- Email: [email protected]
Quick method for grouper species identification using real-time PCR
Food Control 27 (2012) 108e112
Contents lists available at SciVerse ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Quick method for grouper species identification using real-time PCR Shuangya Chen a, *, Jin Zhang b, Weiling Chen a, Yongxiang Zhang a, Jiahe Wang a, Dunming Xu a, Yu Zhou a a b
Xiamen Entry-Exit Inspection and Quarantine Technology Center, No. 2165, Jiangang Road, Haicang District, Xiamen, Fujian 361026, China Agilent Technologies Co. Ltd., Beijing 100102, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 January 2012 Received in revised form 13 March 2012 Accepted 14 March 2012
A convenient and quick method based on real-time polymerase chain reaction (PCR) was established to identify 10 grouper species in China. According to the sequence of mitochondrial cytochrome oxidase subunit I (COI) gene, primers and probe were designed. PCR amplifications of 129 bp of COI gene sequences from 10 grouper species of four genera (Epinephelus, Promicrops, Plectropomus and Cromileptes) were compared with that of 30 other fish species. PCR amplifications were only observed in 10 grouper species. The result suggested that real-time PCR can be a powerful tool for grouper species diagnoses. Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved.
Keywords: Real-time PCR Grouper Species identification
1. Introduction Increased international trade, worldwide rising fish consumption, and various supply resources as well as demand of certain species cause more and more cases of adulteration in the fish market. Such adulteration mainly includes mislabeling, fraud and substitution with cheaper fish. Hence, traceability of fish species is highly requested in the fish market. The typical method for tracing fish species is based on morphological characteristics. However, this method is only suited to whole fish. Once fish is processed, distinguishing characteristics may be lost and fish species identification becomes more difficult. DNA and protein based approaches are also used for fish identification. Protein based method has less advantage on processed sample in which protein may be already denatured. DNA based methods tend to be more favorite due to their superior discrimination abilities. In particular, Real-time PCR has become routine in fish species identification because of the specificity and the sensitivity (Hellberg et al., 2011; Herrero, Madrinan, Vieites, & Espineira, 2010; Hird et al., 2005; Lopez & Pardo, 2005; Nagase et al., 2009; Sanchez, Quinteiro, Rey-Mendez, Perez-Martin, & Sotelo, 2009). Groupers are valuable fish species for marine fishing and commercial fish farming. The distribution of groupers species in China mainly is in Southern China Sea and Eastern China Sea, and groupers mostly point to fishes belong to Epinephelus, Promicrops,
* Corresponding author. Tel.: þ86 592 3269929; fax: þ86 592 3269921. E-mail address: [email protected] (S. Chen).
Plectropomus and Cromileptes genera. Due to an increase in consumption demand and high cost, other cheaper fish meats are occasionally used to adulterate grouper meat. To solve the problem, real-time PCR method is applied for the analysis of groupers identification. Previous publication showed that 16S rRNA gene is a good target for grouper identification (Epinephelus and Mycteroperca species) from substitute species (Trotta et al., 2005). While some highly consumed grouper species in China market, like Promicrops lanceolatus, Plectropomus leopardus and Cromileptes altivelis, were not belong to Epinephelus or Mycteroperca. Therefore this method was not appropriate for identify grouper species in China market. In present study, we designed specific primers and probe according to a 129 bp fragment of COI gene, and developed a real-time PCR method for discrimination of 10 grouper species. 2. Materials and methods 2.1. Samples A total of 10 species of the groupers (Epinephelus akaara, Epinephelus awoara, Epinephelus coioides, Epinephelus fuscoguttatus, Epinephelus moara, Epinephelus quoyanus, P. lanceolatus, P. leopardus, Plectropomus maculates and C. altivelis), were used to test the primer pairs and probe. In addition, 30 other fish species (Oreochromis niloticus, Sciaenops ocellatus, Larimichthys crocea, Lateolabrax japonicus, Parapristipoma trilineatum, Pagrus major, Acanthopagrus schlegelii, Acanthopagrus latus, Priacanthus tayenus, Hapalogenys mucronatus, Oplegnathus fasciatus, Thunnus albacares, Salmo salar, Nemipterus marginatus, Sebastiscus marmoratus, Lutjanus
0956-7135/$ e see front matter Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2012.03.011
S. Chen et al. / Food Control 27 (2012) 108e112 Table 1 Sources of the COI sequences used for alignment and primer design. Species
GenBank accession no.
Species
GenBank accession no.
