RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line

BBADIS-63895; No. of pages: 11; 4C: 4, 7 Biochimica et Biophysica Acta xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis

3Q1

Varsha Meghnani, Stefan W. Vetter, Estelle Leclerc ⁎

4

Department of Pharmaceutical Sciences, North Dakota State University, PO Box 6050, Fargo, ND 58108-6050, USA

5

a r t i c l e

6 7 8 9 10

Article history: Received 25 July 2013 Received in revised form 16 February 2014 Accepted 26 February 2014 Available online xxxx

11 12 13 14 15 16

Keywords: RAGE S100B Melanoma p53 cancer Metastatic switch

a b s t r a c t

E

D

P

The formation of melanoma metastases from primary tumor cells is a complex phenomenon that involves the regulation of multiple genes. We have previously shown that the receptor for advanced glycation end products (RAGEs) was up-regulated in late metastatic stages of melanoma patient samples and we hypothesized that up-regulation of RAGE in cells forming a primary melanoma tumor could contribute to the metastatic switch of these cells. To test our hypothesis, we overexpressed RAGE in the WM115 human melanoma cell line that was established from a primary melanoma tumor of a patient. We show here that overexpression of RAGE in these cells is associated with mesenchymal-like morphologies of the cells. These cells demonstrate higher migration abilities and reduced proliferation properties, suggesting that the cells have switched to a metastatic phenotype. At the molecular level, we show that RAGE overexpression is associated with the up-regulation of the RAGE ligand S100B and the down-regulation of p53, ERK1/2, cyclin E and NF-kB. Our study supports a role of RAGE in the metastatic switch of melanoma cells. © 2014 Published by Elsevier B.V.

32 30 29

C

31

1. Introduction

34 35

The receptor for advanced glycation end products (RAGEs) is expressed during early development, but repressed in most adult tissues, except in the lungs, and is found up-regulated in a large number of pathologies such as diabetes, Alzheimer's disease and in many cancers [1,2]. RAGE is activated by structurally unrelated ligands such as the advanced glycation end products (AGEs), HMGB1, or members of the S100 protein family, that are associated with tissue damage and pathological conditions [3–10]. Due to the diversity of its ligands, RAGE is classified as a pattern recognition receptor. RAGE signaling is complex and depends on ligands and cell types [11]. For instance, in colon, gastric, breast, pancreatic and liver cancer tissues RAGE is found up-regulated and suppression of RAGE expression or RAGE signaling reduces cellular proliferation and/or migration [12–17]. However, in lung carcinomas and rhabdomyosarcoma, it is the down-regulation of RAGE that results in increased cellular proliferation and/or migration [18,19], suggesting that the role of RAGE is cancer specific and depends of the tissue and tumor environment [20–22]. The goal of this study was to elucidate the role of RAGE upregulation in melanoma. In melanoma, RAGE has been detected at high levels in a

44 45 46 47 48 49 50 51 52

Q8

R

R

N C O

42 43

U

40 41

E

33

38 39

17 18 19 Q6 20 21 22 23 24 25 26 27 Q7

T

28

36 37

O R O

i n f o

F

2

RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line

1

Abbreviations: RAGEs, receptor for advanced glycation end products; AGEs, advanced glycation end products; HMGB1, high mobility group box 1 protein; EMT, epithelial mesenchymal transition; cdk, cyclin dependent kinase ⁎ Corresponding author at: North Dakota State University, Dept. 2665, PO BOX 6050, Fargo, ND 58108, USA. Tel.: +1 701 231 5187; fax: +1 701 231 8333. E-mail address: [email protected] (E. Leclerc).

subset of metastatic tumor samples, both at the transcription and protein levels [12,23], suggesting that RAGE might contribute to tumor development only in certain melanoma tumors [23]. It was also shown that the metastatic human melanoma cells G361 showed higher levels of cellular proliferation and migration in the presence of RAGE activating AGE ligands [24] and that cellular proliferation could be blocked by antiRAGE antibodies [24]. Similarly, anti-RAGE antibodies have been shown to reduce the growth of melanoma tumor xenografts in mice implanted with G361 melanoma cells [24]. In a different study, RAGE was shown to promote the formation of B16F10 melanoma metastases in mice [25]. Based on these data, we hypothesized that RAGE may contribute significantly to melanoma tumor cell proliferation and/or metastases formation in the population of melanoma tumors where RAGE is upregulated. To test our hypothesis, we overexpressed RAGE in a melanoma cell line (WM115) that originates from a primary melanoma tumor and compared the cellular proliferation and migration of populations of WM115 cells that differed only by their level of RAGE. We observed that the cells expressing high levels of RAGE presented an altered morphology with an elongated mesenchymal-like shape that is a typical feature of metastatic cells. Interestingly, we observed that the RAGE overexpressing cells migrated at higher levels and showed reduced cellular proliferation compared to control cells suggesting that RAGE upregulation led to a metastatic switch [26]. At the molecular level, we showed that the RAGE overexpressing cells produced higher levels of S100B, which is used as a prognostic marker in melanoma patients [27–29]. In addition, we found lower levels of the tumor suppressor p53 protein, cyclin E as well as of ERK1/2 in the cells overexpressing RAGE, which supports the reduced cellular proliferation observed.

http://dx.doi.org/10.1016/j.bbadis.2014.02.013 0925-4439/© 2014 Published by Elsevier B.V.

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

104

The human melanoma cell lines WM115 and WM266 were purchased from ATCC and grown in Opti-MEM (Invitrogen, Carlsbad, CA) supplemented with 4% FBS (Invitrogen) in the presence of penicillin and streptomycin (JR Scientific, Woodland, CA), 5% CO2 and at 37 °C. The cells were stably transfected with pcDNA3 expressing full-length RAGE (a gift from Prof. C.W. Heizmann, Children's Hospital, Zürich, Switzerland) using the SatisFection (Stratagene, Santa Clara, CA) or the X-tremeGENE 9 (Roche Applied Science, Indianapolis, IN) transfection reagents according to the manufacturer's protocols. Cells transfected with the empty pcDNA3 vector were used as negative control cells (WM115-MOCK and WM266-MOCK). Prior to transfection, all plasmids were linearized with MfeI. The transfected cells were selected by limited dilution in the presence of 1 mg/ml G418 (WM-115-RAGE and WM115-I) or 0.5 mg/ml G418 (WM115-MOCK). Transfection of WM115-RAGE and WM115-MOCK with RAGE siRNA (sc-37007) or S100B siRNA (sc-43356) (Santa Cruz Biotechnology, Dallas, TX) was performed according to procedures recommended by the manufacturer. Briefly, cells were seeded and grown to 60%–80% confluence, in 6 well plates in Opti-MEM (Invitrogen) and 4% FBS. The transfection was performed in the absence of serum. The cells were collected after 48 h and cell lysates were prepared for RT-PCR analysis (Section 2.2) or ELISA (Section 2.5).

105

2.2. Real-time PCR (RT-PCR)

85 86 Q9 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103

106

147

Flow cytometric measurements were performed on a C6 Accuri flow cytometer (Accuri, Ann Arbor, MI). The cells were gently detached with a cell scrapper and incubated on ice with a serial dilution of a mouse anti-RAGE antibody (Mab 1145, R&D Systems, Minneapolis, MN). After PBS washes, the cells were further incubated with a FITC-conjugated secondary anti-mouse antibody (10 μg/ml, Jackson ImmunoResearch, West Grove, PA). The mean fluorescence of 5000 events per sample was plotted as a function of the antibody concentration. The data were fitted with a 1:1 binding model using the KaleidaGraph software (Synergy). The experiments were performed in triplicate. Cell cycle analysis was performed on the same instrument using propidium iodide (PI) (Calbiochem) and an antibody against cyclin E (H12, Santa Cruz). Briefly, 60–80% confluent WM115-MOCK and WM115-RAGE cells were fixed with 70% alcohol, and permeabilized with Triton X-100 prior to incubation with cyclin E antibody and PI, according to the published procedures [30]. A FITC-conjugated secondary antibody (Jackson ImmunoResearch) was used to detect the bound primary anti-cyclin E antibody. The fluorescence of PI was used to identify the G1, S and G2/M phases of the cell cycle and to gate the cells. To compare the level of cyclin E in the different phases of the cell cycle, the mean fluorescence of FITC was reported for each population of gated cells. The experiment was performed independently twice using triplicate samples in each experiment.

148 149

2.5. ELISA

171

Cell extracts were prepared using a commercial kit (Paris, Invitrogen) and the protein content was determined with the Pierce BCA protein assay kit (Pierce/Thermo Scientific, Rockford, IL). RAGE protein levels in the cell extracts were determined using the Quantikine human RAGE Immunoassay kit (R&D Systems) according to the manufacturer's procedure, and expressed in picogram of RAGE per mg of total protein. S100B levels in the cell extracts and the conditioned media were determined with the help of a calibration curve obtained from a sandwich ELISA. For the sandwich ELISA, we used a polyclonal anti-S100B antibody (DakoCytomation, Denmark) to capture S100B. A calibration curve was performed using recombinant human S100B (0.01 nM to 150 nM), which was purified according to the standard procedures [31]. To detect bound S100B, we used a second anti-S100B antibody (MAB1820, R&D Systems). The detection was performed using an alkaline phosphatase-conjugated (AP) secondary antibody and para-nitrophenyl phosphate as substrate. The cell lysate and conditioned media samples from two independent experiments were run in duplicate.

