- Email: [email protected]
Randomly amplified polymorphic DNA (RAPD) assay for genomic fingerprinting of Bacillus cereus isolates
International Journal of
ELSEVIER
Food Microbiology 31 (1996) 311 316
Short communication
Randomly amplified polymorphic DNA (RAPD) assay for genomic fingerprinting of Bacillus cereus isolates Roger Institut
,fiIirtieriirztlichr
Stephan*
Lehensmittelhygienr CH-8057
&r
Ziirich,
Universit8t
Ziirich,
Winterthurerstr.
272,
Switzerlunri
Received 3 October 1995; accepted 20 October 1995
Abstract Randomly amplified polymorphic DNA (RAPD) assay was used for epidemiological subtyping of B. cereus and B. lentus. Within 25 isolates of B. cereus up to 22 strain types could be determined when five primers were used. RAPD patterns, which were found in three B. Ientus strains, clearly differed form those of B. cereus. The RAPD technique proved to be an effective tool for the characterization of B. cereus strains. Keyword.s:
B. cereus;
Genomic
fingerprinting;
RAPD
assay
1. Introduction Bacillus spp. are a major cause of spoilage of perishable foods such as milk and milk products (Meer et al., 1991); B. cereus, B. licheniformis, B. pumilus, B. subtilis and B. brevis are known to be responsible for food borne diseases (Kramer and Gilbert, 1989). Bacillus cereus is the cause of two different types of food poisoning: the emetic type and the diarrhoeal type, which are each apparently caused by different toxins (Kramer and Gilbert, 1989; Drobniewski, 1993; Granum, 1994). * Corresponding Winterthurerstr.
0168-1605/96/$15.00 PII
author.
272, CH-8057
Institut Ziirich,
Q 1996 Elsevier
SO1 68-t 605(96)00966-X
fiir tierSrztliche Switzerland.
Tel.:
Lebenslnittelhygiene + 41 1 3651471;
Science B.V. All rights
reserved
der Universitat Ziirich. fax: + 41 1 3130130.
312
R. Stephan / Int. J. Food Microbiology 31 (1996) 311-316
Not only precise identification of the isolates and toxins, but also extensive typing is indispensable in epidemiological investigations of food products and food processing establishments. Different techniques have been described in the literature. Besides phage typing for distinction of subtypes in various B. cereus strains (Kawano et al., 1990), serological typing techniques (Kramer and Gilbert, 1989; Shinagawa, 1990), protein electrophoresis (Owens et al., 1984) and fatty acid analysis (Raevuori et al., 1976) have been applied. The RAPD technique (randomly amplified polymorphic DNA) (Williams et al., 1990) provides new means for a molecular characterization of bacteria. Up to now, it has been used for epidemiological subtyping of food hygiene relevant species such as Listeriu spp, Campylobacter spp, Clostridium spp, E. coli and Yersinia spp, (Mazurier and Wernars, 1992; Mazurier et al., 1992; Barbut et al., 1993; Levett et al., 1993; Cave et al., 1994; Czajka and Batt, 1994; Farber and Addison, 1994; Rasmussen et al., 1994). RAPD typing to distinguish strains in the species B. thuringensis (Brousseau et al., 1993) and B. licheniformis (Stephan et al., 1994) have been described. For the present study, the RAPD technique was applied in an attempt to differentiate B. cereus strains.
2. Materials and methods The origin of the 28 Bacillus strains used in this investigation is listed in Table 1. Of the 25 representatives of B. cereus, 23 strains had been isolated from baby food and were kindly provided by Dr. K.J. Zaadhof (Ludwig-Maximilians Universitat Munchen). Two additional strains of the species B. cereus (DSM 4282, DSM 4384) were obtained from the strain collection of ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’ (DSM, Braunschweig, Germany). The biochemical identification of Bacillus strains was carried out in accordance with Bergey’s Manual of Bacteriology (Sneath, 1986). The Gram-staining characteristics, hemolysis of blood agar, the production of catalase and oxidase, hydrolysis of D-glucose, L-arabinose, D-xylose, D-mannitol, gelatine, casein and starch, the reaction in the indole and Voges-Proskauer tests, the urease, nitrate and the Table 1 Origin of the 28 Bacillus cereus strains used for the investigation Species Bacillus cereus
Total number of strains 1
1 23 Bacillus lentus
3
Origin DSM 4282 DSM 4384 Wildstrains” Wildstrains”
DSM, strain collection of ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’. “The wildstrains were isolated of infant and baby food and were provided by Dr. K.J. Zaadhof, Miinchen.
