- Email: [email protected]
Rapid and inexpensive NaOH based direct PCR for amplification of nuclear and organelle DNA from ramie (Boehmeria nivea), a bast fibre crop containing complex polysaccharides
Industrial Crops and Products 50 (2013) 532–536
Contents lists available at ScienceDirect
Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop
Rapid and inexpensive NaOH based direct PCR for amplification of nuclear and organelle DNA from ramie (Boehmeria nivea), a bast fibre crop containing complex polysaccharides Pratik Satya a,∗ , Sabyasachi Mitra a , D.P. Ray b , B.S. Mahapatra a , M. Karan a , S. Jana a , A.K. Sharma a,b a b
Central Research Institute for Jute and Allied Fibres, Barrackpore, Kolkata, India National Institute of Research on Jute and Allied Fibre Technology, Kolkata, India
a r t i c l e
i n f o
Article history: Received 20 April 2013 Received in revised form 23 July 2013 Accepted 27 July 2013 Keywords: Ramie Boehmeria nivea Direct PCR NaOH Dilution Polysaccharides
a b s t r a c t Most of the PCR based approaches in plant science rely on lengthy and expensive DNA isolation protocols, which often involve use of hazardous chemicals. Direct PCR methods save time and cost of experiments and also increase efficiency of PCR. We have compared three rapid DNA extraction processes for direct PCR in ramie (Boehmeria nivea), a fibre crop species containing high amount of gummy complex polysaccharides and developed modified protocols for direct PCR using NaOH as extraction buffer and Tris/Tris–HCl/Tris–EDTA as dilution buffer. These protocols were successful in amplification of nuclear DNA from leaf and stem tissues using ISSR and SSR markers and also chloroplast DNA amplification using primers for rbcL gene. Our results also show that nature and quantity of dilution buffer are important for increasing efficiency of direct PCR. The NaOH based methods are simpler, cheaper and economical compared to other direct PCR methods and work very well for tissues containing high amount of complex polysaccharides. The protocols are suitable for batch processing and high throughput genotyping within a short time period, which will have many applications in plant genomic researches. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Polymerase chain reaction (PCR) is a DNA amplification procedure routinely used in molecular biology and biotechnology experiments. Typically, the template DNA for PCR amplification is extracted from a source organism followed by targeted amplification of gene/DNA sequences using random or specifically designed primers (Mullis and Faloona, 1987). PCR is extensively used for DNA marker based studies, DNA sequencing, cloning and identification of transformants, DNA barcoding, mutant identification, forensic studies and many other biological studies. PCR based DNA markers have versatile applications in plants from genotype identification, purity testing, genetic map construction, gene discovery, QTL mapping and marker assisted crop improvement (Agarwal et al., 2008). DNA extraction is an integral component of all the PCR based experiments. To improve the speed and efficiency of PCR, numerous protocols have been developed to reduce the time period and to improve the quality of extracted DNA, most of which are based on hexadecyltrimethylammonium bromide (CTAB) or sodium dodecyl sulfate (SDS), ionic detergents used to disrupt tissues for releasing DNA from cell (Doyle and Doyle, 1987; Goldenberger et al., 1995).
∗ Corresponding author. Tel.: +91 3325350415. E-mail address: [email protected] (P. Satya). 0926-6690/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.indcrop.2013.07.049
DNA extraction based on these methods requires about 24–48 h before the DNA is ready for PCR (Bellstedt et al., 2010). A number of commercial kits are also available for plant DNA extraction, which are more efficient but are expensive. To eliminate the time consuming DNA extraction step from PCR, direct PCR amplification from ground plant tissues has been proposed (Berthomieu and Meyer, 1991). By reducing the pre-PCR steps from days to hours, direct PCR methods allow large scale processing of samples and minimize costs involved in DNA extraction. In spite of these advantages, only a few direct PCR protocols have been developed to date for plant species because of low success rate due to low yield of DNA and presence of inhibiting compounds like sugars, proteins and phenolics in reaction mixture (Rogers and Parkes, 1999). Some of these protocols are single step PCR, avoiding any storage of the extract (Rogers and Parkes, 1999), while others involve two or more sequential steps involving extraction of the tissue in one buffer followed by PCR amplification of the aliquot in reaction mixture (Bellstedt et al., 2010; Flores et al., 2012), which permit intermediate storage of the extract for longer periods. Ramie, rhea or China grass (Boehmeria nivea (L.) Gaud.) is a perennial fibre crop producing high quality bast fibre for textile applications. The history of ramie cultivation is at least 5000 years old in China and Indo-Malay peninsula (Kirby, 1963; Liang et al., 2009). It is also grown in Japan, Brazil, the Philippines, India and
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
533
Table 1 List of primers used in the experiment. SL No.