172

2.6. Western blots

189

Cell extracts were prepared using a commercial kit (Paris, Invitrogen) and the protein concentration in the cell extracts was determined as described above. The proteins (20–100 μg) were resolved on 10 or 15% SDS PAGE and blotted against nitro-cellulose membranes. The blots were blocked with 3% BSA in TBS (50 mM Tris pH 7.4, 150 mM NaCl) and incubated with the primary antibody diluted in 1% BSA in TBS. HRP conjugated secondary antibodies (donkey anti-rabbit, goat anti-mouse and rabbit anti-goat) were all from Jackson ImmunoResearch and used at dilutions recommended by the manufacturer. The primary antibodies against β-actin (#4970), Akt (#4691), phospho-Akt (Ser473, #4060S), SAPK/JNK (#9258), phospho-SAPK/JNK (#4668, Thr183/Tyr185), p44/42 (#4695)

190 191

U

N

C

O

R

R

E

C

T

RNAs were extracted using a commercial kit (Ambion, Invitrogen) 107 according to the manufacturer's instructions. The quality of the RNA 108 was assessed by absorbance spectroscopy and by agarose gel electro109 phoresis. The RNA was reverse transcribed into cDNA using the Reverse 110 Transcription System from Promega (Madison, WI). 111 The real time PCR (RT-PCR) was run with 20 ng cDNA per well on a 112 Stratagene Mx3000p thermocycler using the Brilliant II SYBER Green 113 QPCR Master mix (Stratagene). The genes of β-actin and glyceraldyde114 3-phosphate dehydrogenase (GAPDH) were used as housekeeping 115 genes. The primers used to detect the transcripts of RAGE, S100B, 116 S100A2, S100A6, S100A10 and β-actin are listed in a previous publica117 tion [23]. The other primers were as follows: GAPDH_Forward: GAAG 118 GTGAAGGTCGGAGTC; GAPDH_Reverse: GAAGATGGTGATGGGATTTC; 119 Q10 p53_Forward: CCAGGGCAGCTACGGTTTC; and p53_Reverse: CTCCGTCA 120 TGTGCTGTGACTG. The following RT-PCR program was used: 10 min at 121 Q11 95 °C followed by 40 cycles of 30 s at 95 °C, 30 s at 58 °C, and 30 s at 122 72 °C. A melting curve was recorded at the end of the cycles to evaluate 123 the quality of the amplified products. 124 The Ct values for each gene were calculated and normalized to 125 β-actin and GAPDH (ΔCt = Ctgene − Ctactin or GAPDH). Since similar ΔCt 126 values were obtained with the housekeeping genes β-actin and 127 GAPDH, only the delta Ct normalized with β-actin are shown. The ΔCt 128 obtained from RAGE transfected cells were then compared to 129 Q12 MOCK transfected cells (Δ(ΔCt) = ΔCt RAGE − ΔCt MOCK ). For each 130 gene, the fold of change (Fgene) of gene expression was calculated 131 using F = 2Δ(ΔCt). The experiments were run in triplicate using cDNAs 132 obtained from three independent RNA preparations. The standard devi133 ations were calculated from the folds of changes in gene expression.

2.4. Flow cytometry

F

83 84

O

2.1. Cell lines and transfection

141 142

R O

82

Hoechst 33342 (Invitrogen) in PBS. The microscope slides were examined using a Zeiss AxioObserver Z1 inverted microscope with a 40 × magnification. The ellipticity of the cells and nuclei of the WM115-MOCK and WM115-RAGE cells was assessed by calculating the ratio of the length over the width of at least 30 cells and their corresponding nuclei.

P

2. Materials and methods

D

81

E

2

134

2.3. Immunofluorescence

For staining the actin filaments, cells were seeded on microscope 136 chamber slides (BD Biosciences, San Jose, CA) overnight, fixed with 137 Q13 3.7% paraformaldehyde followed by permeabilization with 0.1% Triton 138 X-100. The cells were then blocked with 3% BSA in PBS prior to incuba139 tion with sulforhodamine 101 conjugated phalloidin (1/40 dilution) 140 (Biotium, Hayward, CA). Nuclear staining was performed by adding 135

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

143 144 145 146

150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170

173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188

192 193 194 195 196 197 198 199 200

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

201 202

formed were visualized by staining with crystal violet. The colonies in 262 ten different fields were counted. 263

225

2.7.1. Alamar Blue assay

240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261

The cells were seeded (104 cells/well) in 24 well plates and incubated until they reached 60–70% confluence. The cells were then cotransfected with the NF-κB cis-Reporting System (# 219077; Stratagene) containing a luciferase encoding gene and the monster GFP plasmid (SABiosciences) that was used to estimate the transfection efficiency. The transfection was performed using the X-tremeGENE 9 transfection reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's protocols. The pFC-MEKK plasmid was used in cotransfection experiments with the NF-κB plasmid and served as positive control. Following transfection (24 h–48 h), the cells were lysed using the Reporter lysis buffer (Promega, Madison, WI). The activity of the luciferase was determined using a commercial luciferase detection system (# E1500; Promega) on a Quick-Pak Quantifier luminometer.

270

O

E

2.9. Statistical analysis

T

C

E

R

R

238 239

2.7.2. Migration assay The cells were added (104 cells/well) to the top of 8 μm filter inserts (24 well plate, Greiner Bio-One). The inserts were then added into the wells of a 24 well plate containing Opti-MEM and 4% FBS. After 24 h incubation at 37 °C, the cells on top of the filter were gently removed using cotton swabs. Alamar Blue (1/10 dilution, Nalgene) was added to the wells and its fluorescence emission (Ex: 540 nm; Em: 590 nm) was measured after 3 h or 4 h further incubation. The wells containing either the cell culture media alone or the seeded cells without insert were used as negative and positive controls, respectively. When indicated, a polyclonal anti-S100B antibody (DakoCytomation) or polyclonal anti-RAGE antibody (100 nM) was added to the cells at the time point of seeding into wells. The polyclonal anti-RAGE antibody consisted of an equimolar mixture of anti-V, anti-C1 and anti-C2 antibodies as described in our previous publications [34,35].

N C O

236 237

70–80% confluency, Alamar Blue (1/10 dilution, Nalgene) was added to the wells and the plate was further incubated for 3 h or 4 h at 37 °C. The reduced form of Alamar Blue was detected by fluorescence spectroscopy (Ex: 540 nm; Em: 590 nm) [33] and corrected for the fluorescence emission of AB in the cell culture medium only. The experiments were performed in triplicate.

U

234 235

269

R O

4

226 Q15 The cells were seeded (4 × 10 cells/well) in 24 well plates and 227 incubated in Opti-MEM as described above. When the cells reached

233

2.8. NF-κB assay

P

2.7. Cell assays

231 232

264 265

D

224

229 230

2.7.5. Wound healing assay The cells were seeded in 96 well plates and incubated until reaching 90% to 100% confluence. A wound was performed using the tip of sterile P10 pipet tip. The wells were imaged at the indicated time points using a CCD camera attached to an Olympus Fluoview microscope.

F

and phospho-p44/42 (#9101, Thr202/Tyr204) were all from Cell Signaling (Danvers, MA). Antibodies against p53 (sc-47698) and Dia-1 203 (sc-373807) were from Santa-Cruz Biotechnology (Dallas, TX). Anti204 S100B (#Z0311) was from DakoCytomation (Denmark) and anti205 S100A10 (#ab52272) was from Abcam (Cambridge, MA). The cyclin E 206 antibody (#630701) was from BioLegend (San Diego, CA). Rabbit sera 207 directed against S100A2, A6 and A4 were generous gifts from Prof. 208 Heizmann (Children's Hospital, Zurich, Switzerland). The blots were 209 developed using a chemoluminescent substrate (Pierce ECL Western 210 Blotting Substrate, Thermo Scientific). The blots were scanned and the 211 intensities of the scanned bands were determined using the ImageJ soft212 ware [32]. Following the staining for S100 proteins, p53 and cyclin E, the 213 blots were stripped using standard conditions, which consisted of 45 214 min incubation at 50 °C in the presence of 200 mM glycine buffer at 215 pH 2.2, and re-stained for actin. For the staining of AKT/P-AKT, JNK, p216 Q14 JNK, and ERK/p-ERK, the blots were first stained with the antibodies 217 recognizing the phosphorylated form of the proteins and, when indi218 cated in the figure legend, the blot was stripped and re-stained with 219 the antibody recognizing the total forms (phosphorylated and non220 phosphorylated) of the protein. Alternatively, samples from the same 221 cellular extracts were loaded onto different wells of SDS-PAGE gels. 222 After electroblotting, the blot was cut into parts that were used for 223 separate Western blot analysis.

