Quercetin inhibits growth of hepatocellular carcinoma by apoptosis induction in part via autophagy stimulation in mice

Available online at www.sciencedirect.com

ScienceDirect Journal of Nutritional Biochemistry 69 (2019) 108 – 119

Quercetin inhibits growth of hepatocellular carcinoma by apoptosis induction in part via autophagy stimulation in mice Yi Ji a, b, d, 1, Li Li a, b, 1, Yan-Xia Ma c , Wen-Ting Li a, b, Liu Li b , Heng-Zhou Zhu a, b, Mian-Hua Wu a, b,⁎, Jin-Rong Zhou d,⁎⁎ b

a Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, China First Clinical Medical College, Jiangsu Collaborative Innovation Center of Traditional Chinese Medicine Prevention and Treatment of Cancer, Nanjing University of Chinese Medicine, Nanjing, China c College of Basic Medicine, Nanjing University of Chinese Medicine, Nanjing, China d Nutrition/Metabolism Laboratory, Department of Surgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA, USA

Received 23 December 2018; received in revised form 13 March 2019; accepted 25 March 2019

Abstract Quercetin (QCT) has been shown to have anticancer activities associated with apoptosis and autophagy induction. However, whether autophagy is functionally responsible for the inhibitory effect of QCT on hepatocellular carcinoma (HCC) remains elusive. This study aims to investigate if QCT inhibits HCC growth via autophagy induction. The in vitro experiments showed that QCT inhibited the growth of human HCC cells in dose- and time-dependent manners and had minimal cytotoxicity to normal hepatocytes. QCT increased both autophagosomes and autolysosomes in HCC cells, as determined by electron microscopy, GFP-RFP-LC3 fluorescence confocal microscopy and Western blot analysis of autophagy-related biomarkers. Functional assays using pathway-specific inhibitors, activators or siRNAs indicated that QCT stimulated autophagy in part via inhibiting the AKT/mTOR pathway and activating the MAPK pathways. Further functional experiments using autophagy inhibitors demonstrated that QCT induced apoptosis of HCC cells in part via stimulating autophagy. The in vivo studies showed that QCT significantly inhibited tumor growth associated with apoptosis induction and autophagy stimulation, and that inhibition of autophagy significantly alleviated the QCT effect on tumor growth inhibition and apoptosis induction. To the best of our knowledge, this is the first in vivo report to demonstrate that QCT inhibits HCC tumor growth and induces apoptosis in part via stimulation of autophagy. Our results provide strong experimental evidence to support that autophagy stimulation may be an important mechanism by which QCT induces cancer cell apoptosis, and pave the way for further clinical investigations by applying QCT or QCT-rich foods for HCC intervention. © 2019 Elsevier Inc. All rights reserved. Keywords: Quercetin; Hepatocellular carcinoma; Autophagy; Apoptosis; AKT/mTOR; MAPK

1. Introduction Liver cancer is highly fatal and is one of the most common cancers worldwide; it is the second and sixth leading cause of cancer death among men and women, respectively [1]. Hepatocellular carcinoma (HCC) is the most common type of liver cancer and represents 70%– 90% of all liver cancers. When HCC patients are diagnosed at early stages, surgical treatment is effective with favorable survival rates. However, most HCC patients are diagnosed at middle or late stages with invasion and metastasis, at which time surgery is no longer the optimal choice [2]. Other treatments, such as chemotherapy, molec-

ular targeted therapy, immunotherapy and radiotherapy, have moderate efficacy associated with severe side effects. Therefore, more efficacious and safe therapeutics for HCC are urgently needed. Quercetin (QCT, Fig. S1), a member of the flavonoids family, is one of the most prominent dietary antioxidants; it is widely distributed in foods including vegetables, fruit, tea as well as countless food supplements [3,4]. QCT is mostly present in the form of glycosides in plant foods, and some of the glycosides will be converted to QCT by the glycosidase and then generate metabolites in vivo [5,6]. QCT has been reported to possess antioxidative, anti-inflammatory and immunoregulatory properties and has been used for the prevention and

Abbreviations: 3-MA, 3-methyladenine; AKT, protein kinase B; ATG, autophagy-related; CCK-8, Cell Counting Kit-8; CMC, sodium carboxymethyl cellulose; ERK, extracellular signal-regulated kinase; H&E, hematoxylin and eosin; HCC, hepatocellular carcinoma; HCQ, hydroxychloroquine sulfate; IHC, immunohistochemistry; JNK, c-Jun N-terminal kinase; LC3, microtubule associated protein 1 light chain; MAPK, mitogen activated protein kinase; MK, MK-2206; mTOR, mechanistic target of rapamycin; PD, PD0325901; QCT, quercetin; SB, SB203580; SC, SC79; SP, SP600125; TEM, transmission electron microscopy; TUNEL, transferase dUTP nick end labeling ⁎ Correspondence to: M-H. Wu, Affiliated Hospital of Nanjing University of Chinese Medicine, 138 Xianlin Avenue, Qixia District, Nanjing, Jiangsu 210023, China. Tel.: +86 135 0519 9701. E-mail addresses: [email protected] (M.-H. Wu), [email protected] (J.-R. Zhou). 1 These authors contributed equally to the work in this manuscript. https://doi.org/10.1016/j.jnutbio.2019.03.018 0955-2863/© 2019 Elsevier Inc. All rights reserved.