Epinephelus akaara Epinephelus awoara Epinephelus coioides Epinephelus fuscoguttatus Epinephelus moara Epinephelus quoyanus Promicrops lanceolatus Plectropomus leopardus Plectropomus maculates
JF750758 JF750762 JF750760 JF750761 JF750759 DQ107863 JQ268579 JF750763 JF750764
EU266373 EU392206 EU524352 AF240754 EU595292 EF025492 GU805049 EU398761 EF609346
Cromileptes altivelis Oreochromis niloticus Sciaenops ocellatus Larimichthys crocea Lateolabrax japonicus Parapristipoma trilineatum Pagrus major Acanthopagrus schlegelii Acanthopagrus latus Priacanthus tayenus Hapalogenys mucronatus
JF750765 DQ856617 HQ025011 FJ237997 HM180645 EF607482
Oplegnathus fasciatus Thunnus albacares Salmo salar Nemipterus marginatus Sebastiscus marmoratus Lutjanus malabaricus Rhynchobatus djiddensis Dasyatis zugei Eleutheronema tetradactylum Pampus minor Parastromateus niger Psenopsis anomala Microcanthus strigatus Siganus fuscescens Selaroides leptolepis
JF952802 EU595056 EU595055 EU595249 GU120182
Takifugu oblongus Chiloscyllium plagiosum Mustelus manazo Cheilinus undulatus Prionace glauca
EU595321 JN242709 AB015962 EU595072 EU869837
JF790275 EF609571 EU595251 GU207338 EF609464 EF607550
malabaricus, Rhynchobatus djiddensis, Dasyatis zugei, Eleutheronema tetradactylum, Pampus minor, Parastromateus niger, Psenopsis anomala, Microcanthus strigatus, Siganus fuscescens, Selaroides leptolepis, Takifugu oblongus, Chiloscyllium plagiosum, Mustelus manazo, Cheilinus undulatus, Prionace glauca) were used as genetically distant taxa. All the specimens were purchased from seafood markets of Xiamen and Guangdong, China, and taxonomically identifies by an ichthyologist at Third Institute of Oceanography, State Oceanic Administration, P. R. China. Meat samples from live or frozen specimens of each species were obtained freshly and immediately processed by cutting muscle into small portions and subsequently stored at 20 C until use. 2.2. Extraction of genomic DNA Total genomic DNA extraction was performed from muscle sample. Fresh and frozen pieces of samples (40e400 mg) were ground in liquid N2. The resulting tissue was extracted using Qiagen DNeasy Blood & Tissue Kit (Spin-Column Protocol). DNA was eluted in ultrapure water and used for further analysis. DNA concentrations (ng/mL) were determined by absorbance at 260 nm using an AlphaSpec mL calculator. The amplification of DNA templates for all specimens was confirmed by universal primer pairs in the 16S rRNA gene as Table 2. 2.3. PCR amplification of 16S rRNA gene PCR amplification of 16S rRNA gene was carried out on Biorad Amp PCR system (Biorad) in a 25 mL reaction volume containing 12.5 mL of
109
2 PCR mix (Agilent), 1 mL of 10 mM primer, and 1mLof template DNA(2.5e25.0 ng/mL). After an initial denaturation step at 94 C for 2 min, 35 cycles were performed as follows: denaturation at 94 C for 30 s, annealing at 52 C for 40 s, and extension at 72 C for 60 s, with a final extension of 10 min at 72 C. The PCR products were detected and compared with the positions of size markers using Agilent DNA 1000 Kit (Agilent) on the Agilent 2100 Bioanalyzer (Agilent). 2.4. Real-time primer pairs and probe Real-time primer pairs and a probe were designed using Primer Express 3.0 software (Applied Biosystems). COI gene sequences of the groupers species were obtained from GenBank nucleotide sequence database (Table 1). Primers and probe were synthesized by TAKARA Ltd. The probe was synthesized with a 6-FAM (6- carboxyfluorescein) reporter dye at the 50 end and a TAMRA (6- carboxytetramethylrhodamine) quencher molecule at the 30 end. Primer and probe concentrations were optimized for real-time PCR. Primers and probe sequences named Gro-F, Gro-R and Gro-P were shown in Table 2. 2.5. Real-time PCR of COI gene Real-time PCR was performed on ABI 7900 system (Applied Biosystems，USA) in a 25 mL reaction volume containing 12.5 mL of Taqman 2 Fast Start Universal Probe Master Mix (Rox) (Roch Applied Science), 1 mL of 10 mM primer, 1 mL of 10 mM probe (Taqman probe, TAKARA Ltd.), and 2mLof template (2.5e25.0 ng/mL). Reaction was 2 min at 50 C and 10 min at 95 C for activation, followed by 45 cycles of 15 s at 95 C for denaturation, and 1 min at 60 C for annealing and extension. 3. Results 3.1. Design of specific primer pairs and probe for groupers The aim of this study was to develop a reliable method for the routine identification and discrimination of grouper. By aligning the COI sequences of grouper species from Serranidae and other fish species (Table 1), we were able to design primers and probe (Table 2) to differentiate groupers from other species of fish. 3.2. Extraction of genomic DNA All of the DNA extracts from 40 fish species produced a 572 bp PCR fragment respectively using the 16Sar-50 and 16Sbr-30 primers, indicated that the DNA were successfully extracted and the template DNA could be used for PCR amplification. 3.3. The specificity of real-time PCR method DNA from 10 grouper species and 30 other fish species were used as template in real-time PCR reactions respectively. Real-Time PCR method specificity was evaluated by amplification of 40 species.