228

3

2.7.3. Invasion assay The assay was performed similarly to the migration assay with the exception that the insert filters were coated with a solution of bovine collagen I (Santa Cruz Biotechnology, Santa Cruz, CA) prior to the addition of the cells. The migration and invasion experiments were performed in triplicate. 2.7.4. Soft agar colony formation assay Cell suspensions (1 × 104 cells/well) were mixed (1:1) with 1.4% agarose in Opti-MEM containing 8% FBS and added on top of the wells containing solidified 1% agarose. After solidification of the soft agarose, the cell culture medium (Opti-MEM containing 4% FBS) was added to the wells. The plate was then incubated for 4 to 5 weeks at 37 °C and fresh medium was added to the plate every 3 to 4 days. The colonies

266 267 Q16 268

271 272 273 274 275 276 277 278 279 280 281 282 283 284

The migration and invasion assays were replicated at least three times using 6 wells for each condition. All other experiments were also performed in duplicate or triplicate, as indicated. The mean ± standard deviation is reported. Statistical significances between groups were determined using the Student's t-test or one-way ANOVA using Bonferroni Post-Hoc test.

285 286

3. Results

291

287 288 289 290

3.1. Overexpression of RAGE in WM115 cells and characterization of the 292 transfected cell lines 293 To determine the effect of RAGE up-regulation in melanoma cells, we stably transfected the WM115 melanoma cell line with a vector coding for full-length RAGE. WM115 cells stably transfected with the empty vector (WM115-MOCK) were used as negative control. To characterize the transfected cells, we determined the levels of RAGE mRNA and protein by RT-PCR and ELISA, respectively. From two independent transfection procedures, we selected two clones WM115-RAGE and WM115RAGE-I, which overexpressed RAGE, at the protein levels, 94-fold and 7-fold, respectively, when compared to the WM115-MOCK controls. WM115-MOCK cells expressed 11.5 ± 0.1 pg RAGE per mg of total protein and WM115-RAGE cells expressed 1081.3 ± 53.0 pg RAGE per mg total protein (Fig. 1A). The second transfected cell line WM115-RAGE-I expressed 81.0 ± 2.0 pg RAGE per mg total protein. The expression of RAGE at the protein level reflected the levels of transcripts that were determined by RT-PCR. We also measured the level of RAGE in WM-266 cells. This cell-line (WM266) originates from the same patient as the WM115, but was established from a metastatic tumor [36]. RAGE protein levels in WM266-MOCK were 2.4 higher than in WM115-MOCK cells and were equal to 24.4 (±5.4) pg per mg of protein. To ensure that in the transfected cells RAGE was properly processed and exported to the cell surface, we measured the binding of anti-RAGE antibodies to cell surface RAGE by flow cytometry (Fig. 1B). We found that the antibodies bound to larger numbers of RAGE receptors in RAGE overexpressing cells than in control cells.

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

P

Fig. 1. A) Levels of RAGE in RAGE transfected WM115 cells as determined by ELISA. Levels are expressed in pg RAGE protein per mg of total protein. WM115-RAGE and WM115-RAGE-I expressed 94 fold and 7 fold higher RAGE protein than the MOCK control cells, respectively. B) Binding of the anti-RAGE antibody MAB1145 to WM115-RAGE (filled circles) and WM115MOCK (filled squares) measured by flow cytometry. The binding curve of MAB1145 to WM115-RAGE was fitted using a 1:1 binding model and showed an affinity of 1.5 (±0.3) nM. RAGE overexpressed in the melanoma cells is properly processed and translocated to the cell-surface, as demonstrated by their recognition by specific antibodies. The experiment was performed in triplicate and the standard deviation is indicated. C–F) Morphology of WM115-MOCK (C), WM115-RAGE-I (D), WM115-RAGE (E) and WM266-MOCK (F) by bright field microscopy. G–H) Differences in morphology between WM115-MOCK (G) and WM115-RAGE (H) transfected cells, as shown by actin staining. Actin was stained with PE conjugated phalloidin and the nuclei were stained with Hoechst 33342. (20× magnification).

319 320 321

3.2. RAGE overexpression is accompanied with changes in cell morphology and actin remodeling

346

3.3. RAGE overexpression causes changes in cell proliferation and migration

347 348

In order to determine the effect of RAGE overexpression on the cellular behavior of the WM115 melanoma cells, we compared the proliferation and migration properties of these cells compared to MOCK

331 332 333 334 335 336 337 338 339 340 341 342 343 344

349

E

R

R

O

329 330

C

327 328

N

325 326

U

323 324

C

345

We observed large differences in morphologies between the WM115-MOCK, WM115-RAGE-I and WM115-RAGE cell lines. Whereas the WM115-MOCK cells presented the classical epithelial morphology as previously described for this cell line (Fig. 1C) [37,38], the RAGE transfected cells showed a more elongated morphology resembling that of fibroblasts (Fig. 1E). We also measured the length and width of the cells and found that the ratio (R) of the length over the width was significantly larger (p b 0.001) in RAGE transfected cells than in MOCK control cells (RMOCK = 1.77 ± 0.68 versus RRAGE = 9.85 ± 3.8). Interestingly, the WM115-RAGE-I cells that expressed RAGE at an intermediate level also showed an “intermediate” morphology between those of WM115-MOCK and WM115-RAGE (Fig. 1D). We also compared the morphologies of WM115-RAGE and WM266-MOCK, the “sister” cell line of WM115 [36]. We observed that WM266-MOCK presented similar elongated shape than WM115-RAGE (Fig. 1F). Since the architecture of cells is under the control of actin filaments, we also investigated the distribution of F-actin filaments in the transfected cells by fluorescence microscopy, using sulforhodamine conjugated phalloidin. We observed differences in organization of the actin filaments between the two cell lines. In the WM115-MOCK cells, many structures resembled short cortical bundles (Fig. 1G), these structures appeared to be absent in the WM115-RAGE cells (Fig. 1H). Instead in the RAGE-overexpressing cells, longer parallel fibers were observed as well as structures that resemble collapsed F-actin (Fig. 1H). These changes in actin organization resemble the changes occurring during the epithelial mesenchymal transition (EMT) of cancer cells [39,40].

322

controls. To our surprise, we did not observe an increase but rather a significant 30% decrease in cellular proliferation in the WM115-RAGE cells compared to the MOCK cells (Fig. 2). We tested several metastatic properties of the transfected cells and as a first step, we studied the growth of the cells in the absence of support or anchor, a phenomenon which is also referred as anoikis [41–44]. In these conditions, we observed that the WM115-RAGE cells formed a significantly larger number of colonies (19 ± 5 colonies; p b 0.01) than the WM115-MOCK cells (7 ± 3 colonies) (Fig. 3A, B). We next compared the migration properties of the melanoma cells using standard Boyden chamber assays. We found that after 24 h, a significantly larger number of WM115-RAGE cells had migrated through the filter (33 ± 4.5%; p b 0.01) compared to the WM115-MOCK cells (14 ± 1.9%) (Fig. 4A). We also observed that the percentage of migrated WM115-RAGE cells was not significantly different from the percentage of migrated WM266-MOCK cells (27.9 ± 4.2%).

T

318

E

D

Q2

R O

O

F

4

Fig. 2. Comparison of the cellular proliferation of WM115-MOCK and WM115-RAGE cells using Alamar Blue. Excitation was performed at 540 nm and the fluorescence emission was recorded at 590 nm. The experiment was performed at least three times with 4–6 replicates each time.

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365

5

394

3.4. RAGE overexpression is accompanied with the up-regulation of S100B

395

Since we showed that the RAGE overexpressing cells acquired several metastatic properties, our next goal was to interrogate the levels of RAGE ligands in the transfected cells. We chose to compare the levels of several S100 proteins that are relevant to melanoma and therefore measured the levels of S100A2, S100A4, S100A6, S100A10 and S100B in cell extracts of the different cell-lines. Among those S100 proteins,

376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392

396 397 398 399 400

C

E

R

374 375

R

372 373

N C O

370 371

U

368 369

T

393

We also investigated whether the migration abilities of the WM115 cells correlated with the level of RAGE in these cells. We indeed observed that the WM115-RAGE-I cells migrated to a level (19 ± 3.2%) that was intermediate between that of the WM115-MOCK cells (14 ± 1.9%) and that of the WM115-RAGE cells (33 ± 4.5%), the difference of percentage of migrated cells being statistically significant between the three groups (p b 0.05) (Fig. 4A). In addition, we investigated the invasion properties of these cells and observed that a significantly larger number of WM115-RAGE cells had invaded collagen-coated filters (18.5% ± 1%, p b 0.05) than the WM115-MOCK cells (8% ± 4.5%) (Fig. 4B). To complement our findings, we compared the migration abilities of the melanoma cells after the formation of a wound on a layer of confluent cells (Fig. 5). In agreement with the Boyden chamber assay results, we observed that the WM115-RAGE cells (Fig. 5, lower row) recovered the wounded area significantly faster than the MOCK control cells (Fig. 5, upper row). To further support our hypothesis that RAGE overexpression in the WM115 cell line was responsible for the observed changes in cellular migration, we tested whether RAGE suppression by siRNA in the WM115-RAGE cells could revert the increased migration. We observed that suppression of RAGE by specific siRNA significantly reduced (p b 0.05) the percentage of migrated cells from 49% ± 1% (control siRNA) to 39% ± 5% (RAGE siRNA) (Fig. 6A). The level of suppression at the protein level was measured by ELISA and showed a 3.2 fold reduction (± 1.5) after transfection with siRNA (Fig. 6B). In addition, we observed that RAGE suppression resulted in a significant (p b 0.01) increase in cellular proliferation (Fig. 6C).

