Rab3 is involved in cellular immune responses of the cotton bollworm, Helicoverpa armigera

Developmental and Comparative Immunology 50 (2015) 78–86

Contents lists available at ScienceDirect

Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i

Rab3 is involved in cellular immune responses of the cotton bollworm, Helicoverpa armigera Jie Li 1, Cai-Xia Song 1, Yu-Ping Li, Li Li, Xiu-Hong Wei, Jia-Lin Wang *, Xu-Sheng Liu ** Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, 152 Luoyu Road, Wuhan 430079, China

A R T I C L E

I N F O

Article history: Received 28 July 2014 Revised 23 December 2014 Accepted 12 January 2015 Available online 4 February 2015 Keywords: Rab GTPase Phagocytosis Nodulation Encapsulation Cellular immune response Helicoverpa armigera

A B S T R A C T

Rab3, a member of the Rab GTPase family, has been found to be involved in innate immunity. However, the precise function of this GTPase in innate immunity remains unknown. In this study, we identified a Rab3 gene (Ha-Rab3) from the cotton bollworm, Helicoverpa armigera and studied its roles in innate immune responses. Expression of Ha-Rab3 was upregulated in the hemocytes of H. armigera larvae after the injection of Escherichia coli or chromatography beads. The dsRNA-mediated knockdown of Ha-Rab3 gene in H. armigera larval hemocytes led to significant reduction in the phagocytosis and nodulation activities of hemocytes against E. coli, significant increase in the bacterial load in larval hemolymph, and significant reduction in the encapsulation activities of hemocytes toward invading chromatography beads. Furthermore, Ha-Rab3 knockdown significantly suppressed spreading of plasmatocytes. These results suggest that Ha-Rab3 plays important roles in H. armigera cellular immune responses, possibly by mediating spreading of hemocytes. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Rab GTPases (Rab proteins), the largest family of the small GTPase superfamily (Ras/Rap/Ral, Rho/Rac/Cdc42, Arf /Sar, Rab, and Ran family), are evolutionarily conserved in all eukaryotes (Eoin et al., 2012; van Dam et al., 2011). The first Rab GTPase was discovered in yeast Saccharomyces cerevisiae (Novick et al., 1980; Salminen and Novick, 1987). Subsequently, its homologs have been identified in many species, particularly in mammals (Eoin et al., 2012). In humans, 63 Rab genes have been identified, while 11, 29 and 31 Rab genes have been identified in the genomes of S. cerevisiae, Caenorhabditis elegans and Drosophila melanogaster, respectively (Bock et al., 2001; Pereira-Leal and Seabra, 2001; Zhang et al., 2007). Rab GTPases act as molecular switches by being active in the GTPbound state and inactive in the GDP-bound state (Harris and Littleton, 2011). They take part in a vast array of basic cell processes including exocytic and endocytic membrane trafficking, cell proliferation and differentiation, and cell–matrix and cell–cell adhesion. They also

* Corresponding author. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, 152 Luoyu Road, Wuhan 430079, China. Tel.: +86 27 67867704; fax: +86 27 67861147. E-mail address: [email protected] (J-L. Wang). ** Corresponding author. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, 152 Luoyu Road, Wuhan 430079, China. Tel.: +86 27 67867704; fax: +86 27 67861147. E-mail address: [email protected] (X-S. Liu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.dci.2015.01.008 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

contribute to cell type-specific functions such as secretion (in endocrine and exocrine cells), synaptic transmission (in neurons), and phagocytosis (in macrophages and dendritic cells) (Pfeffer, 2001; Schwartz et al., 2007; Segev, 2001). Recently, studies have revealed the involvement of Rab GTPases in invertebrate innate immunity. For example, Rab7 of the black tiger shrimp, Penaeus monodon, was found to be involved in white spot syndrome virus (WSSV) infection through binding directly to VP28 protein of WSSV (Sritunyalucksana et al., 2006). A separate study showed that the infections of WSSV and yellow head virus (YHV) were inhibited in P. monodon when Rab7 was suppressed with dsRNA (Ongvarrasopone et al., 2008). The expression of Rab6 mRNA was upregulated in shrimp Penaeus japonicas following virus infection (Wu and Zhang, 2007). Further, it has been shown that P. japonicas Rab6 interacts with the envelope protein VP466 of WSSV as a virus intracellular receptor and regulates the hemocytic phagocytosis of WSSV by interacting with actin (Wu and Zhang, 2007; Wu et al., 2007). In shrimp Marsupenaeus japonicus, siRNA-mediated silencing of Rab6 gene inhibited the phagocytosis against bacteria, while its overexpression led to increased phagocytosis, suggesting that this Rab GTPase was involved in the regulation of hemocyte phagocytosis of shrimp (Zong et al., 2008). M. japonicus Rab6 could interact with actin and regulate hemocyte phagocytosis against WSSV by inducing actin cytoskeletal rearrangement (Ye et al., 2012). In D. melanogaster, Rab35 plays a key regulatory role in the phagocytosis of hemocytes by controlling actin rearrangement at the immune cell periphery (Shim et al., 2010). D. melanogaster Rab14 regulated hemocytic phagocytosis against Staphylococcus aureus by