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

treatment of cardiovascular diseases, diabetes, neurodegenerative disorders and cerebrovascular diseases [7–10]. QCT has also shown antigrowth activities against several types of cancers, including lung cancer [11], breast cancer [12], leukemia [13], colon cancer [14] and pancreatic cancer [15], via multiple mechanisms, such as inhibiting cell proliferation via DNA topoisomerase II inhibition and cell cycle arrest, inducing apoptosis, inhibiting invasion metastasis and activating immune destruction [16]. The inhibitory activity of QCT in HCC was also reported, and the results showed that QCT inhibited the growth of HCC through the inhibition of proliferation and/or induction of apoptosis [17–21]. Autophagy is a dynamic process of self-cannibalization through the lysosomal pathway in which cytoplasmic materials are sequestered into autophagosomes and fused with lysosomes to form autolysosomes [22,23]. Autophagy is tightly regulated by autophage-related (ATG) proteins. Among at least 16 ATG proteins, microtubule associated protein 1 light chain 3 (LC3), also called ATG8, is the only one known to form a stable association with the membrane of autophagosomes [24]. When autophagy is stimulated, LC3 is converted from the cytosolic LC3-I form to membrane-bound LC3-II form [25]. Detection of this conversion, especially the LC3-II level, has been used as a reliable marker for autophagy. Beclin1 protein, also an important ATG protein, is a “core” element in the initiation of autophagy [26]. The p62 protein is merged into the autophagosome by directly interacting with LC3 and is degraded by autophagy [27]. In the process of autophagy, beclin1 was up-regulated, and p62 was down-regulated [28]. Autophagy plays a complicated role in tumorigenesis and treatment responses. Previous research has generally supported, but with controversy, that autophagy may be tumor-suppressing in the early stages of tumorigenesis, whereas it may be tumor-promoting in established tumors [29,30]. As a consequence, strategies by both stimulating and inhibiting autophagy have been proposed for cancer treatment [31]. It has been reported that induction of autophagy was associated with the antigrowth activity of QCT against several types of cancers [14,32–35], including liver cancer [36]. However, a majority of studies have only determined association between QCT activity and autophagy modulation in vitro, and limited effort has been made to further investigate if modulation/induction of autophagy is functionally related to the mechanism of anticancer activity of QCT, especially in the in vivo models. In the present study, we aimed to evaluate the effect of QCT on the growth of HCC and elucidate if the regulation of autophagy provided an important mechanism of QCT action using both in vitro and in vivo models. 2. Material and methods 2.1. Materials Quercetin (≥98%) and sodium carboxymethyl cellulose (CMC) were purchased from Yuanye Biotechnology (Shanghai, China). DMSO was from Sigma-Aldrich (St. Louis, MO, USA). The RPMI 1640 medium and DMEM were from Hyclone (Logan, UT, USA). Fetal bovine serum was from Biological Industries (Kibbutz Beit-Haemek, Israel). Penicillin and streptomycin were from Beyotime (Shanghai, China). Trypsin and Annexin V-FITC cell apoptosis detection kit were from KeyGEN BioTECH (Nanjing, China). Cell Counting Kit-8 (CCK-8) was from Dojindo (Kumamoto, Japan). 3Methyladenine (3-MA), hydroxychloroquine sulfate (HCQ), MK-2206 (MK), SC79 (SC), SP600125 (SP), PD0325901 (PD) and SB203580 (SB) were from Selleck Chemical (Houston, TX, USA).

109

2.3. Cell growth assay The effect of QCT on cell growth was determined by using the CCK-8 assay. Cells were seeded in 96-well transparent plates at a density of 5×103 cells/well, allowed to adhere overnight and then treated with QCT at various concentrations for 24, 36 and 48 h. At the end of incubation, cells were incubated with CCK-8 reagent (10%, 100 μl/well) for 1 h at 37°C, and then the optical density values were determined at 450 nm in a multimode microplate reader (TECAN, Mannedorf, Switzerland). 2.4. Cell apoptosis analysis by flow cytometry The effect of QCT on cell apoptosis was determined by using the Annexin V-FITC/PI cell apoptosis detection kit according to the protocol we used previously [37]. 2.5. Gene silencing by siRNA Four siRNA sequences of each target gene were synthesized and structured into piLentisiRNA-GFP vectors by Applied Biological Materials (ABM) Inc. (Vancouver, Canada), and the most efficient siRNA sequence was identified by qPCR. Cells were transfected with the genespecific siRNA vector or the silencer negative control vector using DNAfectin Plus transfection reagent (ABM, Vancouver, Canada) according to manufacturer's protocol. After 48 h, the transfected cells were incubated with or without QCT to determine the functional role of the gene in QCT effect. The final siRNA sequences for AKT, JNK, ERK and p38MAPK were GCCAAGGAGATCATGCAGCATCGCTTCTT, CGCTACTTCCTCCTCAAGAATGATGGCAC, AGAGATCATGCTGAACTCCAAGGGCTGCTATA, and GAACATTGTTTCCTGGTACAGACCATATT, respectively. 2.6. Transmission electron microscopy (TEM) The effect of QCT on autophagy of SMMC7721 cells was evaluated by TEM. Cells were treated with QCT (0, 20, 40, 80 μM) for 24 h, collected and fixed at 4°C with 2.5% glutaraldehyde in 0.1 M phosphate buffer pH 7.4 for 2 h, washed three times in PBS, then incubated with 1% osmium tetroxide in the same buffer for 2 h at room temperature, washed three times in PBS and dehydrated with increasing concentrations of ethanol (50%–100%) and acetone (100%) followed by embedding in epoxy resin (Embed 812, Electron Microscopy Science, Perth, Australia). The ultrathin sections (60–80 nm) were cut and stained with 2% uranium acetate saturated alcohol solution and lead citrate. The samples were observed using Hitachi HT7700 TEM (Tokyo, Japan). 2.7. Tandem confocal microscopy SMMC7721 cells stably transfected with lentivirus expressing GFP-RFP-LC3 (GeneChem, Shanghai, China) were seeded in 96-well plates with 5×103 per well and were incubated with QCT at different concentrations (0, 20, 40, 80 μM) for 24 h. After being washed with PBS, the cells were observed using a confocal quantitative image cytometer (Yokogawa, Tokyo, Japan). Fifty cells in each group were randomly selected, and the numbers of yellow puncta (GFP + RFP+) and red puncta (GFP-RFP+) in each cell, which represented autophagosomes and autolysosomes, respectively, were counted to calculate the average number per cell. 2.8. Animal study and dosage information Male BALB/c nude mice (5–6 weeks of age, initial body weight 18.34±2.26 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed in a specific pathogen free environment. After 1 week of acclimation, each animal was injected subcutaneously with SMMC7721 cells (2×106 in 0.2 ml serumfree culture medium) into the right-side flank. After 7 days, tumor-bearing mice were randomly assigned into one of the following experimental groups (n=10/group): (1) control (vehicles), (2) QCT alone (60 mg/kg BW/day), (3) HCQ alone (60 mg/kg BW/ day) or (4) QCT and HCQ combination. HCQ, an autophagy inhibitor, was dissolved in 0.9% NaCl and administered intraperitoneally daily. QCT was dissolved in 0.5% CMC and administrated by oral gavage daily. The human equivalent dose of QCT is 4.87 mg/kg/d via translation method by Reagan-Shaw et al. [38]. This dose was selected based on previous in vivo studies [39,40], and it could be achieved through regular diets rich in vegetables and fruits or via supplements [41]. Tumor diameters were measured every 2 days, and tumor volume was calculated using the formula V = (length × width2) / 2. After 10 days of treatment, mice were sacrificed, and tumors were dissected, weighed and processed for further analysis. The animal study protocol was reviewed and approved by the Laboratory Animal Ethics Committee of Nanjing University of Chinese medicine (ACU171105).