Table 2 PCR primers and probe used to amplify either 16S rRNA gene or COI gene. Name 0
16Sar5 16Sbr30 Gro-F Gro-R Gro-p
Sequence 50 30
Product size (bp)
References
CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT TGGTGGCTTTGGAAACTGACT ACCCCAGAAGAAGCGAGAAGGA FAMe AGCTTCTGACTTCTTCCTCCATCCTTCCTG -TAMRA
572
Palumbi (1996)
129
This study
110
S. Chen et al. / Food Control 27 (2012) 108e112
Fig. 1. Grouper-specific amplification by real- time PCR.
Fig. 2. Real-time PCR amplification of serial dilution of DNA admixture containing grouper and L. japonicus. (A, E. awoara; B, E. moara; C, E. fuscoguttatus; D, C. altivelis; E, P. leopardus; F, E. coioides; G, E. akaara; H, P. maculates; I, E. quoyanus; J, P. lanceolatus) species. On curve: a, 100%; b, 10%; c, 1%; d, 0.1%; e, 0.01%; f, ddH2O.
S. Chen et al. / Food Control 27 (2012) 108e112
111
Fig. 2. (continued).
The successful amplification only occurred in the 10 groupers (E. akaara, E. moara, E. fuscoguttatus, E. coioides, E. awoara, E. quoyanus, P. lanceolatus, P. leopardus, P. maculates and C. altivelis). And the amplification was at a clearly different rate for different grouper species (Fig. 1). This demonstrated that the designed primers and probe were specific for detection 10 groupers. The realtime PCR reaction for the other 30 fish species (O. niloticus, S. ocellatus, L. crocea, L. japonicus, P. trilineatum, P. major, A. schlegelii, A. latus, P. tayenus, H. mucronatus, O. fasciatus, T. albacares, S. salar, N. marginatus, S. marmoratus, L. malabaricus, R. djiddensis, D. zugei, E. tetradactylum, P. minor, P. niger, P. anomala, M. strigatus, S. fuscescens, S. leptolepis, T. oblongus, C. plagiosum, M. manazo, C. undulatus, P. glauca) did not show any amplification. 3.4. The sensitivity of real-time PCR method The sensitivity of the real-time PCR protocol was determined by amplification of serial dilution of DNA admixture containing grouper and L. japonicus. Grouper DNA (10 ng/mL) and L. japonicus DNA (10 ng/mL) was mixed in different ratio to achieve a concentration of 0.01%, 0.1%, 1% and 10% of grouper respectively. PCR reactions were performed using optimized conditions described above. All analyses were repeated twice. The result showed that the repeated analyses had similar results and the detection limit is 0.01% for E. awoara (Fig. 2A), E. moara (Fig. 2B) and E. fuscoguttatus (Fig. 2C), 0.1% for C. altivelis (Fig. 2D), P. leopardus (Fig. 2E), E. coioides (Fig. 2F), E. akaara (Fig. 2G), and P. maculates (Fig. 2H), and 1% for E. quoyanus (Fig. 2I) and P. lanceolatus (Fig. 2J). According to the Ct value of the real time PCR method (Table 3), we suggest that Ct value <40 should be defined as positive. 3.5. Analysis samples in China market using real-time PCR method Eighty-eight different seafood products containing meat of commercial fish species from Xiamen markets and restaurants were analyzed by real-time PCR method. Sixty-five samples were
fresh or frozen fillets and twenty-three samples were fish balls, fish surimi and fish sausage. Thirty-five fillets were marked as grouper fillets and six fish surimi were declared as grouper surimi. In 41 grouper fillet and surimi samples, the results were in agreement with declarations. Other samples did not show specific amplification.