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

controlling the maturation of phagosomes containing bacteria and the fusion of phagosomes with lysosomes (Garg and Wu, 2014). In a recent transcriptome analysis of the cotton bollworm, Helicoverpa armigera, hemocytes identified a putative Rab3 gene (HaRab3). Rab3 is best known for its role in regulating synaptic vesicle trafficking in neurons (Fischer von Mollard et al., 1990; Graf et al., 2009; Nonet et al., 1997). Moreover, studies have shown that this GTPase may be involved in innate immunity. For example, the expression of Rab3 in the Chinese mitten crab, Eriocheir sinensis hemocytes was significantly upregulated after the injection of bacteria Vibrio anguillarum (Wang et al., 2013). The expression levels of Rab3a mRNA in the channel catfish, Ictalurus punctatus were found to be upregulated after bacterial infection (Wang et al., 2014b). However, the precise function of this GTPase in innate immunity remains unknown. In this study, we investigated the role of HaRab3 in immune responses of H. armigera. 2. Materials and methods 2.1. Insect rearing H. armigera larvae were reared on an artificial diet at 28 ± 1 °C under a 14-h light/10-h dark photoperiod, as described by Li et al. (2009). 2.2. Identification and sequence analysis of Ha-Rab3 gene The immune transcriptome of H. armigera hemocytes was sequenced as described (Yang et al., 2013). A cDNA encoding protein homologous to Rab3 was identified and named Ha-Rab3 (GenBank No.: KM035414). The domain prediction was performed using SMART (http://smart.embl-heidelberg.de/). The deduced amino acid sequences were aligned using MEGA 4.0 (http://www .megasoftware.net/) and GENDOC (http://www.nrbsc.org/ downloads/gd322700.exe). 2.3. Recombinant protein expression and production of antibody Full-length Ha-Rab3 was amplified using a pair of gene specific primers (Table 1). After cutting with EcoRI and XhoI, the DNA fragments were inserted into expression vector pET-32a (Novagen, Madison, WI, USA) and then transformed into Escherichia coli BL21 (DE3). The transformants obtained were grown in LB medium at 37 °C under shaking conditions (200 rpm) until the optical density (OD) at 600 nm reached 0.6. IPTG was added at a final concentration of 0.1 mM, and the medium was shaken overnight at room temperature. Bacterial cells were harvested by centrifugation, re-

79

suspended in PBS, and sonicated on ice. Soluble protein fractions of bacterial cells were applied on High-Affinity Ni–NTA Resin (GenScript, Nanjing, China) to purify recombinant protein according to the manufacturer’s instruction. Purified recombinant protein was used as an antigen for producing polyclonal rabbit antiserum according to the method of Wang et al. (2014a).

2.4. Tissue distribution and immunocytochemistry Reverse transcription-polymerase chain reaction (RT-PCR) was used to compare the abundance of Ha-Rab3 transcript in different tissues of H. armigera. Total RNA was isolated from epidermis, midgut, fat body, and hemocytes of sixth instar day 1 larvae by using Total RNA Purification System (Omega, Norcross, GA, USA) combined with On-Column DNase (Qiagen, Hilden, Germany) digestion to remove any genomic DNA contamination. The first-strand cDNA synthesis was performed using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). The primers used for RT-PCR are listed in Table 1. The rpS3 gene from H. armigera (Ha-rpS3, GenBank No.: KM064630) was used as the control. The annealing temperature and the number of cycles for Ha-Rab3 and Ha-rpS3 were 53.3 °C/35 cycles and 55 °C/ 28 cycles, respectively. The PCR products (3 μl each) were electrophoresed on 1% agarose gel. The DNA was stained using ethidium bromide and imaged. Immunocytochemistry was used to analyze the localization of Ha-Rab3 protein in the hemocytes of H. armigera larvae. Ten microliters of hemolymph was collected from sixth instar day 1 larvae, mixed immediately with 40 μl of ice-chilled anticoagulant (62 mM NaCl, 100 mM glucose, 20 mM EDTA, 26 mM citric acid, 30 mM sodium citrate, pH 4.6), and centrifuged at 4000 rpm for 6 min to separate hemocytes from the plasma. The hemocytes were resuspended in 100 μl of phosphate-buffered saline (PBS; 138 mM NaCl, 2.7 mM KCl, 7.3 mM Na2HPO4, 1.47 M KH2PO4, pH 7.4). Twenty microliters of hemocyte suspensions were dropped onto a slide. The hemocytes were allowed to settle down for 20 min and then fixed with 4% paraformaldehyde in PBS for 20 min. After washing 3 times with PBS, the hemocytes were incubated with 0.2% Triton X-100 for 15 min. After washing another 3 times with PBS, the hemocytes were blocked with 3% BSA in PBS for 1 h. Subsequently, the hemocytes were incubated with anti-Ha-Rab3 antiserum (diluted 1:100 in 3% BSA) for 1.5 h, washed 3 times with PBS, and incubated with fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit immunoglobulin G (IgG) (diluted 1:2000 in 3% BSA) for 1.5 h. Finally, 4′-6-diamidino-2-phenylindole dihydrochloride (DAPI) was used to stain the nuclei. Rabbit preimmune serum instead of anti-HaRab3 antiserum was used as negative control. A fluorescence microscope was used to detect fluorescence.