2.2. Cell culture

2.9. Histology and immunohistochemistry (IHC)

The human hepatoma cell lines SMMC7721 and HepG2, and normal human liver cell line LO2 were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were grown in DMEM (HepG2) or RPMI1640 medium (SMMC7721 and LO2), supplemented with 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin in a humidified 37°C incubator containing 5% CO2. All human cell lines were authenticated by short tandem repeat analysis.

After fixation, tumor tissues were embedded in paraffin and sectioned into a 4-μm thickness. For histological examination, the sections were stained with hematoxylin and eosin (H&E). IHC assay was performed to determine the effect of treatment on protein levels of related molecular biomarkers (LC3A/B, p62 and cleaved caspase-3) in tumor tissues following the protocols established in our group [42] with appropriate modifications. The primary rabbit anti-human antibodies LC3A/B (1:500), p62 (1:2000)

110

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

and cleaved caspase-3 (1:500) were used. The goat anti-rabbit HRP-conjugated secondary antibody (1:200) was used. The images were captured by a light microscope (OLYMPUS CX41, Tokyo, Japan) and quantitatively analyzed by Image Pro Plus software. 2.10. Terminal deoxynucleotide transferase dUTP nick end labeling (TUNEL) assay The TUNEL assay was applied to determine the effect of treatment on cancer cell apoptosis in tumor samples following the protocol established in the group [42]. The apoptotic cells and total cells in five random fields from each sample were counted, and the apoptosis rate was calculated for statistical analysis. 2.11. Western blot analysis The protein levels in cells and tumor tissues were determined by Western blot analysis following the protocol previously described [42] with appropriate modifications. The primary rabbit monoclonal antibodies (Cell Signaling Technology, Danvers, MA, USA) and dilutions used were as follows: LC3A/B (1:1000), beclin1 (1:1000), p62 (1:1000), AKT (1:1000), p-AKT (Ser473, 1:2000), mTOR (1:1000), p-mTOR (Ser2448, 1:1000), p70S6K (1:1000), p-p70S6K (Thr389, 1:1000), 4EBP1 (1:1000), p-4EBP1 (Ser65, 1:1000), JNK (1:1000), p-JNK (Thr183/Tyr185, 1:1000), ERK (1:1000), p-ERK (Thr202/Tyr 204, 1:1000), p38MAPK (1:1000), p-p38MAPK (Thr180/Tyr182, 1:1000), Bax (1:1000), Bcl-2 (1:1000), cleaved caspase-3 (Asp175, 1:1000), GAPDH (1:1000) and β-actin (1:1000). The goat anti-rabbit HRP-conjugated secondary antibody (1:10,000, Proteintech) was used. The protein bands were visualized by ECL chemiluminescent reagent under ChemiDoc MP Imager (Bio-Rad, Hercules, CA, USA). The density of each protein band was quantitated by Image Lab software. 2.12. Statistical analysis Data were expressed as group means±standard deviation (S.D.) and analyzed by analysis of variance followed by Tukey's honestly significant difference among experimental groups by using GraphPad Prism 5 software (San Diego, CA, USA). A P value of b.05 was considered statistically significant.

3. Results 3.1. Effects of QCT on the growth of HCC cells and normal hepatocytes We first determined the effects of QCT on the growth of two types of HCC cell lines (SMMC7721 and HepG2) and normal hepatocyte LO2 cell line. QCT significantly decreased the viability of SMMC7721 and HepG2

cells in dose-dependent and time-dependent manners (Fig. 1A and B). SMMC7721 cell line was more sensitive than HepG2 to QCT treatment, with the IC50’s at 21.0 and 34.0 μM, respectively, after 48 h of treatment. On the other hand, QCT had minimal effect on the viability of normal hepatocyte LO2 cells (Fig. 1C). These results indicate that QCT had a potent effect on inhibiting HCC cells but limited cytotoxicity to normal cells. Since SMMC7721 cell line was more sensitive to QCT, it was used in the subsequent in vitro and in vivo experiments. 3.2. Effects of QCT on induction of autophagy and autophagic flux in HCC cells TEM was initially used to determine autophagic changes in HCC cells after QCT treatment. The results showed that autophagosomes with double-layered membranes or the autolysosomes that contained cytoplasmic organelles or myelin figures in SMMC7721 cells were increased significantly after QCT treatment in a dose-dependent manner (Fig. 2A). To further confirm the effect of QCT on autophagy induction, we determined the protein levels of autophagy-related (ATG) molecular biomarker LC3. LC3 is expressed as three isoforms in human cells, LC3A, LC3B and LC3C, but the LC3C is generally considered to be poorly or not expressed in most cells [43]. Therefore, we used the LC3 antibodies that detected both LC3A and LC3B isoforms in this study. Western blot analysis showed that QCT significantly up-regulated the protein levels of LC3A/B-II and beclin1 in dose- and time-dependent manners (Fig. 2B and C). The protein quantitative results were shown in the supplemental Fig. S2 (A and C). Meanwhile, QCT significantly down-regulated p62 protein level dose- and time-dependently (Fig. 2B and C; Fig. S2B and D). These results supported that QCT induced autophagy in SMMC7721 cells. Autophagy is a dynamic and multistep process. The up-regulation of LC3A/B-II results from the activation of autophagy or the accumulation of autophagosome caused by late autophagy inhibition. To distinguish autophagy induction from autophagy inhibition, we stably transfected lentivirus encoding the GFP-RFP-LC3 fusion gene into SMMC7721 cells and used confocal microscopy to observe autophagosomes and autolysosomes. The yellow puncta (both GFP

Fig. 1. Dose- and time-dependent effects of QCT on the growth of HCC cells and normal hepatocytes. Cell viability of SMMC7721 cells (A), HepG2 cells (B) and LO2 cells (C) was measured by using the CCK-8 assay. Values are expressed as means±S.D. of three independent experiments in triplicate. Within each panel, the value with a symbol is significantly different from that of the control: *Pb.05; **Pb.01; ***Pb.001.

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119 Fig. 2. Effects of QCT on stimulation of autophagy in SMMC7721 cells. (A) Cells were treated with QCT at different concentrations for 24 h, and autophagosomes or autolysosomes (shown by arrows) were observed using TEM. (B, C) Cells were treated with different concentrations of QCT for 24 h (B) or with 40 μM of QCT for different times (C), and the protein levels of LC3A/B, beclin1 and p62 were measured by Western blot. (D) Cells were pretreated with HCQ (20 μM) for 2 h and then co-incubated with QCT (40 μM) for another 24 h, and the protein levels of LC3A/B, beclin1 and p62 were detected by Western blot. (E, F) Cells transfected with GFP-RFP-LC3-expressing lentivirus were treated with QCT at different concentrations for 24 h, and autophagy was observed by confocal microscopy and quantified by puncta, with the yellow puncta being autophagosomes and the red puncta being autophagolysosomes. (G, H) GFP-RFP-LC3-expressing lentivirus transfected cells were treated with QCT (40 μM), HCQ (20 μM) or the combination of QCT and HCQ for 24 h, and autophagy was observed by confocal microscopy and quantified by puncta. Values are expressed as means±S.D. of three independent experiments. Within each panel (F, H), the value with a symbol “*” is significantly different from that of the control: *Pb.05; **Pb.01; ***Pb.001. And the value with a symbol “#” is significantly different from that of the QCT group: #Pb.05; ##Pb.01; ###Pb.001. Densitometry analysis results of the protein levels in panels B, C and D are presented in the Fig. S2A and B, C and D, and E and F, respectively.