Primer name
1
SISSR 6
Sequence (5 –3 )
Primer length (nt)
Annealing temperature (◦ C)
Amplicon size (bp)
BDB(CAC)5
18
56.0
280–720
2
SSR 634
F R
GGAGAATATAAGGCCGCGTAG CAGCGGTGTAAGGCTCTCTC
21 20
51.0
650
3
rbcL
F R
ATGTCACCACAAACAGAAACTAAAGCAAGT CTTCACAAGCAGCAGCTAGTTCAGGACTCC
30 30
48.0
1380
B – (C, G, T); D – (A, G, T).
Korea. The fibre produced from ramie is strongest of all known plant based fibres bearing more than twofold strength of cotton fibre with a very high fibre cell length/breadth ratio (>3500) (Sarkar et al., 2010). Besides, the fibre bears additional useful properties, such as resistance to bacterial degradation and higher tensile strength under hygroscopic condition. The root of the plant is also used for medicinal purpose as antioxidant, anti-inflammatory and hepatoprotective agent (Lin et al., 1998; Huang et al., 2009). The stem of ramie contains high amount of mucilaginous and complex pectinaceous substances, commonly described as gum. During processing, the gummy substances are removed chemically or enzymatically before fibre extraction (Bruhlmann et al., 1994). Presence of such complex polysaccharides reduces the efficiency of CTAB based DNA isolation methods and also may interfere with PCR (Kaufman et al., 1999). There are some reports of extraction of genomic DNA from cotyledons or young ramie leaves using CTAB based methods (Liang et al., 2009; Li et al., 2010), but no rapid method for direct PCR or quick DNA extraction from leaves or stem is available. Here we describe methods for direct PCR from ramie stem and leaf tissues, using NaOH and Tris/Tris–HCl/Tris–EDTA. The NaOH based direct PCR method is modified from the alkali based quick DNA extraction method developed by Wang et al. (1993). Since these methods work well with high gum containing species like ramie, we believe it will be useful for direct PCR for many plant species. 2. Materials and methods 2.1. Plant material Ramie (B. nivea L. Gaud) material was cv. R 67-94, grown at Central Research Institute for Jute and Allied Fibres, Kolkata, India. Leaf and stem samples were collected from 35 days old plant at active vegetative growth phase. Stem samples were collected from apical soft stem region as well as basal hard stem region. All samples were collected in polypropylene bags and stored at −20 ◦ C prior to use. 2.2. Direct PCR Three protocols for quick DNA extraction from plant tissues were first tested to develop a direct PCR amplification protocol in ramie using leaves, soft (upper) stem and hard (lower) stem tissues as described below. A total of four replicates (five samples per replicate) were tested for each method. 1. Rapid one step extraction method (ROSE) (Steiner et al., 1995) – Fresh tissues (50 mg) were ground in 500 l extraction buffer (10 mM Tris–HCl, pH 8.0; 312.5 mM EDTA, pH 8.0; 1% PVP; 1% sodium lauryl sulphate, SDS) in a 2 ml Eppendorf tube, and incubated at 90 ◦ C for 20 min, followed by freezing for 5 min. We used SDS instead of sodium lauryl sarcosinate, as it is more common anionic agent for DNA extraction (Goldenberger et al., 1995). 10 l of the extract were diluted in 1690 l of sterile H2 O. Five microlitre of the dilution was used as the DNA template for PCR.