Table 1 Primer sequences used in RT-PCR (Gene-1), qRT-PCR (Gene-2), recombinant expression (Gene-3), and RNAi (Gene-4) in this study. Gene

Primer sequence (5′→3′)

Fragment length (bp)

Ha-Rab3-1

ATGACTGGAGATGCAAAATGG GTGCAATACTGCTGGGTATAG GTGCGCGTCACTCCGACTC TCATGAGGCCGTCCACGAAC GAACGCTACCGCACGATCACC CTTGCGCGTTGTCCCATGAGT CGGCGTGGAGGTGCGCGTC CGATGGCGCACAGACCGCG CCGGAATTCATGACTGGAGATGCAAAATGGC CCGCTCGAGTTAACAGTTACAGTTGGTGG TAATACGACTCACTATAGGGAGATCAGCCTTCGTCTCCACCG TAATACGACTCACTATAGGGAGACGCAGATTATGTCCACCAGTCG TAATACGACTCACTATAGGGAGAAGGGCGAGGGCGATGCCACC TAATACGACTCACTATAGGGAGATGTACTCCAGCTTGTGCCCC

678

Ha-rpS3-1 Ha-Rab3-2 Ha-rpS3-2 Ha-Rab3-3 Ha-Rab3-4 GFP-4

Note. Restriction enzyme sites in primers for recombinant expression are underlined.

358 145 194 675 455 382

80

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

2.5. Injection of bacteria and chromatography beads E. coli was harvested from cultures by centrifuging at 6000 rpm for 3 min, washed 3 times with PBS, and resuspended in PBS. Sephadex DEAE A-25 chromatography beads (Pharmacia, Uppsala, Sweden) were washed 5 times with PBS and resuspended in PBS. H. armigera larvae (6th instar, 1 day old) were anesthetized on ice and approximately 1 × 105 colony forming units (CFU) bacteria or 30 beads resuspended in 5 μl of PBS were injected into each larval hemocoel. Control larvae were injected with 5 μl of PBS. Hemocyte samples were collected at selected time points (2, 6, 12, and 24 h after injection) for RNA extraction. 2.6. Quantitative real-time PCR Quantitative real-time PCR (qRT-PCR) was used to measure the changes in transcript levels of Ha-Rab3 in hemocytes after the injection of bacteria or beads. The extraction of total RNA and firststrand cDNA synthesis were performed following the methods described in section 2.3. Each 15-μl reaction mixture contained 7.5 μl of 2 × TransEco qPCR Mix (TransGen Biotech, Beijing, China), 2 μl of the cDNA template, and 0.3 μl of each primer (10 μM). The primers used in qRT-PCR are listed in Table 1. The reactions were carried out on a CFX96™ Real-Time PCR System (Bio-Rad, Hercules, CA, USA) using the following parameters: initial denaturing at 95 °C for 2 min, followed by 40 cycles of denaturing at 95 °C for 5 s, annealing at 60 °C for 15 s, and extension at 72 °C for 15 s. The relative expression level of Ha-Rab3 was calculated using the 2 −ΔCT method (Schmittgen and Livak, 2008). Three replicates were performed for each template and three independent replicates were utilized for each data point. 2.7. Double-stranded RNA (dsRNA) synthesis and RNA interference (RNAi)

40 μl of ice-chilled anticoagulant, and centrifuged at 4000 rpm for 6 min to separate the hemocytes from the plasma. The hemocytes were resuspended in 200 μl of PBS. Thirty microliters of FITClabeled E. coli was added and incubated for 1 h at room temperature. Aliquots of the mixture (50 μl) were mounted on glass slides and placed in a moist chamber for 30 min. After washing with PBS for 3 times, 100 μl of 0.2% trypan blue solution in PBS was placed onto each slide, in order to quench the non-phagocytosed E. coli. After 5 min at room temperature, the slides were washed with PBS and treated with 4% formaldehyde in PBS for 10 min to fix the hemocytes. The proportion of hemocytes that had phagocytosed E. coli was determined under a fluorescence microscope. In all, 100 hemocytes were counted on each slide. For each larva, the assay was performed in 3 different slides. Five larvae were analyzed for each treatment. 2.9. Nodule formation assay Forty-eight hours after the dsRNA injection, the larvae were injected with E. coli (1 × 105 cells/larva). The larvae were then dissected 3 h after bacterial injection. The nodules were counted using a stereomicroscope. Five larvae were analyzed for each treatment. 2.10. Bacteria clearance assay Forty-eight hours after the dsRNA injection, the larvae were injected with E. coli (1 × 105 cells/larva). Hemolymph samples were separately collected from each larva 3 h post-E. coli challenge and diluted (1:10) using the anticoagulant. The diluted hemolymph samples (100 μl) were plated on LB agar plates. The colony forming units were enumerated after overnight incubation of the LB plates at 37 °C. Five larvae were analyzed for each treatment. 2.11. Encapsulation assay

The MEGAscript RNAi Kit (Ambion, Austin, TX, USA) was used to generate dsRNA corresponding to the nucleotides 151–559 of the Ha-Rab3 cDNA. A 23 base T7 promoter sequence was added to the 5′ end of each gene specific primer (Table 1). After synthesis, HaRab3 dsRNA was dissolved in elution buffer (10 mM Tris–HCl, pH 7, 1 mM EDTA). The quantity of dsRNA was determined using a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). dsRNA of the green fluorescence protein (GFP) was prepared using the same method and used as a control in RNAi experiments. Fourth instar larvae used for the dsRNA injection were anesthetized on ice for 10 min prior to the microinjection. A total of 4 μl of dsHa-Rab3 (6 μg) was injected into each larva at the intersegment behind the second abdominal segment using a microinjector with a glass capillary needle. Control larvae were injected with 4 μl of dsGFP (6 μg). The larvae were then returned to the artificial diet and reared at 28 °C. Hemocyte samples were collected 48 h postinjection and used to examine mRNA expression levels of HaRab3 by qRT-PCR as described in section 2.5. 2.8. Phagocytosis assay FITC labeling of bacteria was performed using the method described by Li et al. (2014). In brief, heat-killed E. coli (109 cells/ml) were incubated in carbonate buffer (0.1 M Na2CO3, 0.1 M NaHCO3, pH 9.6) containing FITC (0.5 mg/ml) for 1 h in the dark. FITCconjugated E. coli was washed 3 times with PBS, resuspended in PBS at a concentration of 1 × 108 cells/ml, and stored at −20 °C before use. After the injection of dsRNA, the hemolymph samples (10 μl/ larva) were collected 48 h post-injection, mixed immediately with