111

112 Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119 Fig. 3. Effects of QCT on autophagy stimulation in SMMC7721 cells via regulation of AKT/mTOR signaling pathway and MAPK signaling pathways. (A) The effects of QCT on the levels of total and phosphorylated AKT, mTOR, p70S6K and 4EBP1 proteins were detected by Western blot. (B, D) Cells pretreated with MK (3 μM) or SC (10 μM) for 2 h were co-treated with QCT (40 μM) for another 24 h, and the p-AKT and LC3A/B protein expression levels were measured by Western blot. (C) Cells transfected with AKT siRNA (si-AKT) or control siRNA (si-CON) for 48 h were treated with QCT (40 μM) for another 24 h, and the levels of p-AKT and LC3A/B proteins were measured by Western blot. (E) Cells were treated with QCT at different concentrations for 24 h, and the total and phosphorylated protein levels of JNK, ERK and p38MAPK were detected by Western blot. (F–H) Cells pretreated with SP (10 μM), PD (1 μM) or SB (10 μM) for 2 h were co-incubated with QCT (40 μM) for another 24 h, and the levels of LC3A/B, p-JNK, p-ERK or p-p38MAPK proteins were detected by Western blot. (I–K) Cells were transfected with siRNAs against JNK (si-JNK), ERK (si-ERK) or p38MAPK (si-p38MAPK), or their corresponding controls (si-CON) for 48 h and then treated with QCT (40 μM) for another 24 h. Levels of LC3A/B and p-JNK or p-ERK or p-p38MAPK proteins were measured by Western blot. Independent experiments were repeated three times. Densitometry analysis results of the protein levels are presented in Fig. S3.

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119 Fig. 4. Effects of QCT-induced autophagy on the growth and apoptosis of SMMC7721 cells in vitro. (A) Cells pretreated with HCQ (20 μM) for 2 h were co-incubated with QCT (40 μM) for another 24 h, and the cell viability was measured by the CCK-8 assay. (B, C) Cells were treated with HCQ and QCT as described in panel A, and the apoptosis was detected by flow cytometry. (B) The proportions of apoptotic cells in different experimental groups and (C) the representative cell distributions in different experimental groups. (D–F) Cells were treated with HCQ and QCT as described in panel A, and the expression levels of bax, bcl-2 and cleaved caspase-3 were detected by Western blot (D) and quantified by densitometry (E, F). The results are expressed as means±S.D. of three independent experiments. Within each panel, the value with a symbol “*” is significantly different from that of the control: *Pb.05; **Pb.01; ***Pb.001. And the value with a symbol “#” is significantly different from that of the QCT group: #Pb.05; ##Pb.01; ###Pb.001. 113

114

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

and RFP positive, G+R+) in cells represent autophagosomes, while the red puncta (only RFP positive, G−R+) in cells represent autolysosomes. QCT treatment significantly increased the numbers of both yellow puncta and red puncta cells in a dose-dependent manner (Fig. 2E and F). These results further supported that QCT could induce autophagy in SMMC7721 cells. To further verify that QCT stimulated autophagic flux in SMMC7721 cells, cells were co-treated with QCT and autophagy inhibitors. HCQ is a lysosomotropic agent that blocks the fusion of autophagosomes with lysosomes by inhibiting lysosomal enzymes and causing accumulation of LC3A/B-II. After co-incubation with QCT and HCQ for 24 h, LC3A/B-II accumulation was further increased (Fig. 2D and S2E). Furthermore, HCQ significantly reversed QCT-up-regulated beclin1 protein level and QCTdown-regulated p62 protein level (Fig. 2D, Fig. S2E and F). Another autophagy inhibitor, 3-methyladenine (3-MA), a class III phosphatidylinositol 3-kinase inhibitor that inhibits autophagy at the initial stage to decrease the production of LC3A/B-II, was further used. Cotreatment with QCT and 3-MA decreased QCT-induced LC3A/B-II formation in SMMC7721 cells (Fig. S2G and H). The results of confocal microscopy analysis showed that HCQ further enhanced the number of QCT-increased yellow puncta and decreased the number of QCT-increased red puncta (Fig. 2G and H), while 3-MA reduced the number of both QCT-increased yellow puncta and red puncta (Fig. S2I and J). These data indicated that HCQ caused accumulation of autophagosomes and reduced the formation of autolysosomes, whereas 3-MA abolished QCT-induced autophagosome formation. All of these findings provided evidence to strongly confirm that QCT could induce autophagic flux in SSMC7721 cells. Additionally, we detected the LC3A/B, beclin1 and p62 protein levels in HepG2 cells treated with QCT. Results (Fig. S4A–C) showed that QCT significantly up-regulated the protein levels of LC3A/B-II and beclin1 in dose-dependent manners, while it down-regulated p62 protein level. To further verify that QCT stimulated autophagy and autophagic flux in HepG2 cells, cells were co-treated with QCT and HCQ. After co-incubation with QCT and HCQ for 24 h, LC3A/B-II accumulation was further increased (Fig. S4D and E). Furthermore, HCQ significantly reversed QCT-up-regulated beclin1 protein level and QCT-down-regulated p62 protein level (Fig. S4D–F). The above results from different types of HCC cells supported that QCT could activate autophagy and autophagic flux in HCC cells. 3.3. Effects of QCT on autophagy induction by inhibiting the AKT/mTOR signaling pathway The effects of QCT on the expression of the AKT/mTOR signaling pathway related proteins were first measured by Western blot analysis. QCT significantly reduced the protein levels of phosphorylated AKT, mTOR, p70S6K and 4EBP1 in a dose-dependent manner but had no effects on their total protein levels (Fig. 3A and Fig. S3A). To further clarify if the AKT/mTOR signaling pathway is a functional target for QCT, AKT was inhibited by its inhibitors (MK or siRNA) and activated by its activator (SC). Both MK and siRNA showed similar effects to those of QCT treatment on down-regulating p-AKT and up-regulating LC3A/B-II protein levels (Fig. 3B and C, Fig. S3B and C), and the combination of QCT with MK or siRNA further enhanced the LC3A/B-II levels (Fig. 3B and C, Fig. S3B and C). On the other hand, the AKT activation with SC could reduce the QCT-induced LC3A/B-II expression (Fig. 3D and Fig. S3D). The results clearly supported that QCT induced autophagy in SMMC7721 cells in part by inhibiting the AKT/mTOR signaling pathway. 3.4. Effects of QCT on autophagy induction by activating the MAPK signaling pathways We further detected the expression levels of the MAPK signaling pathway-related target proteins JNK, ERK1/2 and p38MAPK. As shown