R. Stephan / Int. J. Food Microbiology 31 (1996) 311.-316
Table 2 Primers for characterization
313
of B. cereza with RAPD technique
Primer
Number of nucleotides
Sequence (5’-3’)
HLWL 82 HLWL 85 HLWL 74 T3A T5A
10-mer 10-mer 10-mer
CGGCCTCTGC ACAACTGCTC ACGTATCTGC AGGGGGTTCGAATTCCCGCC AGTCCGGTGCTCTAACCAAC
20-mer 20-mer
lecithinase activities and the growth at pH 6.8, at pH 5.7, in 7% NaCl and by varying growth temperatures (lO“C, 30°C 40°C 5O’C) were tested. Hydrolysis of lecithin (egg yolk reaction) and hydrolysis of mannit was detected on Mossel-Agar (Merck 5267). In addition, all strains were identified by means of API-50-CHB test strips (Bio-Merieux Marcy-l’Etoile, France). The sensitivity to penicillin was determined with the disk diffusion susceptibility test (Bauer et al., 1966). RAPD analysis was performed as described by Mazurier and Wernars (1992). Freshly cultured cells were inoculated in BHI-broth and incubated at 37°C for 72 h. After centrifugation (2000 x g, 15 min.) the cells were washed in 0.85% NaCl, pelleted again by centrifugation and finally resuspended and diluted in sterile water. In the amplification reaction the lo-mer primers HLWL 82, HLWL 85, HLWL 74 and 20-mer primers T3A and T5A were used (Table 2). Fifty-p1 reactions were each containing 1.25 units Taq-DNA-Polymerase (Boehringerprepared, Mannheim, Rotkreuz, Switzerland), 1OmM Tris-HCl, 1.5 mM MgCl,, 50 mM KCl, 0.1 mM of each deoxynucleoside triphosphate, 50 ng of the primer and 5 ,uI of the diluted bacterial suspension. DNA amplification was performed in a DNA Thermal Cycler (Perkin Elmer Cetus, Nowalk). A 25-~1 volume of each reaction was analyzed in a 1.6% agarose gel run at 7 V/cm (90 min). After staining with ethidium bromide, profiles were visually differentiated and arbitrarily numbered. The consistency of the results was confirmed by three repetitions of the RAPD analysis.
3. Results and discussion All 28 Bacillus strains showed a positive egg yolk reaction. The biochemical identification in accordance with Bergey’s Manual of Bacteriology such as the API-System confirmed 25 of the investigated strains as B. cereus and three strains as B. lentus. The RAPD analysis of the 25 strains of B. cereus revealed four different DNA profiles with the primer HLWL 82, 13 with HLWL 85, 13 with HLWL 74, two with T3A and four different DNA profiles with the primer T5A. Fingerprints obtained with the primer 85 are shown in Fig. 1. With this primer individual strains showed up to five different DNA bands. HLWL 82 showed four, HLWL 74 four, T5A four,
314
R. Stephan / Int. J. Food Microbiology 31 (1996) 31 l-316
whereas only two distinct bands became visible with T3A. Of all primers, HLWL 85 obtained the most differentiated RAPD profiles. However, it should be pointed out that for epidemiological subtyping of bacterial strains, simultaneous use of different primers has been recommended (Williams et al., 1990). The different DNA profiles which could be determined with the five primers were combined and subsumed into strain types (Table 3). Within the 25 B. cereus strains, a total of 22 different types could be distinguished. The strain type A,,-B2-C,0-D,-E, was found four times, the strain type A,-B,-C,-D,-E, was found twice. Furthermore, the investigation showed that two different RAPD types of B. cereus corresponded with certain biochemical reactions (Table 3). The only penicillin-sensitive strain belonged to the single strain type A,-B,-C,-D,-E, and the strain with a negative nitrate reaction belonged to the type A,-B,-C,-D,E,. It was striking that the three B. lentus strains showed no difference when the five primers were used. This profile (A,,-B,-C,,-D,-E,) could not be demonstrated in any of the 25 B. cereus strains. The RAPD technique with the primers HLWL-85 and HLWL-75 proved to be an effective tool for the characterization of B. cereus strains.