4. Discussion The grouper species have a relatively high market value in China. Therefore, some retailers misuse the other low-price fish meats instead of grouper meats to make a profit. The purpose of the study was to develop a rapid, reliable, and reproducible method to identify widely consumed grouper species in China market. The mitochondrial cytochrome oxidase subunit I gene (COI) contains both slowly and rapidly evolving codon positions, as well as more conservation and more reliable regions. Therefore, this gene has been considered one of the most frequently used gene for phylogenetic studies at the species or genus level. In the present study, we focused on the highly conserved mitochondrial COI gene, and successfully provided a simple identification method that required only 3 h detecting grouper species. In addition, this method using real-time PCR was demonstrated to be specific and sensitive.
Table 3 Ct values of real-time PCR for different concentration of groupers. Test level
A
B
C
D
E
F
G
H
I
J
100% 10% 1.0% 0.1% 0.01%
21.0 22.7 25.5 28.8 33.2
15.3 19.7 23.3 30.1 31.7
14.7 17.8 21.1 25.0 29.2
26.8 29.4 33.6 36.2 e
26.6 29.5 33.7 35.9 e
25.4 30.1 32.7 38.8 e
29.5 32.0 33.2 41.3 e
29.3 32.1 36.9 38.1 e
32.8 35.7 37.6 e e
28.6 32.1 35.8 e e
A, E. awoara; B, E. moara; C, E. fuscoguttatus; D, C. altivelis; E, P. leopardus; F, E. coioides; G, E. akaara; H, P. maculates; I, E. quoyanus; J, P. lanceolatus. “-”means no amplification or Ct value >45.
112
S. Chen et al. / Food Control 27 (2012) 108e112
Furthermore, huge price differences exist in different grouper species. Cheaper grouper meats are occasionally used to adulterate expensive ones. We have used PCR-RFLP method to discriminate eight grouper species (E. fuscoguttatus, E. coioides, E. awoara, E. quoyanus, P. lanceolatus, P. leopardus, P. maculates and C. altivelis) successfully (Chen, Zhang, Chen, Xu, & Zhou, 2011HYPERLINK). Since E. akaara and E. moara had same patten when using Ddel, HeaIII and NlaIII enzymes, these two grouper could be distinguished by sequencing method.
Acknowledgments This work was supported by a grant (No. 2011IK245) from General Administration of Quality Supervision, Inspection & Quarantine of the People’s Republic of China (AQSIQ).
References Chen, S., Zhang, J., Chen, W., Xu, D., & Zhou, Y. (2011). Species identification of grouper and snapper in Taiwan Strait using polymerase chain reactionrestriction fragment length polymorphism analysis and lab-on-a-chip system. Chinese Journal of Chromatography, 29, 677e680.
Hellberg, R. S. R., Naaum, A. M., Handy, S. M., Robert, H., Hanner, Deeds, J. R., Yancy, H. F., et al. (2011). Interlaboratory evaluation of a real-time multiplex polymerase chain reaction method for identification of salmon and trout species in commercial products. Journal of Agricultural and Food Chemistry, 59, 876e884. Herrero, B., Madrinan, M., Vieites, J. M., & Espineira, M. (2010). Authentication of Atlantic cod (Gadus morhua) using real time PCR. Journal of Agricultural and Food Chemistry, 58, 4794e4799. Hird, H. J., Hold, G. L., Chisholm, J., Reece, P., Russell, V. J., Brown, J., et al. (2005). Development of a method for the quantification of haddock (Melanogrammus aeglefinus) in commercial products using real-time PCR. European Food Research and Technology, 220, 633e637. Lopez, I., & Pardo, M. A. (2005). Application of relative quantification TaqMan realtime polymerase chain reaction technology for the identification and quantification of Thunnus alalunga and Thunnus albacares. Journal of Agricultural and Food Chemistry, 53, 4554e4560. Nagase, M., Yi, R., Hidaka, F., Maeta, K., Aimi, T., Yamaguchi, T., et al. (2009). Quantification of relative flying fish paste content in the processed seafood agonoyaki using real-time PCR. Fisheries Science, 75, 811e816. Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In D. M. Hillis, C. Moritz, & B. K. Mable (Eds.), Molecular systematics (pp. 205e247). Massachusetts, Sunderland: Sinauer & Associates Inc. Sanchez, A., Quinteiro, J., Rey-Mendez, M., Perez-Martin, R. I., & Sotelo, C. G. (2009). Identification of European hake species (Merluccius merluccius) using real-time PCR. Journal of Agricultural and Food Chemistry, 57, 3397e3403. Trotta, M., Schonhuth, S., Pepe, T., Cortesi, M. L., Puyet, A., & Bautista, J. M. (2005). Multiples PCR method for use in real-time PCR for identification of fish fillets from grouper (Epinephelus and Mycteroperca species) and common substitute species. Journal of Agricultural and Food Chemistry, 53, 2039e2045.