2. Sucrose prep method (Berendzen et al., 2005) – DNA was extracted from fresh tissues (25 mg) on ice using 500 l extraction buffer (50 mM Tris–HCl, pH 7.5; 300 mM NaCl, 300 mM sucrose), heated at 99 ◦ C for 5 min and centrifuged at 5000 × g for 5 s. One microlitre of the dilution was used for PCR. 3. NaOH extraction method (Wang et al., 1993) – Tissue samples (30–50 mg) were ground in 300–500 l of 0.5–1.0 N NaOH in a 2 ml Eppendorf tube with the help of a small plastic pestle for a few minutes (alternatively, tissue can be ground in a mortar by pestle and transferred to tube). The material was then spun at 5000 × g for 30 s using a standard low speed bench top centrifuge to precipitate the large particles. Five microlitre of the supernatant was then diluted to 1:100 ratio in 0.1 M Tris (pH 8), vortexed for a few seconds and further diluted to 1:10 ratio in 0.1 M Tris (pH 8). At this stage, the material can be stored at −20 ◦ C or −80 ◦ C for future use if required. One microlitre of the solution was used as PCR template either in a 0.2 ml PCR tube or in strips of 8 tubes using multichannel pipettes. We have modified the original method by varying the concentration of NaOH used, by introducing an additional step of centrifugation to avoid pipetting of larger tissue particles and also by optimizing the dilution of the aliquot. The protocol was further modified by replacing Tris by Tris–HCl (0.1 M) or Tris–EDTA (0.1 M) in the dilution buffer. We also tried to use 1:1 dilution of the NaOH extract in Tris (0.1 M) to develop a single step PCR method. Here, after grinding of tissue samples in 0.5 M NaOH, equal volume of 0.1 M Tris (pH 8.0) was added in the same Eppendorf tube and 1 l of the solution was directly used as PCR template. PCR amplifications were carried out using the following protocols. The final reaction volume was 20 l containing 1 l (NaOH and Sucrose Prep methods) or 5 l (ROSE method) of template DNA, 2 l of 10× PCR buffer, 0.4 l of 10 pmol dNTPs (Invitrogen, USA), 0.4 l of 25 mM MgCl2 , 0.8–1.2 M of primers and 0.5 l of 3 U Taq DNA polymerase (Invitrogen, USA). The amplification was carried out in a thermal cycler (Agilent, USA) with following programme: 4 min at 94 ◦ C, 43 cycles of 1 min at 94 ◦ C, 1 min at primer specific annealing temperature and 2 min at 72 ◦ C followed by 8 min at 72 ◦ C for final extension. Three different marker systems, nuclear simple sequence repeat (SSR) from jute (Corchorus olitorius) (SSR 634), inter simple sequence repeat (ISSR) from potato (Solanum tuberosum) (SISSR 6) and primers for the chloroplast rbcL gene sequence were tested for direct PCR amplification (Table 1). Amplified products using ISSR and SSR primers were resolved at 1% agarose gel, while for chloroplast primer, 1.5% agarose gel was used. Amplified products were visualized and photographed using a gel documentation system (Biorad, USA). The intensity of the amplicons was compared using gel image analysis software (Quantity one Ver.4.6.3, Biorad, USA). 3. Results Out of ROSE, sucrose-prep and NaOH based DNA extraction methods, only the NaOH based direct PCR method yielded
534
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
Fig. 1. Direct PCR amplification from NaOH method (lanes 1–5), ROSE (lanes 6–10) and sucrose-prep (lanes 11–15) using ISSR marker. M – marker lane containing 50 bp DNA ladder.
Fig. 3. Direct PCR amplification for rbcL. Lane descriptions are same as in Fig. 2. M – marker lane containing 1 kb DNA ladder.
Fig. 2. Direct PCR amplification from leaf (lanes 1–4), soft stem (lanes 5–8) and hard stem (lanes 9–12) of ramie using ISSR (a) and SSR marker (b). A – 0.5 N NaOH, 1/100 dilution in Tris–EDTA, B – 0.5 N NaOH, 1/1000 dilution in Tris–EDTA, C – 1 N NaOH, 1/100 dilution in Tris–EDTA, D – 1 N NaOH, 1/1000 dilution in Tris–EDTA. M – marker lane containing 50 bp DNA ladder.