ABCDEFGHIK
Fig. 1. Amplified RAPD products of Bacillus cereus strains. Amplification with primer HLWL 85 is shown. Lane A, pBR 328 DNA digested with BglI and Hinff (Boehringer-Mannheim, Rotkreuz, Switzerland). Lane B and C, B. cereu obtained from DSM; lane B, strain DSM 4282, lane C, strain DSM 4384. Lanes D-K, B. cereus isolated from baby food. Lane D, strain 5; lane E, strain 6; lane F, negative control; lane G, strain 8; lane H, strain 9; lane I, strain 10; lane K, strain 11.
R. Strphan / Int. J. Food Microbiology 31 (1996) 311m316 Table 3 RAPD-type,
nitrate
Species (origin)
reaction
Strain
and sensitivity
Nitrate
to penicillin
Penicillin
of 28 Bacillus
RAPD-type
315
strains
with
HLWL-85
HLWL-82
HLWL-74
T5A
T3A
B. cereus (DSM) B. crreus (wildstrains)
B. lentus (wildstrains)
4282 4384
Pos Pos
R R
Al Al
BI Bl
Cl c2
Dl Dl
El El
I6 27 28 5 6 8 9 17 30 IO 20 II I4 7 I3 15 19 22 25 26 21 23 34
Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Neg Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos
R R R R R R R R R R R R R R E R R R R R R R R
Al Al Al A2 A3 A4 A5 A5 A5 A6 A6 A7 A7 A8 A8 A9 A10 A10 AI0 Al0 All A12 Al4
BI Bl Bl BI B2 B2 Bl B2 B2 BI BI Bl BI BI B2 Bl B2 B2 B2 B2 BI B3 BI
c5 Cl2 c2 c3 Cl c5 C6 C8 CS C6 C6 c7 c9 c4 C8 c5 Cl0 Cl0 Cl0 Cl0 Cl1 CII c7
D3 D3 D3 Dl D2 D2 Dl D3 D5 DI Dl Dl Dl Dl D3 D3 D4 D4 D4 D4 Dl Dl DI
El El El El El El El El El El El El El El El E2 El El El El El El El
29 31 32
Pos Pos Pos
R R R
A13 Al3 Al3
B4 B4 B4
Cl3 Cl3 Cl3
D3 03 D3
El El El
R, resistant. E. sensitive. Pos, positive. Neg, negative.
Acknowledgements
The wildstrains were kindly provided by Dr. K.J. Zaadhof, Lehrstuhl fiir Hygiene und Technologie der Milch, Ludwig-Maximilians Universitat Miinchen, Germany.
316
R. Stephan 1 Int. J. Food Microbiology 31 (1996) 311-316
References Barbut, F., Mario, N., Delmee, M. and Gozian, J. (1993) Genomic fingerprinting of Clostridium difficile isolates by using a random amplified polymorphic DNA (RAPD) assay. FEMS Microbial. Lett. 114, 161-166. Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. (1966) Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 45, 493-496. Brousseau, R., Saint-Onge, A., Prefontaine, G., Masson, L. and Cabana, J. (1993) Arbitrary primer polymerase chain reaction, a powerful method to identify Bacillus thuringiensis serovars and strains. Appl. Environ. Microbial. 59, 114-l 19. Cave, H., Bingen, E., Elion, J. and Denamur, E. (1994) Differentiation of Escherichia coii strains using randomly amplified polymorphic DNA analysis. Res. Microbial. 145, 141-150. Czajka, J. and Batt, C.A. (1994) Verification of causal relationships between L. monocytogerres isolates by RAPD DNA patterns. J. Clin. Microbial. 32, 1280-1287. Drobniewski, F. (1993) Bacillus cereus and related species. Clin. Microbial. Rev. 6, 3244338. Farber, J.M. and Addison, C.J. (1994) RAPD typing for distinguishing species and strains in the genus Listeria. J. Appl. Bacterial. 77, 2422250. Granum, P.E. (1994) Bacillus cereus and its toxins. J. Appl. Bacterial. 76, 61-66. Kawano, J., Shimizu, A., Takeuchi, S. and Kimura, S. (1990) Isolation and use of experimental phages for typing Bacillus cereus. Science Reports of Faculty of Agriculture, Kobe University 17, 163-166. Kramer, J.M. and Gilbert, R.T. (1989) Bacillus cereus and other bacillus species. In: M.P. Doyle (editor), Foodborne Bacterial Pathogens, Marcel Dekker, New York, pp. 21-70. Levett, P.N., Bennett, P., O’Donaghue, K., Bowker, K., Reeves, D. and Mac Gowan, A. (1993) Relapsed infection due to L. monocytogenes confirmed by RAPD analysis. J. Infect. 