasive and noninvasive carcinoma of the breast: NSABP trials. National Surgical Adjuvant Breast and Bowel Project. World J Surg 1994;18:63– 69.