reliable PCR amplification from all the samples tested (95.0% strong amplification, 5.0% weak amplification) (Fig. 1). We did not find any strong amplification for ISSR marker using ROSE (20% weak amplification, 80% negative) and sucrose-prep (100% negative). The A260/280 ratio varied from 0.77 for the ROSE method to 1.36 for NaOH–Tris method. The DNA yield was also lowest for ROSE method (38.7 ng/l) and highest for NaOH–Tris method (288.5 ng/l). NaOH based direct PCR resulted in amplification of different size group amplicons ranging from 280 to 1380 bp. The ISSR marker designed from potato genome produced a total of five amplicons ranging from 280 to 720 bp in all the tissues, of which four exhibited weaker amplification (Fig. 2a). We have earlier used this ISSR marker in Hibiscus and obtained six amplicons (Satya et al., 2012). The SSR primer SSR 634, designed from a fibre crop species, Corchorus capsularis amplified a single fragment (650 bp) of equal intensity from all tissues, indicating possibility of cross-species transferability of SSR markers (Fig. 2b). The primer for rbcL amplified a single fragment of 1380 bp from all the tissues. The intensities of the fragment were higher from leaf tissues using 0.5–1.0 N NaOH at 1:100 and 1:1000 dilutions, while for soft stem tissues, the intensity was higher using 0.5 N NaOH at 1:100 dilution (Fig. 3). Use of 1:1000 dilution of extract from 0.5 N NaOH resulted in weaker amplification of rbcL gene from soft stem tissues. In case of hard
stem tissues, all the methods produced relatively weaker amplification. This result was expected, as the amount of chloroplast DNA gradually decreases from leaf tissues to soft and hard stem tissues. Sample extraction in NaOH followed by dilution in Tris, Tris–HCl or Tris–EDTA produced amplified fragments from leaf, soft stem and hard stem tissues of ramie for all the DNA marker systems (Fig. 4a). Treatment with Tris–HCl (A260/280 = 1.46) and Tris–EDTA
Fig. 4. Comparison of different dilution buffers, Tris (lanes 1–5), Tris–HCl (lanes 6–10) and Tris–EDTA (lanes 11–15) for direct PCR using NaOH based extraction using ISSR marker. (a) Electrophoresis pattern of SISSR 6, (b) comparative intensity of fragments of different molecular weight amplified using SISSR 6. M – marker lane containing 50 bp DNA ladder.
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
(A260/280 = 1.54) also improved DNA quality. For each treatment, two replicates of five samples were taken to estimate the reliability of the protocols. All these three methods provided distinct, reproducible amplification patterns for nuclear DNA markers (ISSR and SSR) and chloroplast DNA marker (rbcL). Dilution in Tris–EDTA exhibited stronger amplification compared to that of Tris–HCl (t4 ,0.01% = 4.72, Pr = 0.02) and Tris (t4 ,0.01% = 5.89, Pr = 0.01), suggesting Tris–EDTA as more efficient dilution buffer (Fig. 4b). We obtained good PCR amplification using 1:100 or 1:1000 dilutions of Tris/Tris–HCl/Tris–EDTA, but did not get any amplification from 1:1 dilution of these buffers.
4. Discussion Direct PCR is an attractive option in PCR based experiments because it eliminates DNA isolation step, which is very useful when large number of samples are processed. However, in the published literature for DNA marker and other PCR based experiments, there is limited use of direct PCR either for large scale genotyping, DNA barcoding, molecular breeding, transgene detection or other studies. The reasons may be issues related to reliability of direct PCR assays, suitability to different marker systems, storability of the extracts, DNA quality demanded by the protocol, or simple mental bias of the user towards DNA extraction based protocols. Our results suggest that direct PCR can increase efficiency and reduce cost of nuclear and chloroplast marker based genotyping; however, all direct PCR protocols may not be suitable for ramie. Since ramie tissues contain high amount of complex polysaccharides, sucrose may not be suitable for removal of these compounds. The detergent based ROSE method did not use any dilution, which may not work for tissues with high amount of complex polysaccharides. Further researches are thus necessary to increase the efficiency of these two methods in species like ramie. The NaOH based direct PCR methods described above required about 10–12 min to prepare PCR template including sample grinding, and another 2–2.5 h to complete PCR. It considerably reduces the time compared to other direct PCR methods described by Flores et al. (2012), which requires about 45 min to prepare sample for PCR or by Bellstedt et al. (2010), where considerable time is required for preparation of buffers. The method is also less expensive than other direct PCR methods. For example, it requires only two chemicals (NaOH and Tris/Tris–HCl/Tris–EDTA) compared to 10–15 chemicals required for direct PCR protocol described by Bellstedt et al. (2010). The final dilution exhibited successful PCR amplification after one week of storage at −20 ◦ C, indicating good stability of the extract. NaOH based DNA extraction method has been proved to