D

366 367

Fig. 3. A: Soft agar assay with WM115-MOCK (a–c) and WM115-RAGE cells (d–f). Three representative fields are shown for each type of cells. The colonies were stained with crystal violet. B: Averaged number of colonies per field. Three independent experiments were performed, **p b 0.01.

E

Q3

P

R O

O

F

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

Fig. 4. A–B: Migration and invasion assays. A: Percentage of migrated cells (WM115-MOCK, Q4 WM115-RAGE, WM115-RAGE-I and WM266-MOCK). B: Percentage of invaded cells (WM115-MOCK, WM115-RAGE-I and WM115-RAGE). Alamar blue was used to determine the percentage of migrated and invaded cells. The mean values of three independent experiments performed in triplicates are indicated with their standard deviations (*p b 0.05; **p b 0.01).

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

R O

O

F

6

414 415 416 417 418 419 420 421 422 423

D

E

424 425 426 427

3.5. Overexpression of RAGE results in decreased levels of the tumor 428 suppressor p53 and cyclin E 429

T

C

E

412 413

R

411

R

409 410

O

407 408

C

405 406

of either WM115-MOCK or WM115-RAGE cells after treatment with polyclonal anti-RAGE antibodies (data not shown), suggesting that the increase in migration of the WM115-RAGE cells occurred in a RAGEligand independent manner.

Following the observation that S100B levels were up-regulated in the WM115-RAGE cells, we next investigated the levels of possible intracellular targets of S100B relevant in cancer and melanoma. One of these targets is the tumor suppressor protein p53 and the mechanism of interaction of S100B with p53 has been well documented [28,45,46]. We observed that the level of p53 was significantly lower in the WM115RAGE cells than in the MOCK control cells, both at the transcription (2.6 ± 0.3 fold) and protein levels (1.9 ± 0.4 fold) (Fig. 9A). We also measured the levels of the cell cycle regulator cyclin E, and found significantly lower protein levels of cyclin E (4.0 ± 1.2 fold) in RAGE overexpressing cells than in MOCK controls (Fig. 9B). To further support our findings, we analyzed the level of cyclin E during the different phases of the cell cycle (G1, S and G2/M) by flow cytometry. Our data shows that cyclin E was significantly reduced (p b 0.01) in all phases of the cell cycle (Fig. 9C).

N

403 404

we could only detect significant changes in S100B levels. S100B mRNA levels in WM115-RAGE cells were (4.6 ± 0.7) higher than in the control WM115-MOCK cells. At the protein level, S100B levels were also significantly higher in WM115-RAGE cells than in WM115-MOCK cells as determined by Western blot (2.5 ± 0.7) and ELISA (2.7 ± 1.4) (Fig. 7). In addition, we found that WM115-RAGE cells secreted higher levels of S100B in the media (8.2 ± 1.5 fold) than the WM115-MOCK cells (Fig. 7B). Interestingly, suppression of RAGE by siRNA in the WM115-RAGE cells did not result in a significant reduction in the levels of intracellular S100B protein (data not shown). To test the hypothesis that S100B participates in the increased migration of WM115-RAGE cells, we compared the migration of these cells after suppressing extracellular RAGE/S100B interaction with anti-S100B antibodies (DakoCytomation) or suppressing intracellular S100B using siRNA (Fig. 8). S100B suppression by siRNA resulted in a 8.5 (±3.3) fold decrease in S100B transcript levels. We observed no changes in migration in the WM115-RAGE cells after treatment with either S100B antibodies or S100B specific siRNA suggesting that the changes in migration in the WM115-RAGE cells occurred in a S100B independent manner (Fig. 8). To test the hypothesis that other RAGE ligands might stimulate the migration of the WM115RAGE cells, we compared the migration of these cells after treatment with anti-RAGE antibodies. We could not detect changes in migration

U

401 402

P

Fig. 5. Wound healing assay. Top row: Assay with WM115-MOCK cells. Bottom row: Assay with WM115-RAGE cells. After wounding the confluent cells with a pipet tip, the RAGE transfected cells (bottom row) recovered the wounded area faster than the MOCK transfected cells (top row). Three independent experiments were performed and show similar results. The figure shows a representative experiment. The pictures of the wounded area were taken at t = 0 h; t = 14 h and t = 24 h.

Fig. 6. Effect of RAGE blockage by siRNA on cellular migration and proliferation of WM115-RAGE cells. A) Migration of WM115-RAGE following transfection with control and RAGE specific siRNA. B) Protein RAGE levels following suppression with RAGE siRNA. C) Changes in cellular proliferation of WM115-RAGE following transfection with control and RAGE specific siRNA.

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

430 431 432 433 434 435 436 437 438 439 440 441 442 443 444

7

R O

O

F

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

E

D

P

Fig. 9. A. Levels of p53 protein in WM115-MOCK and WM115-RAGE as determined by Western blot. Antibodies against β-actin were used as loading control, in the same lanes that were used for p53 staining. B. Levels of cyclin E in cell lysates of WM115-MOCK and WM115-RAGE as determined by Western blot. Antibodies against β-actin were used for the loading control and the actin staining was performed on the same lanes that were used for the cyclin E staining. C. Level of cyclin E in the different phases G1, S and G2/M of the cell cycle. PI was used to gate the cells according to cell cycle phases. A FITClabeled secondary antibody was used to detect bound anti-cyclin E.

N C O

R

Fig. 7. A. Detection of S100B, S100A6 and S100A10 in cell lysates by Western blot. Three independent cell lysates were prepared and analyzed. The figure shows the representative blot of one cell lysate. The detection of actin was performed using the same lanes that were used for the detection of S100 proteins. B. Detection of S100B in cell lysates and supernatant as determined by ELISA.

The transcription factor NF-κB has been shown to promote multiple processes in cancer such as proliferation, invasion, metastasis, angiogenesis, and chemo- and radioresistance [47–49]. We hence determined whether RAGE overexpression influenced the activity of NF-κB. For this purpose, we transfected both WM115-MOCK and WM115-RAGE with a luciferase/NF-κB reporter system and observed that the basal activity of NF-κB was significantly reduced in the RAGEtransfected cells and was only 37% of the level in the control cells (Fig. 10A).

U

Q5

R

E

C

T

3.6. Overexpression of RAGE is accompanied by a decrease in NF-κB activity 445

Fig. 8. Effect of S100B blockage by siRNA and RAGE/S100B interaction by anti-RAGE antibodies on the migration of WM115-RAGE cells. Following transfection with S100B siRNA, RAGE levels were decreased by 8.5 fold (±3.3) as determined by RT-PCR. Ctrl (siRNA) indicates that the cells were transfected with a negative control siRNA.

Fig. 10. A. Activity of NF-kB in WM115-MOCK and WM115-RAGE cells. The activity of NF-kB was determined using a luciferase/NF-kB reporter system. B. Detection of AKT, ERK1/2 and SAPK/JNK in cell lysates by Western blot. Three independent cell lysates were prepared and analyzed. The intensities of the bands corresponding to the non-phosphorylated and phosphorylated forms of each kinase (AKT, p-AKT; SAPK/JNK, p-SAPK/JNK and ERK1/2, p-ERK1/2) were compared by densitometric analysis. The figure shows a representative blot of cell lysates. The same cellular extract was loaded onto different wells of the gel and blotted. After electroblotting, the blot was cut into two parts and each part was stained either for the total forms of AKT, JNK and ERK1/2 or for the phosphorylated forms of the proteins.