27, 205. Mazurier, S.-I. and Wemars, K. (1992) Typing of Listeria strains by random amplification of polymorphic DNA. Res. Microbial. 143, 499-505. Mazurier, S., Van de Giessen, A., Heuvelman, K. and Wernars, K. (1992) RAPD analysis of Campylobacter isolates: DNA fingerprinting without the need to purify DNA. Lett. Appl. Microbial. 14, 260-262. Meer, R.R., Baker, J., Bodyfelt, F.W. and Griffiths, M.W. (1991) Psychotrophic Bacillus species in fluid milk products: a review. J. Food Protect. 54, 9699979. Owens, J.-J., Fitz, F. and McDowell, D.A. (1984) Isoenzyme changes during sporulation of Bacillus cereus and its variety mycoides. Proc. Biochem. 19, 63-64. Raevuori, M., Kiutamo, T., Niskanen, A. and Salminen, K. (1976) An outbreak of Bacillus cereus food-poisoning in Finland associated with boiled rice. J. Hyg. 76, 319-327. Rasmussen, H.N., Olsen, J.E. and Tasmussen, O.F. (1994) RAPD analysis of Yersinia enterocolitica. Lett. Appl. Microbial. 19, 3599362. Shinagawa, K. (1990) Analytical methods for Bacillus cereus and other Bacillus species. Int. J. Food Microbial. 10, 125-142. Sneath, P.H.A. (1986) Endospore-forming Gram-positive rods and cocci. In: P.H.A. Sneath, N.S. Mair, M.E. Sharpe and J.G. Holt (editors), Bergy’s Manual of Systematic Bacteriology, Vol. 2, Williams and Wilkins, Baltimore, MD, pp. 110551139. Stephan, R., Schraft, H. and Untermann, F. (1994) Characterization of Bacillus licheniformis with the RAPD technique (randomly amplified polymorphic DNA). Lett. Appl. Microbial. 18, 260-263. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-6535.
ELSEVIER
Food Microbiology 31 (1996) 311 316
Short communication
Randomly amplified polymorphic DNA (RAPD) assay for genomic fingerprinting of Bacillus cereus isolates Roger Institut
,fiIirtieriirztlichr
Stephan*
Lehensmittelhygienr CH-8057
&r
Ziirich,
Universit8t
Ziirich,
Winterthurerstr.
272,
Switzerlunri
Received 3 October 1995; accepted 20 October 1995
Abstract Randomly amplified polymorphic DNA (RAPD) assay was used for epidemiological subtyping of B. cereus and B. lentus. Within 25 isolates of B. cereus up to 22 strain types could be determined when five primers were used. RAPD patterns, which were found in three B. Ientus strains, clearly differed form those of B. cereus. The RAPD technique proved to be an effective tool for the characterization of B. cereus strains. Keyword.s:
B. cereus;
Genomic
fingerprinting;
RAPD
assay
1. Introduction Bacillus spp. are a major cause of spoilage of perishable foods such as milk and milk products (Meer et al., 1991); B. cereus, B. licheniformis, B. pumilus, B. subtilis and B. brevis are known to be responsible for food borne diseases (Kramer and Gilbert, 1989). Bacillus cereus is the cause of two different types of food poisoning: the emetic type and the diarrhoeal type, which are each apparently caused by different toxins (Kramer and Gilbert, 1989; Drobniewski, 1993; Granum, 1994). * Corresponding Winterthurerstr.
0168-1605/96/$15.00 PII
author.
272, CH-8057
Institut Ziirich,
Q 1996 Elsevier
SO1 68-t 605(96)00966-X
fiir tierSrztliche Switzerland.
Tel.:
Lebenslnittelhygiene + 41 1 3651471;
Science B.V. All rights
reserved
der Universitat Ziirich. fax: + 41 1 3130130.