in Fig. 3E and Fig. S3E, QCT treatment increased the protein levels of phosphorylated JNK, ERK1/2 and p38MAPK in a dose-dependent manner, whereas it did not significantly alter the total levels of these proteins. To further evaluate if and which MAPK signaling pathways were functionally related to the QCT-induced autophagy, selective inhibitors for each of these pathways, SP (JNK inhibitor), PD (ERK1/2 inhibitor) or SB (p38MAPK inhibitor), were used. The results showed that the combination treatment of QCT and the inhibitors (SP, PD and SB) significantly reduced the protein levels of LC3A/B-II compared with the QCT treatment alone (Fig. 3F and Fig. S3F, Fig. 3G and Fig. S3G, Fig. 3H and Fig. S3H). Similarly, in the experiments using siRNAs to knockdown the JNK, ERK1/2 and p38MAPK genes, we found that the QCT-induced protein levels of LC3A/B-II were reduced by siRNAs of MAPKs (Fig. 3I and Fig. S3I, Fig. 3J and Fig. S3J, Fig. 3K and Fig. S3K). In summary, these results demonstrated that QCT induced autophagy in SMMC7721 cells through activating JNK-, ERK1/2- and p38MAPKrelated MAPK pathways. 3.5. Induction of cancer cell apoptosis by QCT via autophagy stimulation in vitro To further explore the relationship between QCT induced-autophagy and its antitumor activity, the SMMC7721 cells and HepG2 cells were treated with QCT, HCQ or the combination of QCT and HCQ. QCT significantly inhibited the SMMC7721 cell growth (Fig. 4A) and induced cell apoptosis (Fig. 4B and C) associated with up-regulating bax and cleaved caspase-3 protein levels (Fig. 4D and E) and down-regulating bcl-2 (Fig. 4D and F) protein level. Autophagy inhibitor HCQ alone did not significantly alter SMMC7721 cell growth (Fig. 4A) and slightly but significantly inhibited apoptosis (Fig. 4B) without significant alteration of protein levels of apoptosis-related biomarkers (Fig. 4D–F). On the other hand, autophagy inhibition by HCQ significantly reduced QCT activities in inhibiting SMMC7721 cell growth (Fig. 4A), inducing cell apoptosis (Fig. 4B) and regulating protein levels of apoptosis-related biomarkers (Fig. 4D–F). Similar results were obtained by using another autophagy inhibitor 3-MA (data not shown). Similarly, we found that autophagy inhibition by HCQ significantly reduced QCT activities in inhibiting HepG2 cell growth (Fig. S5A). QCT significantly induced HepG2 cell apoptosis (Fig. S5B) associated with up-regulating bax and cleaved caspase-3 protein levels (Fig. S5C and D) and down-regulating bcl-2 (Fig. S5C and E) protein level. Autophagy inhibition by HCQ significantly reduced QCT activities in inducing cell apoptosis (Fig. S5B) and regulating protein levels of apoptosis-related biomarkers (Fig. S5C–F). However, autophagy inhibitor HCQ alone did not significantly alter cell growth (Fig. S5A) and cell apoptosis (Fig. S5B–E). Again, these results supported that QCT inhibited the growth and induced apoptosis of HCC cells at least in part via induction of cancer cell autophagy. 3.6. Growth inhibition of SMMC7721 tumors by QCT via autophagy stimulation in vivo The HCC xenograft mouse model was applied to verify if QCT inhibited the tumor growth in part via autophagy stimulation in vivo. QCT inhibited tumor growth time-dependently and significantly reduced final tumor weight by 53.95% (Pb.001) (Fig. 5A and B). HCQ alone did not alter tumor growth or final tumor weight (Fig. 5A and B). However, HCQ reduced inhibitory effect of QCT on tumor growth in a time-dependent manner (Fig. 5A); the final tumor weight in the HCQ and QCT combination group was 48.82% higher than that in the QCT alone group (Pb.05, Fig. 5B). Treatments did not significantly alter body weight, confirming that QCT had minimal adverse effect on mice (Fig. 5C).

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119 Fig. 5. Effects of QCT-stimulated autophagy on the growth of SMMC7721 tumors in vivo. The tumor-bearing mice were treated with the control, QCT (60 mg/kg BW), HCQ (60 mg/kg BW) and the combination of QCT and HCQ. The figures show the treatment effects on the time-dependent tumor volume changes (A), the final tumor weights (B) and the body weight changes (C). The treatment effects on autophagy were evaluated by IHC staining (D) and imaging quantitation of LC3A/B (E) and p62 (F) proteins on tumor tissue sections. The results are expressed as means±S.D. Within each panel, the value with a symbol “*” is significantly different from that of the control: *Pb.05; **Pb.01; ***Pb.001. And the value with a symbol “#” is significantly different from that of the QCT group: #Pb.05; ##Pb.01; ###Pb.001.

115

116 Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119 Fig. 6. Effects of QCT-stimulated autophagy on induction of apoptosis of SMMC7721 tumors in vivo. (A) The pictures of H&E staining, TUNEL and IHC staining for cleaved caspase-3 on tumor tissue sections. (B) The percentage of the necrotic area in the H&E staining images. (C) The percentage of apoptosis rate by quantifying TUNEL assay. (D) The quantitative analysis of IHC staining of cleaved caspase-3. (E–G) The representative images of Western blot analysis of bax, bcl-2 and cleaved caspase-3 proteins (E) and the densitometry analysis results of bax and cleaved caspase-3 (F) and bcl-2 (G). All the results are expressed as means±S.D. Within each panel, the value with a symbol “*” is significantly different from that of the control: *Pb.05; **Pb.01; ***Pb.001. And the value with a symbol “#” is significantly different from that of the QCT group: #Pb.05; ##Pb.01; ###Pb.001.