Forty-eight hours after the dsRNA injection, approximately 30 Sephadex DEAE A-25 chromatography beads resuspended in 5 μl of PBS were injected into each larva. The larvae were dissected 24 h post-bead challenge and the beads were recovered and examined under a microscope. Encapsulation index representing the encapsulation activity of the hemocytes was calculated according to both the encapsulation degree of each bead recovered from a larva and the relative abundance of beads with a given encapsulation degree (Li et al., 2009). Five larvae were analyzed for each treatment. 2.12. Plasmatocyte-spreading assay After the injection of dsRNA, the hemolymph samples were separately collected from each larva at 48 h post-injection and diluted (1:10) using saline solution (137.78 mM NaCl, 8.51 mM KCl, 3.87 mM CaCl2, 1 mM MgCl2 and 10 mM HEPES, pH 7.0). A 50-μl aliquot of diluted hemolymph was dropped onto a glass slide. The hemocytes were allowed to attach for 30 min in a moist chamber. After washing with PBS for 3 times, the hemocytes were examined using a phase-contrast microscope. The extent of plasmatocyte-spreading was determined by counting the number of cells that displayed cytoplasmic expansion. One hundred plasmatocytes were examined on each slide. Three slides per larva and five larvae from each treatment were analyzed. 2.13. Statistical analysis Statistical analysis was performed using Student’s t-test. The p values <0.05 were considered statistically significant.

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

3. Results 3.1. Identification and sequence analysis of Ha-Rab3 A Rab3 cDNA was identified from the transcriptome of H. armigera hemocytes and named Ha-Rab3. This cDNA contained an open reading frame (ORF) of 657 bp (Fig. 1A). The predicted protein encoded by Ha-Rab3 was 218-aa long and included a RAB domain (20–183 aa). The GTP/Mg2+ binding sites were highly conserved in the amino acid sequences of Ha-Rab3. Multiple alignments of the amino acid sequences of Rab3 from H. armigera and other species showed that the deduced amino acid

81

sequence of Ha-Rab3 was highly homologous not only to the Rab3 proteins from insects, such as Bombyx mori (96% identity), Aedes aegypti (89% identity) and D. melanogaster (88% identity), but also to those from higher vertebrates, such as Mus musculus (75% identity) and Homo sapiens (73% identity) (Fig. 1B). Comparative analysis showed that the Switch I and Switch II regions were highly conserved in Ha-Rab3. 3.2. Tissue distribution of Ha-Rab3 The expression of Ha-Rab3 mRNA in 4 tissues (hemocytes, fat body, midgut, and epidermis) of H. armigera larvae was examined

Fig. 1. Sequence analysis of Ha-Rab3. (A) Nucleotide and deduced amino acid sequences of Ha-Rab3. The RAB domain is shaded. The GTP/Mg2+ binding sites are underlined. (B) Multiple alignments of the amino acid sequences of Rab3 from H. armigera and other species. Identical and similar amino acid residues are shaded in black and gray, respectively. The conserved residues for the Switch I and Switch II regions are marked by * and ♦, respectively. Sequences from the following species were used in this analysis: Ha-Rab3 (H. armigera Rab3, KM035414); Bm-Rab3 (B. mori Rab3, NP_001037620); Aa-Rab3C (A. aegypti Rab3C, XP_001651875); Dm-Rab3 (D. melanogaster Rab3, NP_523687); Es-Rab3 (E. sinensis Rab3, AGC10823); Ce-Rab3 (C. elegans Rab3, BAD07033); Dr-Rab3A (Danio rerio Rab3A, NP_001017761); Mm-Rab3A (M. musculus Rab3A, NP_033027); Hs-Rab3A (H. sapiens Rab3A, NP_002857).

82

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

Fig. 2. Tissue distribution of Ha-Rab3. (A) Expression pattern of Ha-Rab3 mRNA in different tissues of H. armigera larvae. rpS3 serves as a control. Hc: hemocytes; Fb: fat body; Mg: midgut; Ep: epidermis. (B) The localization of Ha-Rab3 protein in the hemocytes of H. armigera larvae. Anti-Ha-Rab3 antiserum was incubated with hemocytes. Pre-serum was used as negative control. FITC-labeled (green) goat anti-rabbit IgG were used to recognize the primary antibody. DAPI (blue) was used to stain the nuclei. Gr: granulocyte; Pl: plasmatocyte. Scale bar = 10 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

using RT-PCR. Ha-Rab3 was expressed at high levels in the hemocytes and low levels in the fat body, midgut, and epidermis (Fig. 2A). The localization of Ha-Rab3 protein in the hemocytes of H. armigera larvae was examined using immunocytochemistry. As shown in Fig. 2B, fluorescence was detected in granulocytes and plasmatocytes, suggesting that Ha-Rab3 was expressed in these two types of hemocytes.