312
R. Stephan / Int. J. Food Microbiology 31 (1996) 311-316
Not only precise identification of the isolates and toxins, but also extensive typing is indispensable in epidemiological investigations of food products and food processing establishments. Different techniques have been described in the literature. Besides phage typing for distinction of subtypes in various B. cereus strains (Kawano et al., 1990), serological typing techniques (Kramer and Gilbert, 1989; Shinagawa, 1990), protein electrophoresis (Owens et al., 1984) and fatty acid analysis (Raevuori et al., 1976) have been applied. The RAPD technique (randomly amplified polymorphic DNA) (Williams et al., 1990) provides new means for a molecular characterization of bacteria. Up to now, it has been used for epidemiological subtyping of food hygiene relevant species such as Listeriu spp, Campylobacter spp, Clostridium spp, E. coli and Yersinia spp, (Mazurier and Wernars, 1992; Mazurier et al., 1992; Barbut et al., 1993; Levett et al., 1993; Cave et al., 1994; Czajka and Batt, 1994; Farber and Addison, 1994; Rasmussen et al., 1994). RAPD typing to distinguish strains in the species B. thuringensis (Brousseau et al., 1993) and B. licheniformis (Stephan et al., 1994) have been described. For the present study, the RAPD technique was applied in an attempt to differentiate B. cereus strains.
2. Materials and methods The origin of the 28 Bacillus strains used in this investigation is listed in Table 1. Of the 25 representatives of B. cereus, 23 strains had been isolated from baby food and were kindly provided by Dr. K.J. Zaadhof (Ludwig-Maximilians Universitat Munchen). Two additional strains of the species B. cereus (DSM 4282, DSM 4384) were obtained from the strain collection of ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’ (DSM, Braunschweig, Germany). The biochemical identification of Bacillus strains was carried out in accordance with Bergey’s Manual of Bacteriology (Sneath, 1986). The Gram-staining characteristics, hemolysis of blood agar, the production of catalase and oxidase, hydrolysis of D-glucose, L-arabinose, D-xylose, D-mannitol, gelatine, casein and starch, the reaction in the indole and Voges-Proskauer tests, the urease, nitrate and the Table 1 Origin of the 28 Bacillus cereus strains used for the investigation Species Bacillus cereus
Total number of strains 1
1 23 Bacillus lentus
3
Origin DSM 4282 DSM 4384 Wildstrains” Wildstrains”
DSM, strain collection of ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’. “The wildstrains were isolated of infant and baby food and were provided by Dr. K.J. Zaadhof, Miinchen.
R. Stephan / Int. J. Food Microbiology 31 (1996) 311.-316
Table 2 Primers for characterization
313
of B. cereza with RAPD technique
Primer
Number of nucleotides
Sequence (5’-3’)
HLWL 82 HLWL 85 HLWL 74 T3A T5A
10-mer 10-mer 10-mer
CGGCCTCTGC ACAACTGCTC ACGTATCTGC AGGGGGTTCGAATTCCCGCC AGTCCGGTGCTCTAACCAAC
20-mer 20-mer
lecithinase activities and the growth at pH 6.8, at pH 5.7, in 7% NaCl and by varying growth temperatures (lO“C, 30°C 40°C 5O’C) were tested. Hydrolysis of lecithin (egg yolk reaction) and hydrolysis of mannit was detected on Mossel-Agar (Merck 5267). In addition, all strains were identified by means of API-50-CHB test strips (Bio-Merieux Marcy-l’Etoile, France). The sensitivity to penicillin was determined with the disk diffusion susceptibility test (Bauer et al., 1966). RAPD analysis was performed as described by Mazurier and Wernars (1992). Freshly cultured cells were inoculated in BHI-broth and incubated at 37°C for 72 h. After centrifugation (2000 x g, 15 min.) the cells were washed in 0.85% NaCl, pelleted again by centrifugation and finally resuspended and diluted in sterile water. In the amplification reaction the lo-mer primers HLWL 82, HLWL 85, HLWL 74 and 20-mer primers T3A and T5A were used (Table 2). Fifty-p1 reactions were each containing 1.25 units Taq-DNA-Polymerase (Boehringerprepared, Mannheim, Rotkreuz, Switzerland), 1OmM Tris-HCl, 1.5 mM MgCl,, 50 mM KCl, 0.1 mM of each deoxynucleoside triphosphate, 50 ng of the primer and 5 ,uI of the diluted bacterial suspension. DNA amplification was performed in a DNA Thermal Cycler (Perkin Elmer Cetus, Nowalk). A 25-~1 volume of each reaction was analyzed in a 1.6% agarose gel run at 7 V/cm (90 min). After staining with ethidium bromide, profiles were visually differentiated and arbitrarily numbered. The consistency of the results was confirmed by three repetitions of the RAPD analysis.