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

446 447 448 Q17 449 450 451 452 453 454

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

4. Discussion

460 461 462

465

The mechanisms by which RAGE contributes to cancer are not clear and may differ between cancer types [20–22]. Indeed, although RAGE up-regulation correlates with increased cellular proliferation and 468 migration in many cancers (colon, gastric, breast, pancreatic and liver 469 cancer) [12–17], it is the down-regulation of RAGE that correlates 470 with increased proliferation and migration in lung carcinomas and 471 rhabdomyosarcoma [18,19]. 472 We previously showed that RAGE transcript levels varied greatly 473 among stage III and IV melanoma tumor samples, suggesting that the 474 role of RAGE in melanoma may be tumor specific [23]. To better under475 stand the function of RAGE in melanoma progression, we chose to com476 pare the proliferation and migration properties of the WM115 primary 477 melanoma cell line following overexpression of RAGE. We chose the 478 WM115 cell line because i) it was established from a primary tumor 479 of a melanoma patient, ii) it has low basal levels of RAGE expression 480 Q18 and iii) the metastatic cell line WM266, which was established from 481 the same patient, was also available. Therefore, we were able to 482 compare the metastatic properties of the WM115 cell line, after RAGE 483 overexpression, to those of the sister metastatic cell line WM266. 484 We first observed that RAGE overexpression in WM115 cells result485 ed in changes in both cell morphology and actin remodeling, resembling 486 the epithelial to mesenchymal transition (EMT) characteristic of meta487 static cells [39]. In addition to the change in cell morphology and the 488 increase in cell ellipticity (Fig. 1), we noticed that the nuclei of the 489 RAGE overexpressing cells were also notably more elongated than 490 those of the control MOCK cells. As observed with the cells, comparison 491 of the ratio (R) of the length over width of the nuclei showed a signifi492 cant (p b 0.001) difference in ellipticity between the two cell lines. 493 (RNuclei-MOCK = 1.4 ± 0.3 versus RNuclei-RAGE = 1.8 ± 0.5). Studies 494 have shown that the nuclear shape is tightly regulated by the cell mor495 phology and that the nuclear morphology could reflect changes in cell 496 health [50,51]. In addition, defects in nuclear shape are also used in clin497 ical settings as markers of disease [51]. The changes in nuclear shape 498 that we observed following RAGE overexpression are thus consistent 499 with the observed changes in cell morphology and the accompanied 500 changes in cellular proliferation and migration properties. We also ob501 served that RAGE overexpression increased significantly the mobility 502 of the melanoma cells in all assays used by us, i.e. migration, invasion, 503 anchorage independent colony formation and wound healing assays 504 (Figs. 3 and 5). It thus appears that high levels of RAGE confer 505 the WM115 cells a metastatic phenotype by inducing an epithelial– 506 mesenchymal like transition. Our results are in agreement with earlier 507 studies by Huttunen et al. who showed that B16 mouse melanoma 508 cells overexpressing full-length RAGE produced a larger number of me509 tastases than the B16 cells overexpressing a signaling incompetent form 510 of RAGE that lacked the intracellular signaling domain [52]. Although 511 RAGE overexpression in WM115 cells correlated with increased migra512 tion properties, other genes and proteins are involved in this complex 513 process as demonstrated by many studies aiming at identifying meta514 static melanoma gene expression signatures [53–56]. Indeed, we ob515 served that in our experimental conditions, the WM266-MOCK cells 516 had similar migration properties to the WM115-RAGE cells. However, 517 in the WM266-MOCK cells, the level of RAGE is only 2.4 fold higher

U

N

C

O

R

R

E

C

T

466 467

F

464

458 459

O

463

We next analyzed the activity of several signaling kinases that are relevant in cancer and melanoma and we investigated the levels of ERK1/2, AKT and JNK/SAPK in cell extracts. We observed a 1.8 (±0.5) fold reduction of the levels of phosphorylated ERK1/2 in WM115RAGE cells compared to the control cells (Fig. 10B). However, we did not observe differences in phosphorylated Akt or JNK between the two cell lines (Fig. 10B).

R O

457

than in WM115-MOCK cells (24.4 ± 5.4 pg RAGE per mg of protein versus 11.5 + 0.1 pg RAGE per mg of total protein, respectively). Our results demonstrate that overexpression of RAGE was sufficient to induce metastatic properties in the WM115 cell line, however, the WM266 cell line displays a metastatic phenotype despite only minimal increase in RAGE expression, suggesting that other genes are also involved in this process. RAGE overexpression also resulted in decreased proliferation abilities of the cells, suggesting that RAGE triggered a phenomenon described as the metastatic switch, where the migration properties of cells are increased at the expenses of the proliferative capabilities of the cells [26]. The observed reduction in cell proliferation in RAGE overexpressing cells correlated with a decrease in levels of cyclin E in all cell cycle phases (Fig. 9C). Cyclin E can regulate cell proliferation by cyclin dependent kinase 2 (cdk2) dependent and independent processes resulting in cell cycle progression [57]. Overexpression of cyclin E has been previously observed in WM115 melanoma cells and was associated with the hyper-proliferative nature of this cell line [58]. To demonstrate that RAGE overexpression correlated to reduced cellular proliferation of the WM115 cells, we investigated if these effects were reversible, using specific RAGE siRNA. We observed that suppression of RAGE resulted in a significant (p b 0.01) increase in cellular proliferation (Fig. 6C), supporting our hypothesis that in melanoma cells, RAGE overexpression can control the metastatic switch. One of the current prognostic markers for metastatic melanoma patients is S100B [27–29]. We show here that the WM115-RAGE cells express and release significantly larger amounts of S100B than the control cells. This finding is another indication that the WM115-RAGE cells have developed metastatic features and led us to investigate the level of the tumor suppressor p53, which is expressed as wild type in WM115 cells [59]. We observed lower levels of p53 in the WM115-RAGE cells than in control cells, in agreement with earlier studies that showed that S100B down-regulates p53 in melanoma cells [60–62]. Interestingly, a recent study has shown that p53 deficiency in the A375P metastatic melanoma cells resulted in increased migration and invasion of these cells and is in line with our results [63]. Downstream RAGE signaling is complex and not yet fully understood. Several intracellular proteins such as ERK1/2, Diaphanous-1 (Dia-1), TIRAP and MyD88, have been suggested to play the role of adaptor proteins of RAGE [64–66]. While Dia-1 was shown to promote cellular migration of C6 glioma through the activation of Rac-1 and cdc42 [65], it is not known if this interaction is relevant in melanoma cells. Sakagushi et al. recently described that they could not immunoprecipitate Dia-1 from HEK-293 cells overexpressing RAGE [66]. To test a possible effect of RAGE overexpression on Dia-1, we measured Dia-1 protein levels in cell lysates of WM115-MOCK and WM115RAGE cells. Western blot analysis did not reveal differences in Dia-1 expression levels between the two cell lines (data not shown). The activation of the Ras/BRAF/ERK signaling pathways is a central mechanism leading to cell proliferation and survival and promoting anchorage independent growth, migration and invasion [41,67–71]. In melanoma, the Ras/RAF/ERK signaling pathway is constitutively activated in more than 60% of melanoma cells, including WM115 and WM266 cells, due to gain of function mutations in B-RAF (BRAFV600E) [72–74]. Our analysis of signaling pathways that modulated upon overexpression of RAGE showed a significant decrease in the phosphorylated form of ERK1/2. We propose that the decrease of ERK1/2 activity reflects the decrease in proliferation of WM115-RAGE cells. Interestingly, a decrease in phosphorylated levels of ERK1/2 also correlated with a decrease in cellular proliferation in MC3T3-E1 osteoblast cells overexpressing RAGE [75]. In melanoma, cellular proliferation is also under the control of PI3K/ AKT [76,77]. In our experimental conditions, we could not detect changes in activity of the AKT kinase, suggesting that the PI3K/AKT pathway is not involved in the changes of proliferation or migration observed when RAGE is overexpressed. Since JNK has also been shown to be activated in melanoma, at times through ERK signaling, we also determined the

P

3.7. Overexpression of RAGE is accompanied by a decrease in ERK1/2 phosphorylation

D

455 456

E

8

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 Q19 573 574 575 576 577 578 579 580 581 582 583

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

levels of activated JNK in the two cell lines but could not find significant changes in the WM115-RAGE cells compared to the control cells [78]. 586 These data suggest that RAGE overexpression modulates the ERK path587 ways without affecting the JNK and AKT pathways. 588 The observed increases in migration, invasion and anchorage 589 independent cellular proliferation of melanoma cells occurred in the 590 absence of exogenous ligand and correlated with the level of RAGE ex591 pression. Recent evidence strongly suggests that RAGE oligomerization 592 is required for activation of the receptor [79–86], and for example, it 593 has been shown that on the surface of HEK293 and HeLa cells, RAGE 594 exists as constitutive dimers [87,88] and that oligomerization of the 595 receptor could be further enhanced following stimulation with S100B 596 or AGEs [88]. We propose that when overexpressed in the melanoma 597 WM115 cells, RAGE spontaneously forms higher order oligomers 598 which are sufficient to trigger RAGE signaling. In this case, RAGE oligo599 merization could thus result in ligand-independent RAGE activation. 600 This hypothesis is also supported by our observation that the anti-RAGE 601 antibodies, used in this study, were not able to suppress increases in cel602 lular migration whereas treatment of the cells with RAGE targeting siRNA 603 did reduce cellular migration. RAGE oligomerization is currently an active 604 area of research and several mechanisms of oligomerization-dependent 605 RAGE activation have been proposed: RAGE oligomerization could occur 606 either through the V domains [84], C1 domains [84,89] or the C2 domains 607 of the receptor [85,86] in a ligand dependent manner [85]. We propose 608 here that RAGE oligomerization could also be a means for RAGE to 609 generate intracellular signaling in the absence of interaction with its li610 gands. Although ligand-induced receptor oligomerization is a common 611 mechanism of signaling, as observed with the epithelial growth factor re612 ceptor [90], several studies have also reported ligand-independent recep613 tor signaling caused by receptor oligomerization [91–93]. For example, 614 overexpression of CD30 was found to be sufficient to mediate signaling 615 in Hodgkin–Reed–Sternberg cells through oligomerization of the receptor 616 [92]. RAGE could therefore represent a new paradigm of receptor that 617 Q20 exhibits ligand-independent activation through receptor oligomerization. 618 Further studies would be necessary to elucidate the mechanisms of RAGE 619 oligomerization in the RAGE overexpressing melanoma cells. 620 In conclusion, our data support the hypothesis that RAGE up621 regulation in primary melanoma cells triggers a metastatic switch 622 with increase migration and reduced proliferation. Our data also suggest 623 that RAGE overexpression can lead to ligand independent RAGE activa624 tion, possibly through oligomerization of the receptor. We will further 625 investigate the mechanisms of ligand independent RAGE activation in 626 model cells.