Contents lists available at SciVerse ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Quick method for grouper species identification using real-time PCR Shuangya Chen a, *, Jin Zhang b, Weiling Chen a, Yongxiang Zhang a, Jiahe Wang a, Dunming Xu a, Yu Zhou a a b
Xiamen Entry-Exit Inspection and Quarantine Technology Center, No. 2165, Jiangang Road, Haicang District, Xiamen, Fujian 361026, China Agilent Technologies Co. Ltd., Beijing 100102, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 January 2012 Received in revised form 13 March 2012 Accepted 14 March 2012
A convenient and quick method based on real-time polymerase chain reaction (PCR) was established to identify 10 grouper species in China. According to the sequence of mitochondrial cytochrome oxidase subunit I (COI) gene, primers and probe were designed. PCR amplifications of 129 bp of COI gene sequences from 10 grouper species of four genera (Epinephelus, Promicrops, Plectropomus and Cromileptes) were compared with that of 30 other fish species. PCR amplifications were only observed in 10 grouper species. The result suggested that real-time PCR can be a powerful tool for grouper species diagnoses. Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved.
Keywords: Real-time PCR Grouper Species identification
1. Introduction Increased international trade, worldwide rising fish consumption, and various supply resources as well as demand of certain species cause more and more cases of adulteration in the fish market. Such adulteration mainly includes mislabeling, fraud and substitution with cheaper fish. Hence, traceability of fish species is highly requested in the fish market. The typical method for tracing fish species is based on morphological characteristics. However, this method is only suited to whole fish. Once fish is processed, distinguishing characteristics may be lost and fish species identification becomes more difficult. DNA and protein based approaches are also used for fish identification. Protein based method has less advantage on processed sample in which protein may be already denatured. DNA based methods tend to be more favorite due to their superior discrimination abilities. In particular, Real-time PCR has become routine in fish species identification because of the specificity and the sensitivity (Hellberg et al., 2011; Herrero, Madrinan, Vieites, & Espineira, 2010; Hird et al., 2005; Lopez & Pardo, 2005; Nagase et al., 2009; Sanchez, Quinteiro, Rey-Mendez, Perez-Martin, & Sotelo, 2009). Groupers are valuable fish species for marine fishing and commercial fish farming. The distribution of groupers species in China mainly is in Southern China Sea and Eastern China Sea, and groupers mostly point to fishes belong to Epinephelus, Promicrops,
* Corresponding author. Tel.: þ86 592 3269929; fax: þ86 592 3269921. E-mail address: [email protected] (S. Chen).
Plectropomus and Cromileptes genera. Due to an increase in consumption demand and high cost, other cheaper fish meats are occasionally used to adulterate grouper meat. To solve the problem, real-time PCR method is applied for the analysis of groupers identification. Previous publication showed that 16S rRNA gene is a good target for grouper identification (Epinephelus and Mycteroperca species) from substitute species (Trotta et al., 2005). While some highly consumed grouper species in China market, like Promicrops lanceolatus, Plectropomus leopardus and Cromileptes altivelis, were not belong to Epinephelus or Mycteroperca. Therefore this method was not appropriate for identify grouper species in China market. In present study, we designed specific primers and probe according to a 129 bp fragment of COI gene, and developed a real-time PCR method for discrimination of 10 grouper species. 2. Materials and methods 2.1. Samples A total of 10 species of the groupers (Epinephelus akaara, Epinephelus awoara, Epinephelus coioides, Epinephelus fuscoguttatus, Epinephelus moara, Epinephelus quoyanus, P. lanceolatus, P. leopardus, Plectropomus maculates and C. altivelis), were used to test the primer pairs and probe. In addition, 30 other fish species (Oreochromis niloticus, Sciaenops ocellatus, Larimichthys crocea, Lateolabrax japonicus, Parapristipoma trilineatum, Pagrus major, Acanthopagrus schlegelii, Acanthopagrus latus, Priacanthus tayenus, Hapalogenys mucronatus, Oplegnathus fasciatus, Thunnus albacares, Salmo salar, Nemipterus marginatus, Sebastiscus marmoratus, Lutjanus
0956-7135/$ e see front matter Crown Copyright Ó 2012 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2012.03.011
S. Chen et al. / Food Control 27 (2012) 108e112 Table 1 Sources of the COI sequences used for alignment and primer design. Species
GenBank accession no.
Species
GenBank accession no.