3. Results and discussion All 28 Bacillus strains showed a positive egg yolk reaction. The biochemical identification in accordance with Bergey’s Manual of Bacteriology such as the API-System confirmed 25 of the investigated strains as B. cereus and three strains as B. lentus. The RAPD analysis of the 25 strains of B. cereus revealed four different DNA profiles with the primer HLWL 82, 13 with HLWL 85, 13 with HLWL 74, two with T3A and four different DNA profiles with the primer T5A. Fingerprints obtained with the primer 85 are shown in Fig. 1. With this primer individual strains showed up to five different DNA bands. HLWL 82 showed four, HLWL 74 four, T5A four,
314
R. Stephan / Int. J. Food Microbiology 31 (1996) 31 l-316
whereas only two distinct bands became visible with T3A. Of all primers, HLWL 85 obtained the most differentiated RAPD profiles. However, it should be pointed out that for epidemiological subtyping of bacterial strains, simultaneous use of different primers has been recommended (Williams et al., 1990). The different DNA profiles which could be determined with the five primers were combined and subsumed into strain types (Table 3). Within the 25 B. cereus strains, a total of 22 different types could be distinguished. The strain type A,,-B2-C,0-D,-E, was found four times, the strain type A,-B,-C,-D,-E, was found twice. Furthermore, the investigation showed that two different RAPD types of B. cereus corresponded with certain biochemical reactions (Table 3). The only penicillin-sensitive strain belonged to the single strain type A,-B,-C,-D,-E, and the strain with a negative nitrate reaction belonged to the type A,-B,-C,-D,E,. It was striking that the three B. lentus strains showed no difference when the five primers were used. This profile (A,,-B,-C,,-D,-E,) could not be demonstrated in any of the 25 B. cereus strains. The RAPD technique with the primers HLWL-85 and HLWL-75 proved to be an effective tool for the characterization of B. cereus strains.
ABCDEFGHIK
Fig. 1. Amplified RAPD products of Bacillus cereus strains. Amplification with primer HLWL 85 is shown. Lane A, pBR 328 DNA digested with BglI and Hinff (Boehringer-Mannheim, Rotkreuz, Switzerland). Lane B and C, B. cereu obtained from DSM; lane B, strain DSM 4282, lane C, strain DSM 4384. Lanes D-K, B. cereus isolated from baby food. Lane D, strain 5; lane E, strain 6; lane F, negative control; lane G, strain 8; lane H, strain 9; lane I, strain 10; lane K, strain 11.
R. Strphan / Int. J. Food Microbiology 31 (1996) 311m316 Table 3 RAPD-type,
nitrate
Species (origin)
reaction
Strain
and sensitivity
Nitrate
to penicillin
Penicillin
of 28 Bacillus
RAPD-type
315
strains
with
HLWL-85
HLWL-82
HLWL-74
T5A
T3A
B. cereus (DSM) B. crreus (wildstrains)
B. lentus (wildstrains)
4282 4384
Pos Pos
R R
Al Al
BI Bl
Cl c2
Dl Dl
El El
I6 27 28 5 6 8 9 17 30 IO 20 II I4 7 I3 15 19 22 25 26 21 23 34
Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Neg Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos Pos
R R R R R R R R R R R R R R E R R R R R R R R
Al Al Al A2 A3 A4 A5 A5 A5 A6 A6 A7 A7 A8 A8 A9 A10 A10 AI0 Al0 All A12 Al4
BI Bl Bl BI B2 B2 Bl B2 B2 BI BI Bl BI BI B2 Bl B2 B2 B2 B2 BI B3 BI
c5 Cl2 c2 c3 Cl c5 C6 C8 CS C6 C6 c7 c9 c4 C8 c5 Cl0 Cl0 Cl0 Cl0 Cl1 CII c7
D3 D3 D3 Dl D2 D2 Dl D3 D5 DI Dl Dl Dl Dl D3 D3 D4 D4 D4 D4 Dl Dl DI
El El El El El El El El El El El El El El El E2 El El El El El El El
29 31 32
Pos Pos Pos
R R R
A13 Al3 Al3
B4 B4 B4
Cl3 Cl3 Cl3
D3 03 D3
El El El
R, resistant. E. sensitive. Pos, positive. Neg, negative.