0.020

B *

PBS

0.015

E. coli Beads

0.010

*

** *

**

0.005

0.000

qRT-PCR was used to examine the expression levels of Ha-Rab3 mRNA in the hemocytes of H. armigera larvae at various time points after the injection of E. coli or Sephadex DEAE A-25 chromatography beads (Fig. 3A). There was no significant induction of Ha-Rab3

2h

6h

12h

Challenge time

24h

Relative expression level

Relative expression level

A

3.3. Expression profiles of Ha-Rab3 induced by bacterial or chromatography bead challenge

0.010 0.008 0.006 0.004 0.002

**

0.000

dsGFP

dsHa-Rab3

Fig. 3. qRT-PCR assays. (A) Expression profiles of Ha-Rab3 induced by microbial and bead challenge. Hemocytes were collected 2, 6, 12, and 24 h post-challenge to analyze the transcription levels of Ha-Rab3 using qRT-PCR. (B) Confirmation of RNAi effect. Hemocytes were collected at 48 h after dsRNA treatment to analyze the transcription levels of Ha-Rab3 using qRT-PCR. Error bars show means ± SD (n = 3). Asterisks indicate significant differences (Student’s t-test, *P < 0.05, **P < 0.01).

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

mRNA at 2 h after the injection of E. coli, but significant increases were detected at 6 h, 12 h, and 24 h post-injection. After the chromatography bead challenge, the expression of Ha-Rab3 mRNA increased until 6 h after the injection and dropped to the basal level at 24 h post-injection. These results suggested that Ha-Rab3 gene expression was inducible upon bacterial and bead challenges.

3.4. Expression of Ha-Rab3 is suppressed by the injection of its specific dsRNA To understand the function of Ha-Rab3 in the innate immunity of H. armigera, we performed Ha-Rab3 RNAi experiments. H. armigera larvae were injected with dsRNA. qRT-PCR was used to analyze the expression levels of Ha-Rab3 mRNA in the hemocytes 48 h after dsRNA injection (Fig. 3B). Compared to its expression in control larvae (injected with dsGFP), the expression of Ha-Rab3 was significantly lower in the hemocytes of dsHa-Rab3-treated larvae. This result confirmed that Ha-Rab3 gene expression was repressed by the dsRNA.

3.5. In vivo knockdown of Ha-Rab3 gene by RNAi significantly impairs the phagocytic ability of H. armigera hemocytes H. armigera larvae were injected with dsRNA. Hemocytes were collected at 48 h after dsRNA injection and used in in vitro phagocytosis assays. The phagocytic activities of the hemocytes from dsHaRab3-treated larvae against E. coli were significantly lower than that of the hemocytes from dsGFP-treated larvae (Fig. 4A). These results indicated that Ha-Rab3 gene may be involved in the phagocytosis response of H. armigera hemocytes.

3.6. In vivo knockdown of Ha-Rab3 gene by RNAi significantly impairs the nodulation response of H. armigera hemocytes H. armigera larvae were injected with dsRNA and challenged with E. coli. Larvae were dissected 3 h after bacterial challenge and the nodules were counted. The larvae treated with dsHa-Rab3 formed significantly less number of nodules than the control larvae (Fig. 4B). This result suggested that Ha-Rab3 gene may be involved in the nodulation response of H. armigera hemocytes.

3.7. In vivo knockdown of Ha-Rab3 gene by RNAi results in increased bacterial load in hemolymph H. armigera larvae were injected with dsRNA and challenged with E. coli. The bacterial load in hemolymph was estimated 3 h after bacterial injection. E. coli load in hemolymph was significantly higher in Ha-Rab3 knockdown larvae than in control larvae (Fig. 4C). This result further confirmed that Ha-Rab3 plays an important role in defending H. armigera against invading bacteria.

3.8. In vivo knockdown of Ha-Rab3 gene by RNAi significantly impairs the encapsulation ability of H. armigera hemocytes H. armigera larvae were injected with dsRNA and challenged with chromatography beads. Larvae were dissected 24 h after the challenge and the extent of encapsulation of the recovered beads (approximately 20 beads per larva) was calculated. The extent of encapsulation of beads was significantly lower in dsHa-Rab3treated larvae than in the control larvae (Fig. 4D). These results indicated that Ha-Rab3 gene may be involved in the encapsulation response of H. armigera hemocytes.