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

The protein levels of LC3A/B and p62 in tumor tissues were quantified by immunohistochemistry. The results (Fig. 5D–F) showed that QCT treatment significantly increased LC3A/B protein level (Pb.001) and decreased p62 protein level (Pb.001) in tumors compared with the control. HCQ treatment alone did not significantly alter LC3A/B or p62 protein level, but its combination with QCT further enhanced the LC3A/B-up-regulating effect of QCT and reduced the p62-down-regulating effect of QCT. These results demonstrated that QCT could induce autophagy in the SMMC7721 tumors in vivo. 3.7. Apoptosis induction by QCT via autophagy stimulation in vivo All tumor tissue sections were subjected to histopathological evaluation. H&E staining showed that QCT treatment significantly increased necrosis in the tumors (Fig. 6A and B). Although HCQ treatment alone did not significantly alter necrosis, its combination with QCT significantly alleviated the necrosis-increasing effect of QCT by 59.85% (Pb.001, Fig. 6A and B). TUNEL assay was applied to determine apoptosis in tumor tissues. The results showed that QCT significantly induced apoptosis by 127.36% (Pb.001) compared with the control (Fig. 6A and C). HCQ did not alter apoptosis, but it significantly reduced the apoptosis-inducing activity of QCT by 31.21% (Pb.001, Fig. 6A and C). Likewise, the IHC analysis of cleaved caspase-3 reconfirmed that the blockage of autophagy inhibited apoptosis, as reflected by reduced cleaved caspase-3 protein levels (Fig. 6A and D). We also assessed the protein levels of apoptosis-related biomarkers bax, bcl-2 and cleaved caspase3 by Western blot. QCT up-regulated the expression of bax and cleaved caspase-3 proteins and down-regulated the expression of bcl-2 protein in tumor tissue sections. And these effects were partially, but significantly, reversed by HCQ (Fig. 6E–G). 4. Discussion In this report, a series of in vitro and in vivo studies was performed to determine the effect of QCT on the growth inhibition of HCC cells and to elucidate if induction of autophagy could serve as an important mechanism of QCT action. The results of the in vitro studies showed that QCT inhibited the growth of cancer cells associated with induction of apoptosis and stimulation of autophagy. Function assays demonstrated that QCT could stimulate autophagy at least in part by inhibiting the AKT/mTOR signaling pathway and activating the MAPK pathways. Furthermore, the apoptosis-inducing activity of QCT was regulated by autophagy, indicating that autophagy stimulation by QCT could be an important mechanism of apoptosis induction. The in vivo animal studies showed that QCT could significantly inhibit tumor growth associated with apoptosis induction and autophagy stimulation and that inhibition of autophagy could significantly alleviate the QCT effect on tumor growth inhibition and apoptosis induction. These results provide strong experimental evidence to support that autophagy stimulation may be an important mechanism by which QCT induces cancer cell apoptosis. To the best of our knowledge, this is the first in vivo report to demonstrate that QCT inhibits HCC tumor growth, at least in part, via stimulation of autophagy and apoptosis induction. Both autophagy and apoptosis are biological processes that play an important role in cell development, homeostasis and multiple diseases. The relationship between autophagy and apoptosis in oncology is complicated. On the one hand, autophagy was considered to have the function that helps cells to overcome integrated stress, and it could inhibit apoptosis [44]. On the other hand, accumulating evidence supports that autophagy as a type II programmed cell death mechanism could promote apoptosis [45]. Indeed, autophagy has become a very attractive target for cancer therapeutics, and many existing drugs designed to kill cancer cells also induce autophagy [46].

117

Moreover, some studies found a cross talk between autophagy and apoptosis, and they could cooperate, assist or antagonize each other to affect various biological activities of cells [47]. Previous research has generally indicated that QCT inhibits the growth of several types of cancers, including liver cancer, associated with induction of autophagy [14,32–36]. However, it is largely unknown if induction of autophagy is functionally responsible for the mechanism of anticancer activity of QCT. Especially, the in vivo evidence has been very limited, if any. In a series of in vitro and in vivo studies, we showed that QCT could activate autophagy and induce apoptosis, and inhibition of autophagy significantly alleviated the apoptosis-inducing activity of QCT. These results clearly support that stimulation of autophagy is functionally responsible for the anticancer and apoptosis-inducing activities of QCT against HCC. The results of our study also showed that QCT induced autophagy, at least in part, via inhibiting the AKT/mTOR pathway and activating the MAPK pathways. The AKT/mTOR signaling pathway is the classic and vital negative regulation pathway of autophagy, highlighted by emerging evidence [48,49]. The MAPK signaling pathways are involved in the development and progression of cancer by regulating cell growth, division, proliferation, apoptosis and autophagy [50,51]. Conventional MAPKs contain three major members in mammalian cells: JNK, ERK1/2 and p38MAPK. The JNK pathway is the significantly positive regulatory pathway of autophagy [52]. But the ERK1/2 and p38 PAPK signaling pathways have a dual role in autophagy, both as a positive and as a negative regulator of autophagy [52–55]. In the in vitro functional assays using the pathway-specific inhibitors (chemical inhibitors and RNA interference) or chemical activators, our results showed that QCT stimulated autophagy by inhibiting the AKT/mTOR pathway and activating the MAPK pathways. These results provided supporting evidence to suggest that inhibiting the AKT/mTOR pathway and activating the MAPK pathways represent the mechanisms by which QCT induces autophagy. Although QCT has shown diverse pharmacological activities, it usually has low and variable bioavailability, which has limited its pharmacological application [56,57]. Several strategies, such as prodrugs [58], nanocrystals [59], polymeric micelles [60] and microemulsions [61], have been applied to improve its bioavailability and in vivo efficacy. In our studies, oral administration of the pure form of QCT at 60 mg/kg BW significantly inhibited the growth of SMMC7721 HCC tumors in vivo. It is expected that the more bioavailable form(s) of QCT may have even more potent activities in inhibiting the growth of SMMC7721 tumors. In conclusion, our in vitro and in vivo studies provided compelling evidence to support that activation of autophagy by inhibiting the AKT/mTOR pathway and activating the MAPK signaling pathways may represent an important mechanism of QCT action in inhibiting the growth and inducing apoptosis of HCC. Since QCT is a commonly available dietary bioactive component and has minimal adverse effect, our results, together with those from other investigators, may warrant further preclinical and human studies to develop QCT as a candidate agent for effective and safe intervention of HCC. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.jnutbio.2019.03.018.

Author contributions Yi Ji and Li Li conceived and designed the study; Li Li contributed materials; Yi Ji, Yan-Xia Ma and Wen-Ting Li performed the in vitro experiments; Yi Ji, Li Liu and Heng-Zhou Zhu performed the in vivo experiments; Yi Ji analyzed the data and wrote the paper; Mian-Hua Wu and Jin-Rong Zhou provided supervision to the entire project. All authors were involved in revising the paper and approved the final manuscript.