Epinephelus akaara Epinephelus awoara Epinephelus coioides Epinephelus fuscoguttatus Epinephelus moara Epinephelus quoyanus Promicrops lanceolatus Plectropomus leopardus Plectropomus maculates
JF750758 JF750762 JF750760 JF750761 JF750759 DQ107863 JQ268579 JF750763 JF750764
EU266373 EU392206 EU524352 AF240754 EU595292 EF025492 GU805049 EU398761 EF609346
Cromileptes altivelis Oreochromis niloticus Sciaenops ocellatus Larimichthys crocea Lateolabrax japonicus Parapristipoma trilineatum Pagrus major Acanthopagrus schlegelii Acanthopagrus latus Priacanthus tayenus Hapalogenys mucronatus
JF750765 DQ856617 HQ025011 FJ237997 HM180645 EF607482
Oplegnathus fasciatus Thunnus albacares Salmo salar Nemipterus marginatus Sebastiscus marmoratus Lutjanus malabaricus Rhynchobatus djiddensis Dasyatis zugei Eleutheronema tetradactylum Pampus minor Parastromateus niger Psenopsis anomala Microcanthus strigatus Siganus fuscescens Selaroides leptolepis
JF952802 EU595056 EU595055 EU595249 GU120182
Takifugu oblongus Chiloscyllium plagiosum Mustelus manazo Cheilinus undulatus Prionace glauca
EU595321 JN242709 AB015962 EU595072 EU869837
JF790275 EF609571 EU595251 GU207338 EF609464 EF607550
malabaricus, Rhynchobatus djiddensis, Dasyatis zugei, Eleutheronema tetradactylum, Pampus minor, Parastromateus niger, Psenopsis anomala, Microcanthus strigatus, Siganus fuscescens, Selaroides leptolepis, Takifugu oblongus, Chiloscyllium plagiosum, Mustelus manazo, Cheilinus undulatus, Prionace glauca) were used as genetically distant taxa. All the specimens were purchased from seafood markets of Xiamen and Guangdong, China, and taxonomically identifies by an ichthyologist at Third Institute of Oceanography, State Oceanic Administration, P. R. China. Meat samples from live or frozen specimens of each species were obtained freshly and immediately processed by cutting muscle into small portions and subsequently stored at 20 C until use. 2.2. Extraction of genomic DNA Total genomic DNA extraction was performed from muscle sample. Fresh and frozen pieces of samples (40e400 mg) were ground in liquid N2. The resulting tissue was extracted using Qiagen DNeasy Blood & Tissue Kit (Spin-Column Protocol). DNA was eluted in ultrapure water and used for further analysis. DNA concentrations (ng/mL) were determined by absorbance at 260 nm using an AlphaSpec mL calculator. The amplification of DNA templates for all specimens was confirmed by universal primer pairs in the 16S rRNA gene as Table 2. 2.3. PCR amplification of 16S rRNA gene PCR amplification of 16S rRNA gene was carried out on Biorad Amp PCR system (Biorad) in a 25 mL reaction volume containing 12.5 mL of
109
2 PCR mix (Agilent), 1 mL of 10 mM primer, and 1mLof template DNA(2.5e25.0 ng/mL). After an initial denaturation step at 94 C for 2 min, 35 cycles were performed as follows: denaturation at 94 C for 30 s, annealing at 52 C for 40 s, and extension at 72 C for 60 s, with a final extension of 10 min at 72 C. The PCR products were detected and compared with the positions of size markers using Agilent DNA 1000 Kit (Agilent) on the Agilent 2100 Bioanalyzer (Agilent). 2.4. Real-time primer pairs and probe Real-time primer pairs and a probe were designed using Primer Express 3.0 software (Applied Biosystems). COI gene sequences of the groupers species were obtained from GenBank nucleotide sequence database (Table 1). Primers and probe were synthesized by TAKARA Ltd. The probe was synthesized with a 6-FAM (6- carboxyfluorescein) reporter dye at the 50 end and a TAMRA (6- carboxytetramethylrhodamine) quencher molecule at the 30 end. Primer and probe concentrations were optimized for real-time PCR. Primers and probe sequences named Gro-F, Gro-R and Gro-P were shown in Table 2. 2.5. Real-time PCR of COI gene Real-time PCR was performed on ABI 7900 system (Applied Biosystems，USA) in a 25 mL reaction volume containing 12.5 mL of Taqman 2 Fast Start Universal Probe Master Mix (Rox) (Roch Applied Science), 1 mL of 10 mM primer, 1 mL of 10 mM probe (Taqman probe, TAKARA Ltd.), and 2mLof template (2.5e25.0 ng/mL). Reaction was 2 min at 50 C and 10 min at 95 C for activation, followed by 45 cycles of 15 s at 95 C for denaturation, and 1 min at 60 C for annealing and extension. 3. Results 3.1. Design of specific primer pairs and probe for groupers The aim of this study was to develop a reliable method for the routine identification and discrimination of grouper. By aligning the COI sequences of grouper species from Serranidae and other fish species (Table 1), we were able to design primers and probe (Table 2) to differentiate groupers from other species of fish. 3.2. Extraction of genomic DNA All of the DNA extracts from 40 fish species produced a 572 bp PCR fragment respectively using the 16Sar-50 and 16Sbr-30 primers, indicated that the DNA were successfully extracted and the template DNA could be used for PCR amplification. 3.3. The specificity of real-time PCR method DNA from 10 grouper species and 30 other fish species were used as template in real-time PCR reactions respectively. Real-Time PCR method specificity was evaluated by amplification of 40 species.