83

3.9. In vivo knockdown of Ha-Rab3 gene by RNAi reduces spreading of hemocytes H. armigera larvae were injected with dsRNA and the hemocytes were collected at 48 h after the injection. The hemocyte spreading behavior was analyzed under a phase-contrast microscope and the percentage of spread plasmatocytes was calculated. The analysis showed that the plasmatocytes of dsHa-Rab3-treated larvae spread less frequently than those of the control larvae (Fig. 4E). This result indicated that silencing the expression of Ha-Rab3 impairs the spreading of plasmatocytes. 4. Discussion Hemocytes play important roles in host innate immune responses against invading pathogens and parasites. The main cellular immune responses involving hemocytes are phagocytosis, nodulation and encapsulation. Phagocytosis, a conserved cellular response that occurs in many protozoa and all metazoan phyla, refers to the engulfment of bacteria by an individual hemocyte (Lavine and Strand, 2002). Nodulation or encapsulation appears to be a cellular immune response that is restricted to invertebrates. Nodulation refers to multiple hemocytes binding to aggregations of bacteria and fungi while encapsulation refers to hemocyte aggregation around larger pathogens such as parasitoids and nematodes (Jiravanichpaisal et al., 2006). Unlike phagocytosis, nodulation and encapsulation result in the formation of an overlapping sheath of hemocytes around a target (Lavine and Strand, 2002). In this study, we identified a Rab3 gene from H. armigera and investigated its function in the immune responses of H. armigera. We found that the expression levels of Ha-Rab3 in the hemocytes were significantly upregulated after H. armigera larvae were stimulated by E. coli (Fig. 3A). The knockdown of the Ha-Rab3 expression led to a significant reduction in phagocytic and nodulation activities of the hemocytes against E. coli (Fig. 4A and B), thereby increasing the bacterial load in larval hemolymph (Fig. 4C). These results indicated that Ha-Rab3 gene plays important roles in H. armigera defenses against bacterial infections, possibly by mediating phagocytosis and nodulation responses. We also found that the expression levels of Ha-Rab3 were upregulated in H. armigera larval hemocytes following chromatography bead challenge (Fig. 3A). Ha-Rab3 knockdown resulted in a significant reduction in encapsulation activities of the hemocytes toward invading chromatography beads (Fig. 4D). These results suggested that Ha-Rab3 gene may be involved in the encapsulation response of H. armigera larvae. Taken together, our results suggest that Ha-Rab3 is critically involved in all the three cellular immune responses mediated by hemocytes, namely the phagocytosis, nodulation and encapsulation. Four types of circulating hemocytes, namely plasmatocytes, granulocytes, oenocytoids and spherulocytes, have been identified in all the lepidopteran insects studied to date (Ribeiro and Brehélin, 2006). Normally, the hemocytes involved in phagocytosis, nodulation and encapsulation responses are granulocytes and plasmatocytes (Lavine and Strand, 2002; Ribeiro and Brehélin, 2006; Schmidt et al., 2001). Upon recognition of invading non-self, the circulating hemocytes respond by spreading (Gillespie et al., 1997). If the invader is small, this spreading promotes phagocytosis of the particle, whereas a larger invader (or many small invaders) would be subjected to nodulation or encapsulation due to the cooperative action of a number of hemocytes (Eleftherianos et al., 2009; Jiravanichpaisal et al., 2006; Lavine and Strand, 2002). Therefore, the transformation of resting, non-adhesive hemocytes to activated, adhesive hemocytes is a crucial step during these cellular immune responses. This hemocyte behavior requires cytoplasmic morphological change to exhibit cell spreading via pseudopodial extension, a physiological process that depends on cytoskeleton

84

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

A

Phagocytic rate (%)

0.8 0.6

*

0.4 0.2 0.0

dsGFP 100 80 60

**

40 20 0

Extent of encapsulation (weighted sum)

250 200

**

150 100 50 0

dsGFP

D

C CFU/μl hemolymph

Number of nodules per larva

B

dsHa-Rab3

dsHa-Rab3

dsGFP

dsHa-Rab3

15

10

** 5

0

E

Plasmatocyte spreading (%)

dsGFP

dsHa-Rab3

80

60

40

** 20

0

dsGFP

dsHa-Rab3

Fig. 4. RNAi of Ha-Rab3 suppresses cellular immune responses of H. armigera. (A) Phagocytosis assay. Hemocytes were collected at 48 h after dsRNA treatment to analyze its phagocytosis ability against FITC-labeled E. coli. Arrows indicate hemocytes containing phagocytosed bacteria (green). The ratio of phagocytic hemocytes was calculated and shown in the graph. (B) Nodule formation assay. Fourth instar larvae were injected with dsRNA and challenged with E. coli. Larvae were dissected 3 h after bacterial challenge and the nodules were observed. Arrows indicate nodules in larval hemocoel. The number of nodules in each larva was counted and shown in the graph. (C) Bacteria clearance assay. Fourth instar larvae were injected with dsRNA and challenged with E. coli. Hemolymph samples were collected at 3 h after bacterial challenge to perform bacteria clearance assay. y-axis shows the average of colony forming U/μl hemolymph. (D) Encapsulation assay. Fourth instar larvae were injected with dsRNA and challenged with chromatography beads. Beads were recovered from the larval hemocoel 24 h after bead injection and observed under microscope. The extent of encapsulation of the beads was calculated and shown in the graph. (E) Plasmatocyte-spreading assay. Hemocytes were collected at 48 h after dsRNA treatment and examined under a phase-contrast microscope. White arrows, red arrows and asterisks indicate the spreading plasmatocytes, non-spreading plasmatocytes and granulocytes, respectively. The percentage of spread plasmatocytes was calculated and shown in the graph. Scale bar = 10 μm. Error bars show means ± SD (n = 5). Asterisks indicate significant differences (Student’s t-test, *P < 0.05, **P < 0.01). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