O

R O

P

D

E

T

C

E

R

R

628 629

N C O

627 Q21 Conflict of interest

The authors have no conflict of interest. Acknowledgements

U

Q23630 Q22 The authors thank the ND-EPSCoR program and the Department of 631 Pharmaceutical Sciences and the College of Pharmacy, Nursing and

637 638

Allied Sciences for financial support. This work was in part supported by the NDSU Advance FORWARD program sponsored by NSF HRD0811239 and ND-EPSCoR through NSF grant #EPS-081442, and by the Infrastructure Improvement Program-Doctoral Dissertation Assistantship accorded to V.M. The authors also would like to thank Dr. Pawel Piotr Borowicz from the Department of Animal Sciences at NDSU for his help with the fluorescence microscopy images.

639

References

632 633 634 635 636

640 641 642 643

[1] J. Brett, A.M. Schmidt, S.D. Yan, Y.S. Zou, E. Weidman, D. Pinsky, R. Nowygrod, M. Neeper, C. Przysiecki, A. Shaw, et al., Survey of the distribution of a newly characterized receptor for advanced glycation end products in tissues, Am. J. Pathol. 143 (1993) 1699–1712.

[2] A.M. Schmidt, S.D. Yan, S.F. Yan, D.M. Stern, The biology of the receptor for advanced glycation end products and its ligands, Biochim. Biophys. Acta 1498 (2000) 99–111. [3] A.M. Schmidt, M. Vianna, M. Gerlach, J. Brett, J. Ryan, J. Kao, C. Esposito, H. Hegarty, W. Hurley, M. Clauss, et al., Isolation and characterization of two binding proteins for advanced glycosylation end products from bovine lung which are present on the endothelial cell surface, J. Biol. Chem. 267 (1992) 14987–14997. [4] M. Neeper, A.M. Schmidt, J. Brett, S.D. Yan, F. Wang, Y.C. Pan, K. Elliston, D. Stern, A. Shaw, Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins, J. Biol. Chem. 267 (1992) 14998–15004. [5] H.J. Huttunen, H. Rauvala, Amphoterin as an extracellular regulator of cell motility: from discovery to disease, J. Intern. Med. 255 (2004) 351–366. [6] A.M. Schmidt, M. Hasu, D. Popov, J.H. Zhang, J. Chen, S.D. Yan, J. Brett, R. Cao, K. Kuwabara, G. Costache, et al., Receptor for advanced glycation end products (AGEs) has a central role in vessel wall interactions and gene activation in response to circulating AGE proteins, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 8807–8811. [7] P. Alexiou, M. Chatzopoulou, K. Pegklidou, V.J. Demopoulos, RAGE: a multi-ligand receptor unveiling novel insights in health and disease, Curr. Med. Chem. 17 (2010) 2232–2252. [8] L.G. Bucciarelli, R. Ananthakrishnan, Y.C. Hwang, M. Kaneko, F. Song, D.R. Sell, C. Strauch, V.M. Monnier, S.F. Yan, A.M. Schmidt, R. Ramasamy, RAGE and modulation of ischemic injury in the diabetic myocardium, Diabetes 57 (2008) 1941–1951. [9] S. Crunkhorn, Neurodegenerative disease: taming the RAGE of Alzheimer's disease, Nat. Rev. Drug Discov. 11 (2012) 351. [10] R. Ramasamy, A.M. Schmidt, Receptor for advanced glycation end products (RAGE) and implications for the pathophysiology of heart failure, Curr. Heart Fail. Rep. 9 (2012) 107–116. [11] T. Chavakis, A. Bierhaus, N. Al-Fakhri, D. Schneider, S. Witte, T. Linn, M. Nagashima, J. Morser, B. Arnold, K.T. Preissner, P.P. Nawroth, The pattern recognition receptor (RAGE) is a counterreceptor for leukocyte integrins: a novel pathway for inflammatory cell recruitment, J. Exp. Med. 198 (2003) 1507–1515. [12] H.L. Hsieh, B.W. Schafer, N. Sasaki, C.W. Heizmann, Expression analysis of S100 proteins and RAGE in human tumors using tissue microarrays, Biochem. Biophys. Res. Commun. 307 (2003) 375–381. [13] H. Kuniyasu, Y. Chihara, H. Kondo, Differential effects between amphoterin and advanced glycation end products on colon cancer cells, Int. J. Cancer 104 (2003) 722–727. [14] H. Kuniyasu, N. Oue, A. Wakikawa, H. Shigeishi, N. Matsutani, K. Kuraoka, R. Ito, H. Yokozaki, W. Yasui, Expression of receptors for advanced glycation end-products (RAGE) is closely associated with the invasive and metastatic activity of gastric cancer, J. Pathol. 196 (2002) 163–170. [15] R. Kang, T. Loux, D. Tang, N.E. Schapiro, P. Vernon, K.M. Livesey, A. Krasinskas, M.T. Lotze, H.J. Zeh III, The expression of the receptor for advanced glycation endproducts (RAGE) is permissive for early pancreatic neoplasia, Proc. Natl. Acad. Sci. U. S. A. 109 (2012) 7031–7036. [16] A.M. Radia, A.M. Yaser, X. Ma, J. Zhang, C. Yang, Q. Dong, P. Rong, B. Ye, S. Liu, W. Wang, Specific siRNA targeting receptor for advanced glycation end products (RAGE) decreases proliferation in human breast cancer cell lines, Int. J. Mol. Sci. 14 (2013) 7959–7978. [17] A.M. Yaser, Y. Huang, R.R. Zhou, G.S. Hu, M.F. Xiao, Z.B. Huang, C.J. Duan, W. Tian, D.L. Tang, X.G. Fan, The role of receptor for advanced glycation end products (RAGE) in the proliferation of hepatocellular carcinoma, Int. J. Mol. Sci. 13 (2012) 5982–5997. [18] B. Bartling, N. Demling, R.E. Silber, A. Simm, Proliferative stimulus of lung fibroblasts on lung cancer cells is impaired by the receptor for advanced glycation endproducts, Am. J. Respir. Cell Mol. Biol. 34 (2006) 83–91. [19] F. Riuzzi, G. Sorci, R. Donato, RAGE expression in rhabdomyosarcoma cells results in myogenic differentiation and reduced proliferation, migration, invasiveness, and tumor growth, Am. J. Pathol. 171 (2007) 947–961. [20] C.D. Logsdon, M.K. Fuentes, E.H. Huang, T. Arumugam, RAGE and RAGE ligands in cancer, Curr. Mol. Med. 7 (2007) 777–789. [21] A. Riehl, J. Nemeth, P. Angel, J. Hess, The receptor RAGE: bridging inflammation and cancer, Cell Commun. Signal. 7 (2009) 12. [22] L.J. Sparvero, D. Asafu-Adjei, R. Kang, D. Tang, N. Amin, J. Im, R. Rutledge, B. Lin, A.A. Amoscato, H.J. Zeh, M.T. Lotze, RAGE (receptor for advanced glycation endproducts), RAGE ligands, and their role in cancer and inflammation, J. Transl. Med. 7 (2009) 17. [23] E. Leclerc, C.W. Heizmann, S.W. Vetter, RAGE and S100 protein transcription levels are highly variable in human melanoma tumors and cells, Gen. Physiol. Biophys. 28 (2009) F65–F75 (Spec No Focus). [24] R. Abe, T. Shimizu, H. Sugawara, H. Watanabe, H. Nakamura, H. Choei, N. Sasaki, S. Yamagishi, M. Takeuchi, H. Shimizu, Regulation of human melanoma growth and metastasis by AGE–AGE receptor interactions, J. Invest. Dermatol. 122 (2004) 461–467. [25] A. Saha, Y.C. Lee, Z.J. Zhang, G. Chandra, S.B. Su, A.B. Mukherjee, Lack of an endogenous anti-inflammatory protein in mice enhances colonization of B16F10 melanoma cells in the lungs, J. Biol. Chem. 285 (2010) 10822–10831. [26] K.S. Hoek, O.M. Eichhoff, N.C. Schlegel, U. Dobbeling, N. Kobert, L. Schaerer, S. Hemmi, R. Dummer, In vivo switching of human melanoma cells between proliferative and invasive states, Cancer Res. 68 (2008) 650–656. [27] R. Harpio, R. Einarsson, S100 proteins as cancer biomarkers with focus on S100B in malignant melanoma, Clin. Biochem. 37 (2004) 512–518. [28] R. Donato, S100B's double life: intracellular and extracellular signal, Biochem. Biophys. Acta Mol. Cell Res. (2014) (in press). [29] S. Kruijff, H.J. Hoekstra, The current status of S-100B as a biomarker in melanoma, Eur. J. Surg. Oncol. 38 (2012) 281–285. [30] Z. Darzynkiewicz, G. Juan, E. Bedner, Determining cell cycle stages by flow cytometry, Curr. Protoc. Cell Biol. 8 (1999) 1–18. [31] S.P. Smith, K.R. Barber, S.D. Dunn, G.S. Shaw, Structural influence of cation binding to recombinant human brain S100b: evidence for calcium-induced exposure of a hydrophobic surface, Biochemistry 35 (1996) 8805–8814.