118

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

Acknowledgment We thank Dr. Ze-Qun Jiang for experimental help and critical reading of the manuscript. Funding This work was supported by the National Natural Science Foundation of China (81503535, 81774266), Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX18_1552) and Jiangsu Collaborative Innovation Center of Traditional Chinese Medicine (TCM) Prevention and Treatment of Cancer. Conflict of interest statement All the authors declare that they have no conflict of interest. References [1] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394–424. [2] Sastre J, Diaz-Beveridge R, Garcia-Foncillas J, Guardeno R, Lopez C, Pazo R, et al. Clinical guideline SEOM: hepatocellular carcinoma. Clinical & translational oncology: official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 17; 2015; 988–95. [3] Boots AW, Haenen GR, Bast A. Health effects of quercetin: from antioxidant to nutraceutical. Eur J Pharmacol 2008;585:325–37. [4] Zhuang M, Qiu H, Li P, Hu L, Wang Y, Rao L. Islet protection and amelioration of type 2 diabetes mellitus by treatment with quercetin from the flowers of Edgeworthia gardneri. Drug Des Devel Ther 2018;12:955–66. [5] Moon JH, Nakata R, Oshima S, Inakuma T, Terao J. Accumulation of quercetin conjugates in blood plasma after the short-term ingestion of onion by women. Am J Physiol Regul Integr Comp Physiol 2000;279:R461–7. [6] Kawabata K, Mukai R, Ishisaka A. Quercetin and related polyphenols: new insights and implications for their bioactivity and bioavailability. Food Funct 2015;6:1399–417. [7] Terao J. Factors modulating bioavailability of quercetin-related flavonoids and the consequences of their vascular function. Biochem Pharmacol 2017;139:15–23. [8] Oboh G, Ademosun AO, Ogunsuyi OB. Quercetin and its role in chronic diseases. Adv Exp Med Biol 2016;929:377–87. [9] Eid HM, Haddad PS. The antidiabetic potential of quercetin: underlying mechanisms. Curr Med Chem 2017;24:355–64. [10] Barreca D, Bellocco E, D'Onofrio G, Nabavi SF, Daglia M, Rastrelli L, et al. Neuroprotective effects of quercetin: from chemistry to medicine. CNS Neurol Disord Drug Targets 2016;15:964–75. [11] Chang JH, Lai SL, Chen WS, Hung WY, Chow JM, Hsiao M, et al. Quercetin suppresses the metastatic ability of lung cancer through inhibiting Snaildependent Akt activation and Snail-independent ADAM9 expression pathways. Biochim Biophys Acta Mol Cell Res 2017;1864:1746–58. [12] Rivera Rivera A, Castillo-Pichardo L, Gerena Y, Dharmawardhane S. Anti-breast cancer potential of quercetin via the Akt/AMPK/mammalian target of rapamycin (mTOR) signaling cascade. PLoS One 2016;11:e0157251. [13] Maso V, Calgarotto AK, Franchi Jr GC, Nowill AE, Filho PL, Vassallo J, et al. Multitarget effects of quercetin in leukemia. Cancer Prev Res (Phila) 2014;7: 1240–50. [14] Psahoulia FH, Moumtzi S, Roberts ML, Sasazuki T, Shirasawa S, Pintzas A. Quercetin mediates preferential degradation of oncogenic Ras and causes autophagy in Ha-RAS-transformed human colon cells. Carcinogenesis 2007;28: 1021–31. [15] Lee JH, Lee HB, Jung GO, Oh JT, Park DE, Chae KM. Effect of quercetin on apoptosis of PANC-1 cells. J Korean Surg Soc 2013;85:249–60. [16] Russo M, Spagnuolo C, Tedesco I, Bilotto S, Russo GL. The flavonoid quercetin in disease prevention and therapy: facts and fancies. Biochem Pharmacol 2012;83: 6–15. [17] Tanigawa S, Fujii M, Hou DX. Stabilization of p53 is involved in quercetin-induced cell cycle arrest and apoptosis in HepG2 cells. Biosci Biotechnol Biochem 2008;72: 797–804. [18] Seufi AM, Ibrahim SS, Elmaghraby TK, Hafez EE. Preventive effect of the flavonoid, quercetin, on hepatic cancer in rats via oxidant/antioxidant activity: molecular and histological evidences. J Exp Clin Cancer Res 2009;28:80. [19] Zhou J, Fang L, Liao J, Li L, Yao W, Xiong Z, et al. Investigation of the anti-cancer effect of quercetin on HepG2 cells in vivo. PLoS One 2017;12:e0172838. [20] Brito AF, Ribeiro M, Abrantes AM, Mamede AC, Laranjo M, Casalta-Lopes JE, et al. New approach for treatment of primary liver tumors: the role of quercetin. Nutr Cancer 2016;68:250–66. [21] Casella ML, Parody JP, Ceballos MP, Quiroga AD, Ronco MT, Frances DE, et al. Quercetin prevents liver carcinogenesis by inducing cell cycle arrest, decreasing cell proliferation and enhancing apoptosis. Mol Nutr Food Res 2014;58:289–300.