rearrangements (Fauvarque and Williams, 2011; Gupta and Campenot, 1996). Although the precise mechanism of activation and regulation of hemocyte-spreading during the cellular immune responses are not fully understood, accumulating evidence suggests that small GTPases play important roles in cellular immune responses via regulating hemocyte spreading. During the phagocytic process of M. japonicus hemocytes, Rab6 induced rearrangement of actin cytoskeleton by interacting with actin (Ye et al., 2012). Hemocytes of Rab35 mutant Drosophila showed defects in the formation of lamellipodium, which caused defects in phagocytosis activity of hemocytes and an increased susceptibility of the flies to bacterial infection (Shim et al., 2010). The knockdown of the Ras in Spodoptera exigua larval hemocytes significantly suppressed hemocyte spreading, cytoskeleton extension, and nodulation behaviors in response to bacterial challenge, indicating that S. exigua Ras gene may regulate nodulation response by mediating hemocyte spreading (Lee et al., 2011). Plasmatocytes and lamellocytes of Rac2 mutant Drosophila could adhere to the parasitoid eggs, but failed to spread after parasitization. This block in hemocyte spreading disrupted all later events in capsule formation (Williams et al., 2005). In Drosophila, β-integrin Myospheroid is necessary for lamellocytes to adhere to the cellular capsule surrounding parasitoid eggs (Irving et al., 2005). Xavier and Williams (2011) reported that Drosophila Rac1 is required for the proper localization of Myospheroid to the cell periphery of hemocytes during the encapsulation to parasitoid eggs. In the present study, we found that silencing the expression of Ha-Rab3 impairs the spreading of H. armigera plasmatocytes (Fig. 4E). This result suggests that H. armigera Ha-Rab3 gene may regulate cellular immune responses by mediating hemocyte spreading. Further studies are needed to fully understand the precise mechanism by which HaRab3 gene regulates hemocyte spreading during the cellular immune responses of H. armigera. The granulocytes of lepidopteran insect take part in cellular immune responses (Ribeiro and Brehélin, 2006). Therefore, these granulocytes also need to undergo a change from non-adhesive state to adhesive state during cellular immune responses. After spreading on the slide, the spreading and non-spreading plasmatocytes of H. armigera larvae could easily be distinguished under a phasecontrast microscope, but the adhesive state of granulocytes was difficult to distinguish (Fig. 4E). Therefore, we did not calculate the extent of granulocyte-spreading in the RNAi assays. But it cannot be excluded that Ha-Rab3 might also mediate spreading of granulocyte during the cellular immune responses of H. armigera. In this study, the sequence analysis indicated that the sequence of Rab3 protein was highly conserved in animals (Fig. 1B). Some functions of Rab3 are also evolutionarily conserved in animals. For example, Rab3 is best known for its role in regulating synaptic vesicle trafficking in neurons. This function of Rab3 is conserved from invertebrates such as nematodes to mammals such as rats (Fischer von Mollard et al., 1990; Graf et al., 2009; Nonet et al., 1997). A recent study showed that the expression of Rab3a mRNA in the teleost I. punctatus was upregulated after bacterial infection, indicating that this gene may play important roles in innate immunity (Wang et al., 2014b). In this study, Rab3 gene was proven to play important roles in the cellular immune responses of H. armigera. Therefore, it could be speculated that the regulation of innate immunity mediated by Rab3 might be conserved in animals during evolution. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (Grant No. 31000982, 31101672) and the Hubei Key Laboratory of Genetic Regulation and Integrative Biology (Grant No. GRIB201305).