Table 2 PCR primers and probe used to amplify either 16S rRNA gene or COI gene. Name 0
16Sar5 16Sbr30 Gro-F Gro-R Gro-p
Sequence 50 30
Product size (bp)
References
CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT TGGTGGCTTTGGAAACTGACT ACCCCAGAAGAAGCGAGAAGGA FAMe AGCTTCTGACTTCTTCCTCCATCCTTCCTG -TAMRA
572
Palumbi (1996)
129
This study
110
S. Chen et al. / Food Control 27 (2012) 108e112
Fig. 1. Grouper-specific amplification by real- time PCR.
Fig. 2. Real-time PCR amplification of serial dilution of DNA admixture containing grouper and L. japonicus. (A, E. awoara; B, E. moara; C, E. fuscoguttatus; D, C. altivelis; E, P. leopardus; F, E. coioides; G, E. akaara; H, P. maculates; I, E. quoyanus; J, P. lanceolatus) species. On curve: a, 100%; b, 10%; c, 1%; d, 0.1%; e, 0.01%; f, ddH2O.
S. Chen et al. / Food Control 27 (2012) 108e112
111
Fig. 2. (continued).
The successful amplification only occurred in the 10 groupers (E. akaara, E. moara, E. fuscoguttatus, E. coioides, E. awoara, E. quoyanus, P. lanceolatus, P. leopardus, P. maculates and C. altivelis). And the amplification was at a clearly different rate for different grouper species (Fig. 1). This demonstrated that the designed primers and probe were specific for detection 10 groupers. The realtime PCR reaction for the other 30 fish species (O. niloticus, S. ocellatus, L. crocea, L. japonicus, P. trilineatum, P. major, A. schlegelii, A. latus, P. tayenus, H. mucronatus, O. fasciatus, T. albacares, S. salar, N. marginatus, S. marmoratus, L. malabaricus, R. djiddensis, D. zugei, E. tetradactylum, P. minor, P. niger, P. anomala, M. strigatus, S. fuscescens, S. leptolepis, T. oblongus, C. plagiosum, M. manazo, C. undulatus, P. glauca) did not show any amplification. 3.4. The sensitivity of real-time PCR method The sensitivity of the real-time PCR protocol was determined by amplification of serial dilution of DNA admixture containing grouper and L. japonicus. Grouper DNA (10 ng/mL) and L. japonicus DNA (10 ng/mL) was mixed in different ratio to achieve a concentration of 0.01%, 0.1%, 1% and 10% of grouper respectively. PCR reactions were performed using optimized conditions described above. All analyses were repeated twice. The result showed that the repeated analyses had similar results and the detection limit is 0.01% for E. awoara (Fig. 2A), E. moara (Fig. 2B) and E. fuscoguttatus (Fig. 2C), 0.1% for C. altivelis (Fig. 2D), P. leopardus (Fig. 2E), E. coioides (Fig. 2F), E. akaara (Fig. 2G), and P. maculates (Fig. 2H), and 1% for E. quoyanus (Fig. 2I) and P. lanceolatus (Fig. 2J). According to the Ct value of the real time PCR method (Table 3), we suggest that Ct value <40 should be defined as positive. 3.5. Analysis samples in China market using real-time PCR method Eighty-eight different seafood products containing meat of commercial fish species from Xiamen markets and restaurants were analyzed by real-time PCR method. Sixty-five samples were
fresh or frozen fillets and twenty-three samples were fish balls, fish surimi and fish sausage. Thirty-five fillets were marked as grouper fillets and six fish surimi were declared as grouper surimi. In 41 grouper fillet and surimi samples, the results were in agreement with declarations. Other samples did not show specific amplification.