[22] Levine B, Yuan J. Autophagy in cell death: an innocent convict? J Clin Invest 2005; 115:2679–88. [23] Levine B. Cell biology: autophagy and cancer. Nature 2007;446:745–7. [24] Yang Z, Klionsky DJ. An overview of the molecular mechanism of autophagy. Curr Top Microbiol Immunol 2009;335:1–32. [25] Chen S, Jiang YZ, Huang L, Zhou RJ, Yu KD, Liu Y, et al. The residual tumor autophagy marker LC3B serves as a prognostic marker in local advanced breast cancer after neoadjuvant chemotherapy. Clin Cancer Res 2013;19:6853–62. [26] Zeng X, Overmeyer JH, Maltese WA. Functional specificity of the mammalian Beclin-Vps34 PI 3-kinase complex in macroautophagy versus endocytosis and lysosomal enzyme trafficking. J Cell Sci 2006;119:259–70. [27] Johansen T, Lamark T. Selective autophagy mediated by autophagic adapter proteins. Autophagy 2011;7:279–96. [28] Miao Q, Bi LL, Li X, Miao S, Zhang J, Zhang S, et al. Anticancer effects of bufalin on human hepatocellular carcinoma HepG2 cells: roles of apoptosis and autophagy. Int J Mol Sci 2013;14:1370–82. [29] Choi KS. Autophagy and cancer. Exp Mol Med 2012;44:109–20. [30] Mah LY, Ryan KM. Autophagy and cancer. Cold Spring Harb Perspect Biol 2012;4: a008821. [31] Levy JMM, Towers CG, Thorburn A. Targeting autophagy in cancer. Nat Rev Cancer 2017;17:528–42. [32] Klappan AK, Hones S, Mylonas I, Bruning A. Proteasome inhibition by quercetin triggers macroautophagy and blocks mTOR activity. Histochem Cell Biol 2012; 137:25–36. [33] Jia L, Huang S, Yin X, Zan Y, Guo Y, Han L. Quercetin suppresses the mobility of breast cancer by suppressing glycolysis through Akt-mTOR pathway mediated autophagy induction. Life Sci 2018;208:123–30. [34] Calgarotto AK, Maso V, Junior GCF, Nowill AE, Filho PL, Vassallo J, et al. Antitumor activities of quercetin and green tea in xenografts of human leukemia HL60 cells. Sci Rep 2018;8:3459. [35] Moon JH, Eo SK, Lee JH, Park SY. Quercetin-induced autophagy flux enhances TRAIL-mediated tumor cell death. Oncol Rep 2015;34:375–81. [36] Tomas-Hernandez S, Blanco J, Rojas C, Roca-Martinez J, Ojeda-Montes MJ, BeltranDebon R, et al. Resveratrol potently counteracts quercetin starvation-induced autophagy and sensitizes HepG2 cancer cells to apoptosis. Mol Nutr Food Res 2018;62. [37] Gong Y, Li Y, Lu Y, Li L, Abdolmaleky HM, Blackburn GL, et al. Bioactive tanshinones in Salvia miltiorrhiza inhibit the growth of prostate cancer cells in vitro and in mice. Int J Cancer 2011;129:1042–52. [38] Reagan-Shaw S, Nihal M, Ahmad N. Dose translation from animal to human studies revisited. FASEB J 2008;22:659–61. [39] Wang DM, Li SQ, Wu WL, Zhu XY, Wang Y, Yuan HY. Effects of long-term treatment with quercetin on cognition and mitochondrial function in a mouse model of Alzheimer's disease. Neurochem Res 2014;39:1533–43. [40] Yang F, Jiang X, Song L, Wang H, Mei Z, Xu Z, et al. Quercetin inhibits angiogenesis through thrombospondin-1 upregulation to antagonize human prostate cancer PC-3 cell growth in vitro and in vivo. Oncol Rep 2016;35:1602–10. [41] Formica JV, Regelson W. Review of the biology of quercetin and related bioflavonoids. Food Chem Toxicol 1995;33:1061–80. [42] Zhou J-R, Yu L, Mai Z, Blackburn GL. Combined inhibition of estrogen-dependent human breast carcinoma by soy and tea bioactive components in mice. Int J Cancer 2004;108:8–14. [43] Koukourakis MI, Kalamida D, Giatromanolaki A, Zois CE, Sivridis E, Pouliliou S, et al. Autophagosome proteins LC3A, LC3B and LC3C have distinct subcellular distribution kinetics and expression in cancer cell lines. PLoS One 2015;10: e0137675. [44] Kroemer G, Marino G, Levine B. Autophagy and the integrated stress response. Mol Cell 2010;40:280–93. [45] Sooro MA, Zhang N, Zhang P. Targeting EGFR-mediated autophagy as a potential strategy for cancer therapy. Int J Cancer 2018;143:2116–25. [46] Kondo Y, Kanzawa T, Sawaya R, Kondo S. The role of autophagy in cancer development and response to therapy. Nat Rev Cancer 2005;5:726–34. [47] Nikoletopoulou V, Markaki M, Palikaras K, Tavernarakis N. Crosstalk between apoptosis, necrosis and autophagy. Biochim Biophys Acta 2013;1833:3448–59. [48] Yang Z, Klionsky DJ. Mammalian autophagy: core molecular machinery and signaling regulation. Curr Opin Cell Biol 2010;22:124–31. [49] Zhou X, Yue GG, Chan AM, Tsui SK, Fung KP, Sun H, et al. Eriocalyxin B, a novel autophagy inducer, exerts anti-tumor activity through the suppression of Akt/mTOR/ p70S6K signaling pathway in breast cancer. Biochem Pharmacol 2017;142:58–70. [50] Khavari TA, Rinn J. Ras/Erk MAPK signaling in epidermal homeostasis and neoplasia. Cell Cycle 2007;6:2928–31. [51] Kim KY, Park KI, Kim SH, Yu SN, Park SG, Kim YW, et al. Inhibition of autophagy promotes salinomycin-induced apoptosis via reactive oxygen species-mediated PI3K/AKT/mTOR and ERK/p38 MAPK-dependent signaling in human prostate cancer cells. Int J Mol Sci 2017;18. [52] Sui X, Kong N, Ye L, Han W, Zhou J, Zhang Q, et al. p38 and JNK MAPK pathways control the balance of apoptosis and autophagy in response to chemotherapeutic agents. Cancer Lett 2014;344:174–9. [53] Luo T, Zhang H, Yu Q, Liu G, Long M, Zhang K, et al. ERK1/2 MAPK promotes autophagy to suppress ER stress-mediated apoptosis induced by cadmium in rat proximal tubular cells. Toxicol In Vitro 2018;52:60–9. [54] Cagnol S, Chambard JC. ERK and cell death: mechanisms of ERK-induced cell death —apoptosis, autophagy and senescence. FEBS J 2010;277:2–21. [55] Webber JL. Regulation of autophagy by p38alpha MAPK. Autophagy 2010;6: 292–3.

Y. Ji et al. / Journal of Nutritional Biochemistry 69 (2019) 108–119

[56] Guo Y, Bruno RS. Endogenous and exogenous mediators of quercetin bioavailability. J Nutr Biochem 2015;26:201–10. [57] Sudan S, Rupasinghe HV. Antiproliferative activity of long chain acylated esters of quercetin-3-O-glucoside in hepatocellular carcinoma HepG2 cells. Exp Biol Med (Maywood) 2015;240:1452–64. [58] Puoci F, Morelli C, Cirillo G, Curcio M, Parisi OI, Maris P, et al. Anticancer activity of a quercetin-based polymer towards HeLa cancer cells. Anticancer Res 2012;32: 2843–7.

119

[59] Sun M, Gao Y, Pei Y, Guo C, Li H, Cao F, et al. Development of nanosuspension formulation for oral delivery of quercetin. J Biomed Nanotechnol 2010;6:325–32. [60] Wang BL, Gao X, Men K, Qiu J, Yang B, Gou ML, et al. Treating acute cystitis with biodegradable micelle-encapsulated quercetin. Int J Nanomedicine 2012;7: 2239–47. [61] Gao Y, Wang Y, Ma Y, Yu A, Cai F, Shao W, et al. Formulation optimization and in situ absorption in rat intestinal tract of quercetin-loaded microemulsion. Colloids Surf B Biointerfaces 2009;71:306–14.