Acknowledgements
The wildstrains were kindly provided by Dr. K.J. Zaadhof, Lehrstuhl fiir Hygiene und Technologie der Milch, Ludwig-Maximilians Universitat Miinchen, Germany.
316
R. Stephan 1 Int. J. Food Microbiology 31 (1996) 311-316
References Barbut, F., Mario, N., Delmee, M. and Gozian, J. (1993) Genomic fingerprinting of Clostridium difficile isolates by using a random amplified polymorphic DNA (RAPD) assay. FEMS Microbial. Lett. 114, 161-166. Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. (1966) Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 45, 493-496. Brousseau, R., Saint-Onge, A., Prefontaine, G., Masson, L. and Cabana, J. (1993) Arbitrary primer polymerase chain reaction, a powerful method to identify Bacillus thuringiensis serovars and strains. Appl. Environ. Microbial. 59, 114-l 19. Cave, H., Bingen, E., Elion, J. and Denamur, E. (1994) Differentiation of Escherichia coii strains using randomly amplified polymorphic DNA analysis. Res. Microbial. 145, 141-150. Czajka, J. and Batt, C.A. (1994) Verification of causal relationships between L. monocytogerres isolates by RAPD DNA patterns. J. Clin. Microbial. 32, 1280-1287. Drobniewski, F. (1993) Bacillus cereus and related species. Clin. Microbial. Rev. 6, 3244338. Farber, J.M. and Addison, C.J. (1994) RAPD typing for distinguishing species and strains in the genus Listeria. J. Appl. Bacterial. 77, 2422250. Granum, P.E. (1994) Bacillus cereus and its toxins. J. Appl. Bacterial. 76, 61-66. Kawano, J., Shimizu, A., Takeuchi, S. and Kimura, S. (1990) Isolation and use of experimental phages for typing Bacillus cereus. Science Reports of Faculty of Agriculture, Kobe University 17, 163-166. Kramer, J.M. and Gilbert, R.T. (1989) Bacillus cereus and other bacillus species. In: M.P. Doyle (editor), Foodborne Bacterial Pathogens, Marcel Dekker, New York, pp. 21-70. Levett, P.N., Bennett, P., O’Donaghue, K., Bowker, K., Reeves, D. and Mac Gowan, A. (1993) Relapsed infection due to L. monocytogenes confirmed by RAPD analysis. J. Infect. 27, 205. Mazurier, S.-I. and Wemars, K. (1992) Typing of Listeria strains by random amplification of polymorphic DNA. Res. Microbial. 143, 499-505. Mazurier, S., Van de Giessen, A., Heuvelman, K. and Wernars, K. (1992) RAPD analysis of Campylobacter isolates: DNA fingerprinting without the need to purify DNA. Lett. Appl. Microbial. 14, 260-262. Meer, R.R., Baker, J., Bodyfelt, F.W. and Griffiths, M.W. (1991) Psychotrophic Bacillus species in fluid milk products: a review. J. Food Protect. 54, 9699979. Owens, J.-J., Fitz, F. and McDowell, D.A. (1984) Isoenzyme changes during sporulation of Bacillus cereus and its variety mycoides. Proc. Biochem. 19, 63-64. Raevuori, M., Kiutamo, T., Niskanen, A. and Salminen, K. (1976) An outbreak of Bacillus cereus food-poisoning in Finland associated with boiled rice. J. Hyg. 76, 319-327. Rasmussen, H.N., Olsen, J.E. and Tasmussen, O.F. (1994) RAPD analysis of Yersinia enterocolitica. Lett. Appl. Microbial. 19, 3599362. Shinagawa, K. (1990) Analytical methods for Bacillus cereus and other Bacillus species. Int. J. Food Microbial. 10, 125-142. Sneath, P.H.A. (1986) Endospore-forming Gram-positive rods and cocci. In: P.H.A. Sneath, N.S. Mair, M.E. Sharpe and J.G. Holt (editors), Bergy’s Manual of Systematic Bacteriology, Vol. 2, Williams and Wilkins, Baltimore, MD, pp. 110551139. Stephan, R., Schraft, H. and Untermann, F. (1994) Characterization of Bacillus licheniformis with the RAPD technique (randomly amplified polymorphic DNA). Lett. Appl. Microbial. 18, 260-263. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-6535.