85

References Bock, J.B., Matern, H.T., Peden, A.A., Scheller, R.H., 2001. A genomic perspective on membrane compartment organization. Nature 409, 839–841. Eleftherianos, I., Xu, M., Yadi, H., Ffrench-Constant, R.H., Reyolds, S.E., 2009. Plasmatocyte-spreading peptide (PSP) plays a central role in insect cellular immune defenses against bacterial infection. J. Exp. Biol. 212, 1840–1848. Eoin, E.K., Conor, P.H., Bruno, G., Mary, W.M., 2012. The Rab family of proteins: 25 years on. Biochem. Soc. Trans. 40, 1337–1347. Fauvarque, M.O., Williams, M.J., 2011. Drosophila cellular immunity: a story of migration and adhesion. J. Cell Sci. 124, 1373–1383. Fischer von Mollard, G., Mignery, G.A., Baumert, M., Perin, M.S., Hanson, T.J., Burger, P.M., et al., 1990. Rab3 is a small GTP-binding protein exclusively localized to synaptic vesicles. Proc. Natl. Acad. Sci. U.S.A. 87, 1988–1992. Garg, A., Wu, L.P., 2014. Drosophila Rab14 mediates phagocytosis in the immune response to Staphylococcus aureus. Cell. Microbiol. 16, 296–310. Gillespie, J.P., Kanost, M.R., Trenczek, T., 1997. Biological mediators of insect immunity. Annu. Rev. Entomol. 42, 611–643. Graf, E.R., Daniels, R.W., Burgess, R.W., Schwarz, T.L., DiAntonio, A., 2009. Rab3 dynamically controls protein composition at active zones. Neuron 64, 663–677. Gupta, A.P., Campenot, E.S., 1996. Cytoskeletal F-actin polymerization from cytosolic G-actin occurs in the phagocytosing immunocytes of arthropods (Limulus polyphemus and Gromphadorhina portentosa): does [cAMP]i play any role? J. Invertebr. Pathol. 68, 118–130. Harris, K.P., Littleton, J.T., 2011. Vesicle trafficking: a Rab family profile. Curr. Biol. 21, R841–R843. Irving, P., Ubeda, J., Doucet, D., Troxler, L., Lagueux, M., Zachary, D., et al., 2005. New insights into Drosophila larval haemocyte functions through genome-wide analysis. Cell. Microbiol. 7, 335–350. Jiravanichpaisal, P., Lee, B.L., Söderhäll, K., 2006. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 211, 213–236. Lavine, M.D., Strand, M.R., 2002. Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295–1309. Lee, S., Shrestha, S., Prasad, S.V., Kim, Y., 2011. Role of a small G protein Ras in cellular immune response of the beet armyworm, Spodoptera exigua. J. Insect Physiol. 57, 356–362. Li, L., Li, Y.-P., Song, C.-X., Xiao, M., Wang, J.-L., Liu, X.-S., 2014. Identification and functional characterization of a peptidoglycan recognition protein from the cotton bollworm, Helicoverpa armigera. Arch. Insect Biochem. Physiol. 86, 240– 258. Li, Q., Sun, Y., Wang, G., Liu, X., 2009. Effects of the mermithid nematode Ovomermis sinensis on the hemocytes of its host Helicoverpa armigera. J. Insect Physiol. 55, 47–50. Nonet, M.L., Staunton, J.E., Kilgard, M.P., Fergestad, T., Hartwieg, E., Horvitz, H.R., et al., 1997. Caenorhabditis elegans rab-3 mutant synapses exhibit impaired function and are partially depleted of vesicles. J. Neurosci. 17, 8061–8073. Novick, P., Field, C., Schekman, R., 1980. Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 21, 205–215. Ongvarrasopone, C., Chanasakulniyom, M., Sritunyalucksana, K., Panyim, S., 2008. Suppression of PmRab7 by dsRNA inhibits WSSV or YHV infection in shrimp. Mar. Biotechnol. (NY) 10, 374–381. Pereira-Leal, J.B., Seabra, M.C., 2001. Evolution of the Rab family of small GTP-binding proteins. J. Mol. Biol. 313, 889–901. Pfeffer, S.R., 2001. Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol. 11, 487–491. Ribeiro, C., Brehélin, M., 2006. Insect haemocytes: what type of cell is that? J. Insect Physiol. 52, 417–429. Salminen, A., Novick, P.J., 1987. A ras-like protein is required for a post-Golgi event in yeast secretion. Cell 49, 527–538. Schmidt, O., Theopold, U., Strand, M., 2001. Innate immunity and its evasion and suppression by hymenopteran endoparasitoids. Bioessays 23, 344–351. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Schwartz, S.L., Cao, C., Pylypenko, O., Rak, A., Wandinger-Ness, A., 2007. Rab GTPases at a glance. J. Cell Sci. 120, 3905–3910. Segev, N., 2001. Ypt and Rab GTPases: insight into functions through novel interactions. Curr. Opin. Cell Biol. 13, 500–511. Shim, J., Lee, S.M., Lee, M.S., Yoon, J., Kweon, H.S., Kim, Y.J., 2010. Rab35 mediates transport of Cdc42 and Rac1 to the plasma membrane during phagocytosis. Mol. Cell. Biol. 30, 1421–1433. Sritunyalucksana, K., Wannapapho, W., Lo, C.F., Flegel, T.W., 2006. PmRab7 is a VP28-binding protein involved in white spot syndrome virus infection in shrimp. J. Virol. 80, 10734–10742. van Dam, T.J., Bos, J.L., Snel, B., 2011. Evolution of the Ras-like small GTPases and their regulators. Small GTPases 2, 4–16. Wang, J.-L., Zhang, Q., Tang, L., Chen, L., Liu, X.-S., Wang, Y.-F., 2014a. Involvement of a pattern recognition receptor C-type lectin 7 in enhancing cellular encapsulation and melanization due to its carboxyl-terminal CRD domain in the cotton bollworm, Helicoverpa armigera. Dev. Comp. Immunol. 44, 21–29. Wang, L., Li, L., Wang, L., Yang, J., Wang, J., Zhou, Z., et al., 2013. Two Rab GTPases, EsRab-1 and EsRab-3, involved in anti-bacterial response of Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 35, 1007–1015.

86

J. Li et al./Developmental and Comparative Immunology 50 (2015) 78–86

Wang, R., Zhang, Y., Liu, S., Li, C., Sun, L., Bao, L., et al., 2014b. Analysis of 52 Rab GTPases from channel catfish and their involvement in immune responses after bacterial infections. Dev. Comp. Immunol. 45, 21–34. Williams, M.J., Ando, I., Hultmark, D., 2005. Drosophila melanogaster Rac2 is necessary for a proper cellular immune response. Genes Cells 10, 813–823. Wu, W., Zhang, X., 2007. Characterization of a Rab GTPase up-regulated in the shrimp Peneaus japonicus by virus infection. Fish Shellfish Immunol. 23, 438–445. Wu, W., Zong, R., Xu, J., Zhang, X., 2007. Antiviral phagocytosis is regulated by a novel Rab-dependent complex in shrimp Penaeus japonicus. J. Proteome Res. 7, 424–431. Xavier, M.J., Williams, M.J., 2011. The Rho-family GTPase Rac1 regulates integrin localization in Drosophila immunosurveillance cells. PLoS ONE 6, e19504.

Yang, D.-Q., Su, Z.-L., Qiao, C., Zhang, Z., Wang, J.-L., Li, F., et al., 2013. Identification and characterization of two peptidoglycan recognition proteins with zincdependent antibacterial activity from the cotton bollworm, Helicoverpa armigera. Dev. Comp. Immunol. 39, 343–351. Ye, T., Tang, W., Zhang, X., 2012. Involvement of Rab6 in the regulation of phagocytosis against virus infection in invertebrates. J. Proteome Res. 11, 4834–4846. Zhang, J., Schulze, K.L., Hiesinger, P.R., Suyama, K., Wang, S., Fish, M., et al., 2007. Thirty-one flavors of Drosophila rab proteins. Genetics 176, 1307–1322. Zong, R., Wu, W., Xu, J., Zhang, X., 2008. Regulation of phagocytosis against bacterium by Rab GTPase in shrimp Marsupenaeus japonicus. Fish Shellfish Immunol. 25, 258–263.