be superior compared to other quick DNA extraction methods for fungi in terms of success rate, cost and speed of experiment with better storability of extract (Osmundson et al., 2013). The success of these methods may lie in the dilution factor, which tends to reduce the concentration of PCR inhibitors significantly (Wang et al., 1993). We have also failed to obtain any amplification in NaOH based extraction at 1:1 dilution, suggesting dilution may play critical role in success of PCR. As NaOH is itself used as major chemical agent for precipitation of gum from ramie fibre during degumming of fibre (Bruhlmann et al., 1994), the low speed centrifugation step might have precipitated some of the high molecular weight pectinaceous gummy materials bound with NaOH along with cellular debris. A low speed centrifugation step during DNA extraction has been proposed to remove polysaccharides from high polysaccharide containing plant tissues (Kaufman et al., 1999). Higher concentration of gum in lower part of the stem may be the reason for weaker PCR amplification at lower NaOH concentration (0.5 N) compared to higher concentration (1.0 N) in some reactions using hard stem, although for leaf and soft stem tissues all the concentrations were equally effective
535
for nuclear markers. The method is also observed to be effective to produce amplicons with broad size range (280–1380 bp). The direct PCR methods described here are simpler, cheaper and more rapid compared to other direct PCR systems and are expected to be very useful in projects having versatile PCR based applications. A single extraction process can produce 300 l extract, which is sufficient for 3 × 105 PCRs, allowing screening of large number of DNA markers at a time. Both ISSR and SSR reveal variation associated with nuclear repetitive DNA sequences dispersed throughout the genome, and are extensively used for genetic diversity analysis, genetic mapping, evolutionary and ecological genetic studies and molecular breeding in plants (Agarwal et al., 2008). The rbcL gene, coding the large subunit of ribulose 1,5 bisphosphate carboxylase/oxygenase (RUBISCO) is one of the most widely studied genes for plant phylogenetic analysis (Doebley et al., 1990; Chandler and Bayer, 2000; Kress and Erickson, 2007). Sequence comparison of rbcL gene has helped to establish monophylectic origin of Boehmeria in Urticaceae family (Hadiah et al., 2003). Successful amplification of nuclear repetitive DNA associated sequences and rbcL gene sequence proves suitability of the NaOH based direct PCR methods for PCR based studies on nuclear as well as organelle genome. Broad applicability of these methods for diverse DNA marker studies would help in large scale, high throughput genotyping for molecular breeding and genomics researches in ramie as well as in other plant species. Acknowledgements The authors acknowledge financial support for the research work from ‘National Fund for Basic, Strategic and Frontier Area Research in Agriculture, Indian Council of Agricultural Research’ (Project No. FQ 3030/2012-13) and also thank the two anonymous reviewers for their comments. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.indcrop.2013. 07.049. References Agarwal, M., Shrivastava, N., Padh, H., 2008. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports 27, 617–631. Bellstedt, D.U., Pirie, M.D., Visser, J.C., de Villiers, M.J., Gehrke, B., 2010. A rapid and inexpensive method for the direct PCR amplification of DNA from plants. American Journal of Botany, e65–e68, http://dx.doi.org/10.3732/ajb.1000181. Berendzen, K., Searle, I., Ravenscroft, D., Koncz, C., Batschauer, A., Coupland, G., Somssich, I.E., Ülker, B., 2005. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods 1, http://dx.doi.org/10.1186/1746-4811-1-4. Berthomieu, P., Meyer, C., 1991. Direct amplification of plant genomic DNA from leaf and root pieces using PCR. Plant Molecular Biology 17, 555–557. Bruhlmann, F., Kim, K.S., Zimmerman, T.W., Fiechter, A., 1994. Pectinolytic enzymes from actinomycetes for the degumming of ramie bast fibers. Applied and Environment Microbiology 60 (6), 2107–2112. Chandler, G.T., Bayer, R.J., 2000. Phylogenetic placement of the enigmatic Western Australian genus Emblingia based on rbcL sequences. Plant Species Biology 15, 67–72. Doebley, J., Durbin, M., Golenberg, E.M., Clegg, M.T., Ma, D.P., 1990. Evolutionary analysis of the large subunit of carboxylase (rbcL) nucleotide sequence among the grasses (Gramineae). Evolution 44, 1097–1108. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19, 11–15. Flores, G.E., Henley, J.B., Fierer, N., 2012. A direct PCR approach to accelerate analyses of human-associated microbial communities. PLoS ONE 7, e44563, http://dx.doi.org/10.1371/journal.pone.0 044563. Goldenberger, D., Perschil, I., Ritzler, M., Altwegg, M., 1995. A simple “universal” DNA extraction procedure using SDS and proteinase K is compatible with direct PCR amplification. Genome Research 4, 368–370. Hadiah, J.T., Quinn, C.J., Conn, B.J., 2003. Phylogeny of Elatostema (Urticaceae) using chloroplast DNA data. Telopia 10 (1), 235–246.