4. Discussion The grouper species have a relatively high market value in China. Therefore, some retailers misuse the other low-price fish meats instead of grouper meats to make a profit. The purpose of the study was to develop a rapid, reliable, and reproducible method to identify widely consumed grouper species in China market. The mitochondrial cytochrome oxidase subunit I gene (COI) contains both slowly and rapidly evolving codon positions, as well as more conservation and more reliable regions. Therefore, this gene has been considered one of the most frequently used gene for phylogenetic studies at the species or genus level. In the present study, we focused on the highly conserved mitochondrial COI gene, and successfully provided a simple identification method that required only 3 h detecting grouper species. In addition, this method using real-time PCR was demonstrated to be specific and sensitive.
Table 3 Ct values of real-time PCR for different concentration of groupers. Test level
A
B
C
D
E
F
G
H
I
J
100% 10% 1.0% 0.1% 0.01%
21.0 22.7 25.5 28.8 33.2
15.3 19.7 23.3 30.1 31.7
14.7 17.8 21.1 25.0 29.2
26.8 29.4 33.6 36.2 e
26.6 29.5 33.7 35.9 e
25.4 30.1 32.7 38.8 e
29.5 32.0 33.2 41.3 e
29.3 32.1 36.9 38.1 e
32.8 35.7 37.6 e e
28.6 32.1 35.8 e e
A, E. awoara; B, E. moara; C, E. fuscoguttatus; D, C. altivelis; E, P. leopardus; F, E. coioides; G, E. akaara; H, P. maculates; I, E. quoyanus; J, P. lanceolatus. “-”means no amplification or Ct value >45.
112
S. Chen et al. / Food Control 27 (2012) 108e112
Furthermore, huge price differences exist in different grouper species. Cheaper grouper meats are occasionally used to adulterate expensive ones. We have used PCR-RFLP method to discriminate eight grouper species (E. fuscoguttatus, E. coioides, E. awoara, E. quoyanus, P. lanceolatus, P. leopardus, P. maculates and C. altivelis) successfully (Chen, Zhang, Chen, Xu, & Zhou, 2011HYPERLINK). Since E. akaara and E. moara had same patten when using Ddel, HeaIII and NlaIII enzymes, these two grouper could be distinguished by sequencing method.
Acknowledgments This work was supported by a grant (No. 2011IK245) from General Administration of Quality Supervision, Inspection & Quarantine of the People’s Republic of China (AQSIQ).
References Chen, S., Zhang, J., Chen, W., Xu, D., & Zhou, Y. (2011). Species identification of grouper and snapper in Taiwan Strait using polymerase chain reactionrestriction fragment length polymorphism analysis and lab-on-a-chip system. Chinese Journal of Chromatography, 29, 677e680.
Hellberg, R. S. R., Naaum, A. M., Handy, S. M., Robert, H., Hanner, Deeds, J. R., Yancy, H. F., et al. (2011). Interlaboratory evaluation of a real-time multiplex polymerase chain reaction method for identification of salmon and trout species in commercial products. Journal of Agricultural and Food Chemistry, 59, 876e884. Herrero, B., Madrinan, M., Vieites, J. M., & Espineira, M. (2010). Authentication of Atlantic cod (Gadus morhua) using real time PCR. Journal of Agricultural and Food Chemistry, 58, 4794e4799. Hird, H. J., Hold, G. L., Chisholm, J., Reece, P., Russell, V. J., Brown, J., et al. (2005). Development of a method for the quantification of haddock (Melanogrammus aeglefinus) in commercial products using real-time PCR. European Food Research and Technology, 220, 633e637. Lopez, I., & Pardo, M. A. (2005). Application of relative quantification TaqMan realtime polymerase chain reaction technology for the identification and quantification of Thunnus alalunga and Thunnus albacares. Journal of Agricultural and Food Chemistry, 53, 4554e4560. Nagase, M., Yi, R., Hidaka, F., Maeta, K., Aimi, T., Yamaguchi, T., et al. (2009). Quantification of relative flying fish paste content in the processed seafood agonoyaki using real-time PCR. Fisheries Science, 75, 811e816. Palumbi, S. R. (1996). Nucleic acids II: the polymerase chain reaction. In D. M. Hillis, C. Moritz, & B. K. Mable (Eds.), Molecular systematics (pp. 205e247). Massachusetts, Sunderland: Sinauer & Associates Inc. Sanchez, A., Quinteiro, J., Rey-Mendez, M., Perez-Martin, R. I., & Sotelo, C. G. (2009). Identification of European hake species (Merluccius merluccius) using real-time PCR. Journal of Agricultural and Food Chemistry, 57, 3397e3403. Trotta, M., Schonhuth, S., Pepe, T., Cortesi, M. L., Puyet, A., & Bautista, J. M. (2005). Multiples PCR method for use in real-time PCR for identification of fish fillets from grouper (Epinephelus and Mycteroperca species) and common substitute species. Journal of Agricultural and Food Chemistry, 53, 2039e2045.