F

584 585

9

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 Q24 722 723 724 725 726 727 728 729

D

P

R O

O

F

[63] G. Gadea, M. de Toledo, C. Anguille, P. Roux, Loss of p53 promotes RhoA–ROCKdependent cell migration and invasion in 3D matrices, J. Cell Biol. 178 (2007) 23–30. [64] K. Ishihara, K. Tsutsumi, S. Kawane, M. Nakajima, T. Kasaoka, The receptor for advanced glycation end-products (RAGE) directly binds to ERK by a D-domainlike docking site, FEBS Lett. 550 (2003) 107–113. [65] B.I. Hudson, A.Z. Kalea, M. Del Mar Arriero, E. Harja, E. Boulanger, V. D'Agati, A.M. Schmidt, Interaction of the RAGE cytoplasmic domain with diaphanous-1 is required for ligand-stimulated cellular migration through activation of Rac1 and Cdc42, J. Biol. Chem. 283 (2008) 34457–34468. [66] M. Sakaguchi, H. Murata, K. Yamamoto, T. Ono, Y. Sakaguchi, A. Motoyama, T. Hibino, K. Kataoka, N.H. Huh, TIRAP, an adaptor protein for TLR2/4, transduces a signal from RAGE phosphorylated upon ligand binding, PLoS One 6 (2011) e23132. [67] T.M. Becker, S. Philipsz, L.L. Scurr, C. Fung, S. Haferkamp, R.F. Kefford, H. Rizos, Oncogenic B-RAF(V600E) promotes anchorage-independent survival of human melanocytes, J. Invest. Dermatol. 130 (2010) 2144–2147. [68] R.M. Klein, L.S. Spofford, E.V. Abel, A. Ortiz, A.E. Aplin, B-RAF regulation of Rnd3 participates in actin cytoskeletal and focal adhesion organization, Mol. Biol. Cell 19 (2008) 498–508. [69] C. Kudo-Saito, H. Shirako, T. Takeuchi, Y. Kawakami, Cancer metastasis is accelerated through immunosuppression during Snail-induced EMT of cancer cells, Cancer Cell 15 (2009) 195–206. [70] S.I. Shin, V.H. Freedman, R. Risser, R. Pollack, Tumorigenicity of virus-transformed cells in nude mice is correlated specifically with anchorage independent growth in vitro, Proc. Natl. Acad. Sci. U. S. A. 72 (1975) 4435–4439. [71] C. Wellbrock, S. Rana, H. Paterson, H. Pickersgill, T. Brummelkamp, R. Marais, Oncogenic BRAF regulates melanoma proliferation through the lineage specific factor MITF, PLoS One 3 (2008) e2734. [72] H. Davies, G.R. Bignell, C. Cox, P. Stephens, S. Edkins, S. Clegg, J. Teague, H. Woffendin, M.J. Garnett, W. Bottomley, N. Davis, E. Dicks, R. Ewing, Y. Floyd, K. Gray, S. Hall, R. Hawes, J. Hughes, V. Kosmidou, A. Menzies, C. Mould, A. Parker, C. Stevens, S. Watt, S. Hooper, R. Wilson, H. Jayatilake, B.A. Gusterson, C. Cooper, J. Shipley, D. Hargrave, K. Pritchard-Jones, N. Maitland, G. Chenevix-Trench, G.J. Riggins, D.D. Bigner, G. Palmieri, A. Cossu, A. Flanagan, A. Nicholson, J.W. Ho, S.Y. Leung, S.T. Yuen, B.L. Weber, H.F. Seigler, T.L. Darrow, H. Paterson, R. Marais, C.J. Marshall, R. Wooster, M.R. Stratton, P.A. Futreal, Mutations of the BRAF gene in human cancer, Nature 417 (2002) 949–954. [73] S.R. Hingorani, M.A. Jacobetz, G.P. Robertson, M. Herlyn, D.A. Tuveson, Suppression of BRAF(V599E) in human melanoma abrogates transformation, Cancer Res. 63 (2003) 5198–5202. [74] B. Stecca, C. Mas, V. Clement, M. Zbinden, R. Correa, V. Piguet, F. Beermann, I.A.A. Ruiz, Melanomas require HEDGEHOG-GLI signaling regulated by interactions between GLI1 and the RAS–MEK/AKT pathways, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 5895–5900. [75] G. Li, J. Xu, Z. Li, Receptor for advanced glycation end products inhibits proliferation in osteoblast through suppression of Wnt, PI3K and ERK signaling, Biochem. Biophys. Res. Commun. 423 (2012) 684–689. [76] G. Palmieri, M. Capone, M.L. Ascierto, G. Gentilcore, D.F. Stroncek, M. Casula, M.C. Sini, M. Palla, N. Mozzillo, P.A. Ascierto, Main roads to melanoma, J. Transl. Med. 7 (2009) 86. [77] M.A. Davies, The role of the PI3K–AKT pathway in melanoma, Cancer J. 18 (2012) 142–147. [78] P. Lopez-Bergami, C. Huang, J.S. Goydos, D. Yip, M. Bar-Eli, M. Herlyn, K.S. Smalley, A. Mahale, A. Eroshkin, S. Aaronson, Z. Ronai, Rewired ERK–JNK signaling pathways in melanoma, Cancer Cell 11 (2007) 447–460. [79] B.M. Dattilo, G. Fritz, E. Leclerc, C.W. Kooi, C.W. Heizmann, W.J. Chazin, The extracellular region of the receptor for advanced glycation end products is composed of two independent structural units, Biochemistry 46 (2007) 6957–6970. [80] T. Ostendorp, E. Leclerc, A. Galichet, M. Koch, N. Demling, B. Weigle, C.W. Heizmann, P.M. Kroneck, G. Fritz, Structural and functional insights into RAGE activation by multimeric S100B, EMBO J. 26 (2007) 3868–3878. [81] O.V. Moroz, A.A. Antson, E.J. Dodson, H.J. Burrell, S.J. Grist, R.M. Lloyd, N.J. Maitland, G.G. Dodson, K.S. Wilson, E. Lukanidin, I.B. Bronstein, The structure of S100A12 in a hexameric form and its proposed role in receptor signalling, Acta Crystallogr. D Biol. Crystallogr. 58 (2002) 407–413. [82] H. Zong, A. Madden, M. Ward, M.H. Mooney, C.T. Elliott, A.W. Stitt, Homodimerisation is essential for the receptor for advanced glycation end-products (RAGE)-mediated signal transduction, J. Biol. Chem. (2010). [83] E. Sitkiewicz, K. Tarnowski, J. Poznanski, M. Kulma, M. Dadlez, Oligomerization interface of RAGE receptor revealed by MS-monitored hydrogen deuterium exchange, PLoS One 8 (2013) e76353. [84] D. Xu, J.H. Young, J.M. Krahn, D. Song, K.D. Corbett, W.J. Chazin, L.C. Pedersen, J.D. Esko, Stable RAGE–heparan sulfate complexes are essential for signal transduction, ACS Chem. Biol. 8 (2013) 1611–1620. [85] L. Yatime, G.R. Andersen, Structural insights into the oligomerization mode of the human receptor for advanced glycation end-products, FEBS J. 280 (2013) 6556–6568. [86] W. Wei, L. Lampe, S. Park, B.S. Vangara, G.S. Waldo, S. Cabantous, S.S. Subaran, D. Yang, E.G. Lakatta, L. Lin, Disulfide bonds within the C2 domain of RAGE play key roles in its dimerization and biogenesis, PLoS One 7 (2012) e50736. [87] J. Xie, S. Reverdatto, A. Frolov, R. Hoffmann, D.S. Burz, A. Shekhtman, Structural basis for pattern recognition by the receptor for advanced glycation end products (RAGE), J. Biol. Chem. 283 (2008) 27255–27269. [88] H. Zong, A. Madden, M. Ward, M.H. Mooney, C.T. Elliott, A.W. Stitt, Homodimerization is essential for the receptor for advanced glycation end products (RAGE)-mediated signal transduction, J. Biol. Chem. 285 (2010) 23137–23146. [89] J. Xie, D.S. Burz, W. He, I.B. Bronstein, I. Lednev, A. Shekhtman, Hexameric calgranulin C (S100A12) binds to the receptor for advanced glycated end products