536
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
Huang, K.L., Lai, Y.K., Lin, C.C., Chang, J.M., 2009. Involvement of GRP78 in inhibition of HBV secretion by Boehmeria nivea extract in human HepG2 2.2.15 cells. Journal of Viral Hepatitis 16, 367–375. Kaufman, B., Richards, S., Dierig, D.A., 1999. DNA isolation method for high polysaccharide Lesquerella species. Industrial Crops and Products 9, 111–114. Kirby, R.H., 1963. Vegetable Fibres. World Crops Books, Leonard Hill, London. Kress, W.J., Erickson, D.L., 2007. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2 (6), e508, http://dx.doi.org/10.1371/journal.pone.0000508. Li, C.I., Chiou, S.J., Tong, T.S., Lee, C.Y., Lee, L.T., Cheng, C.M., 2010. Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima. Chinese Medicine 5 (40.), http://dx.doi.org/10.1186/1749-8546-5-40. Liang, L., Li, T.J., Liu, Z.L., Deng, H.S., Xu, L.L., Pan, Q.H., Lai, Z.J., Shi, Q.H., 2009. Phylogenetic relationship of ramie and its wild relatives based on cytogenetic and DNA sequence analyses. Acta Agronomica Sinica 35, 1778–1790, http://dx.doi.org/10.1016/S1875-2780(08)60107-8. Lin, C.C., Yen, M.H., Lo, T.S., Lin, J.M., 1998. Evaluation of the hepatoprotective and antioxidant activity of Boehmeria nivea var. nivea and B. nivea var. tenacissima. Journal of Ethnopharmacology 60, 9–17.
Mullis, K.B., Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods in Enzymology 155, 335–350. Osmundson, T.W., Eyre, C.A., Hayden, K.M., Dhillon, J., Garbelotto, M.M., 2013. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples. Molecular Ecology Resources 13, 66–74. Rogers, H.G., Parkes, H.C., 1999. Direct PCR amplification from leaf discs. Plant Science 143, 183–186. Sarkar, D., Sinha, M.K., Kundu, A., Kar, C.S., Saha, A., Kharbikar, L.L., Mahapatra, B.S., 2010. Why is ramie the strongest yet stiffest bast fibre? Current Science 98, 1570–1572. Satya, P., Karan, M., Sarkar, D., Sinha, M.K., 2012. Genome synteny and evolution of AABB allotetraploids in Hibiscus section Furcaria revealed by interspecific hybridization, ISSR and SSR markers. Plant Systematics and Evolution 298 (7), 1257–1270, http://dx.doi.org/10.1007/s00606-012-0632-6. Steiner, J.J., Poklemba, C.J., Fjellstrom, R.G., Elliott, L.F., 1995. A rapid one-tube genomic DNA extraction process for PCR and RAPD analyses. Nucleic Acids Research 23, 2569. Wang, H., Qi, M., Cutler, A.J., 1993. A simple method of preparing plant samples for PCR. Nucleic Acids Research 21, 4153–4154.