N

C

O

R

R

E

C

T

[32] M.D. Abramoff, P.J. Magalhaes, S.J. Ram, Image processing with ImageJ, Biophoton. Int. 11 (2004) 36–42. [33] S.N. Rampersad, Multiple applications of Alamar Blue as an indicator of metabolic function and cellular health in cell viability bioassays, Sensors (Basel) 12 (2012) 12347–12360. [34] E. Leclerc, G. Fritz, M. Weibel, C.W. Heizmann, A. Galichet, S100B and S100A6 differentially modulate cell survival by interacting with distinct RAGE (receptor for advanced glycation end products) immunoglobulin domains, J. Biol. Chem. 282 (2007) 31317–31331. [35] E. Sturchler, A. Galichet, M. Weibel, E. Leclerc, C.W. Heizmann, Site-specific blockade of RAGE-Vd prevents amyloid-beta oligomer neurotoxicity, J. Neurosci. 28 (2008) 5149–5158. [36] M. Herlyn, J. Thurin, G. Balaban, J.L. Bennicelli, D. Herlyn, D.E. Elder, E. Bondi, D. Guerry, P. Nowell, W.H. Clark, et al., Characteristics of cultured human melanocytes isolated from different stages of tumor progression, Cancer Res. 45 (1985) 5670–5676. [37] M. Herlyn, G. Balaban, J. Bennicelli, D.T. Guerry, R. Halaban, D. Herlyn, D.E. Elder, G.G. Maul, Z. Steplewski, P.C. Nowell, et al., Primary melanoma cells of the vertical growth phase: similarities to metastatic cells, J. Natl. Cancer Inst. 74 (1985) 283–289. [38] D.P. Simmons, F. Andreola, L.M. De Luca, Human melanomas of fibroblast and epithelial morphology differ widely in their ability to synthesize retinyl esters, Carcinogenesis 23 (2002) 1821–1830. [39] M. Yilmaz, G. Christofori, EMT, the cytoskeleton, and cancer cell invasion, Cancer Metastasis Rev. 28 (2009) 15–33. [40] J. Haynes, J. Srivastava, N. Madson, T. Wittmann, D.L. Barber, Dynamic actin remodeling during epithelial–mesenchymal transition depends on increased moesin expression, Mol. Biol. Cell 22 (2011) 4750–4764. [41] S. Mori, J.T. Chang, E.R. Andrechek, N. Matsumura, T. Baba, G. Yao, J.W. Kim, M. Gatza, S. Murphy, J.R. Nevins, Anchorage-independent cell growth signature identifies tumors with metastatic potential, Oncogene 28 (2009) 2796–2805. [42] M.C. Guadamillas, A. Cerezo, M.A. Del Pozo, Overcoming anoikis—pathways to anchorage-independent growth in cancer, J. Cell Sci. 124 (2011) 3189–3197. [43] Y.N. Kim, K.H. Koo, J.Y. Sung, U.J. Yun, H. Kim, Anoikis resistance: an essential prerequisite for tumor metastasis, Int. J. Cell Biol. 2012 (2012) 306879. [44] R.A. Weinberg, The Biology of Cancer, in: Garland Science (Ed.), 2007, (New York). [45] R.R. Rustandi, D.M. Baldisseri, D.J. Weber, Structure of the negative regulatory domain of p53 bound to S100B(betabeta), Nat. Struct. Biol. 7 (2000) 570–574. [46] M.R. Fernandez-Fernandez, T.J. Rutherford, A.R. Fersht, Members of the S100 family bind p53 in two distinct ways, Protein Sci. 17 (2008) 1663–1670. [47] M.M. Chaturvedi, B. Sung, V.R. Yadav, R. Kannappan, B.B. Aggarwal, NF-kappaB addiction and its role in cancer: ‘one size does not fit all’, Oncogene 30 (2011) 1615–1630. [48] J. Yang, R. Splittgerber, F.E. Yull, S. Kantrow, G.D. Ayers, M. Karin, A. Richmond, Conditional ablation of Ikkb inhibits melanoma tumor development in mice, J. Clin. Invest. 120 (2010) 2563–2574. [49] Y. Ueda, A. Richmond, NF-kappaB activation in melanoma, Pigment Cell Res. 19 (2006) 112–124. [50] D. Zink, A.H. Fischer, J.A. Nickerson, Nuclear structure in cancer cells, Nat. Rev. Cancer 4 (2004) 677–687. [51] S.B. Khatau, C.M. Hale, P.J. Stewart-Hutchinson, M.S. Patel, C.L. Stewart, P.C. Searson, D. Hodzic, D. Wirtz, A perinuclear actin cap regulates nuclear shape, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 19017–19022. [52] H.J. Huttunen, C. Fages, J. Kuja-Panula, A.J. Ridley, H. Rauvala, Receptor for advanced glycation end products-binding COOH-terminal motif of amphoterin inhibits invasive migration and metastasis, Cancer Res. 62 (2002) 4805–4811. [53] K. Hoek, D.L. Rimm, K.R. Williams, H. Zhao, S. Ariyan, A. Lin, H.M. Kluger, A.J. Berger, E. Cheng, E.S. Trombetta, T. Wu, M. Niinobe, K. Yoshikawa, G.E. Hannigan, R. Halaban, Expression profiling reveals novel pathways in the transformation of melanocytes to melanomas, Cancer Res. 64 (2004) 5270–5282. [54] C. Haqq, M. Nosrati, D. Sudilovsky, J. Crothers, D. Khodabakhsh, B.L. Pulliam, S. Federman, J.R. Miller III, R.E. Allen, M.I. Singer, S.P. Leong, B.M. Ljung, R.W. Sagebiel, M. Kashani-Sabet, The gene expression signatures of melanoma progression, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 6092–6097. [55] A.P. Smith, K. Hoek, D. Becker, Whole-genome expression profiling of the melanoma progression pathway reveals marked molecular differences between nevi/melanoma in situ and advanced-stage melanomas, Cancer Biol. Ther. 4 (2005) 1018–1029. [56] J. Jaeger, D. Koczan, H.J. Thiesen, S.M. Ibrahim, G. Gross, R. Spang, M. Kunz, Gene expression signatures for tumor progression, tumor subtype, and tumor thickness in laser-microdissected melanoma tissues, Clin. Cancer Res. 13 (2007) 806–815. [57] Y. Matsumoto, J.L. Maller, A centrosomal localization signal in cyclin E required for Cdk2-independent S phase entry, Science 306 (2004) 885–888. [58] D.P. Simmons, M.L. Peach, J.R. Friedman, M.M. Green, M.C. Nicklaus, L.M. De Luca, Evidence that sequence homologous region in LRAT-like proteins possesses antiproliferative activity and DNA binding properties: translational implications and mechanism of action, Carcinogenesis 27 (2006) 693–707. [59] K. Satyamoorthy, N.H. Chehab, M.J. Waterman, M.C. Lien, W.S. El-Deiry, M. Herlyn, T. D. Halazonetis, Aberrant regulation and function of wild-type p53 in radioresistant melanoma cells, Cell Growth Differ. 11 (2000) 467–474. [60] J. Lin, M. Blake, C. Tang, D. Zimmer, R.R. Rustandi, D.J. Weber, F. Carrier, Inhibition of p53 transcriptional activity by the S100B calcium-binding protein, J. Biol. Chem. 276 (2001) 35037–35041. [61] J. Lin, Q. Yang, P.T. Wilder, F. Carrier, D.J. Weber, The calcium-binding protein S100B down-regulates p53 and apoptosis in malignant melanoma, J. Biol. Chem. 285 (2010) 27487–27498. [62] J. Lin, Q. Yang, Z. Yan, J. Markowitz, P.T. Wilder, F. Carrier, D.J. Weber, Inhibiting S100B restores p53 levels in primary malignant melanoma cancer cells, J. Biol. Chem. 279 (2004) 34071–34077.

U

730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

E

10

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 Q25 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901

V. Meghnani et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

902 903 904 905 906 907 908

(RAGE) using symmetric hydrophobic target-binding patches, J. Biol. Chem. 282 (2007) 4218–4231. [90] J. Schlessinger, Ligand-induced, receptor-mediated dimerization and activation of EGF receptor, Cell 110 (2002) 669–672. [91] M. Chinkers, E.M. Wilson, Ligand-independent oligomerization of natriuretic peptide receptors. Identification of heteromeric receptors and a dominant negative mutant, J. Biol. Chem. 267 (1992) 18589–18597.

11

[92] R. Horie, T. Watanabe, Y. Morishita, K. Ito, T. Ishida, Y. Kanagae, I. Saito, M. Higashihara, S. Mori, M.E. Kadin, T. Watanabe, Ligand-independent signaling by overexpressed CD30 drives NF-kappaB activation in Hodgkin–Reed–Sternberg cells, Oncogene 21 (2002) 2493–2503. [93] F.K. Chan, H.J. Chun, L. Zheng, R.M. Siegel, K.L. Bui, M.J. Lenardo, A domain in TNF receptors that mediates ligand-independent receptor assembly and signaling, Science 288 (2000) 2351–2354

U

N C O

R

R

E

C

T

E

D

P

R O

O

F

916

Please cite this article as: V. Meghnani, et al., RAGE overexpression confers a metastatic phenotype to the WM115 human primary melanoma cell line, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbadis.2014.02.013

909 910 911 912 913 914 915