Contents lists available at ScienceDirect
Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop
Rapid and inexpensive NaOH based direct PCR for amplification of nuclear and organelle DNA from ramie (Boehmeria nivea), a bast fibre crop containing complex polysaccharides Pratik Satya a,∗ , Sabyasachi Mitra a , D.P. Ray b , B.S. Mahapatra a , M. Karan a , S. Jana a , A.K. Sharma a,b a b
Central Research Institute for Jute and Allied Fibres, Barrackpore, Kolkata, India National Institute of Research on Jute and Allied Fibre Technology, Kolkata, India
a r t i c l e
i n f o
Article history: Received 20 April 2013 Received in revised form 23 July 2013 Accepted 27 July 2013 Keywords: Ramie Boehmeria nivea Direct PCR NaOH Dilution Polysaccharides
a b s t r a c t Most of the PCR based approaches in plant science rely on lengthy and expensive DNA isolation protocols, which often involve use of hazardous chemicals. Direct PCR methods save time and cost of experiments and also increase efficiency of PCR. We have compared three rapid DNA extraction processes for direct PCR in ramie (Boehmeria nivea), a fibre crop species containing high amount of gummy complex polysaccharides and developed modified protocols for direct PCR using NaOH as extraction buffer and Tris/Tris–HCl/Tris–EDTA as dilution buffer. These protocols were successful in amplification of nuclear DNA from leaf and stem tissues using ISSR and SSR markers and also chloroplast DNA amplification using primers for rbcL gene. Our results also show that nature and quantity of dilution buffer are important for increasing efficiency of direct PCR. The NaOH based methods are simpler, cheaper and economical compared to other direct PCR methods and work very well for tissues containing high amount of complex polysaccharides. The protocols are suitable for batch processing and high throughput genotyping within a short time period, which will have many applications in plant genomic researches. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Polymerase chain reaction (PCR) is a DNA amplification procedure routinely used in molecular biology and biotechnology experiments. Typically, the template DNA for PCR amplification is extracted from a source organism followed by targeted amplification of gene/DNA sequences using random or specifically designed primers (Mullis and Faloona, 1987). PCR is extensively used for DNA marker based studies, DNA sequencing, cloning and identification of transformants, DNA barcoding, mutant identification, forensic studies and many other biological studies. PCR based DNA markers have versatile applications in plants from genotype identification, purity testing, genetic map construction, gene discovery, QTL mapping and marker assisted crop improvement (Agarwal et al., 2008). DNA extraction is an integral component of all the PCR based experiments. To improve the speed and efficiency of PCR, numerous protocols have been developed to reduce the time period and to improve the quality of extracted DNA, most of which are based on hexadecyltrimethylammonium bromide (CTAB) or sodium dodecyl sulfate (SDS), ionic detergents used to disrupt tissues for releasing DNA from cell (Doyle and Doyle, 1987; Goldenberger et al., 1995).
∗ Corresponding author. Tel.: +91 3325350415. E-mail address: [email protected] (P. Satya). 0926-6690/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.indcrop.2013.07.049
DNA extraction based on these methods requires about 24–48 h before the DNA is ready for PCR (Bellstedt et al., 2010). A number of commercial kits are also available for plant DNA extraction, which are more efficient but are expensive. To eliminate the time consuming DNA extraction step from PCR, direct PCR amplification from ground plant tissues has been proposed (Berthomieu and Meyer, 1991). By reducing the pre-PCR steps from days to hours, direct PCR methods allow large scale processing of samples and minimize costs involved in DNA extraction. In spite of these advantages, only a few direct PCR protocols have been developed to date for plant species because of low success rate due to low yield of DNA and presence of inhibiting compounds like sugars, proteins and phenolics in reaction mixture (Rogers and Parkes, 1999). Some of these protocols are single step PCR, avoiding any storage of the extract (Rogers and Parkes, 1999), while others involve two or more sequential steps involving extraction of the tissue in one buffer followed by PCR amplification of the aliquot in reaction mixture (Bellstedt et al., 2010; Flores et al., 2012), which permit intermediate storage of the extract for longer periods. Ramie, rhea or China grass (Boehmeria nivea (L.) Gaud.) is a perennial fibre crop producing high quality bast fibre for textile applications. The history of ramie cultivation is at least 5000 years old in China and Indo-Malay peninsula (Kirby, 1963; Liang et al., 2009). It is also grown in Japan, Brazil, the Philippines, India and
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
533
Table 1 List of primers used in the experiment. SL No.
Primer name
1
SISSR 6
Sequence (5 –3 )
Primer length (nt)
Annealing temperature (◦ C)
Amplicon size (bp)
BDB(CAC)5
18
56.0
280–720
2
SSR 634
F R
GGAGAATATAAGGCCGCGTAG CAGCGGTGTAAGGCTCTCTC
21 20
51.0
650
3
rbcL
F R
ATGTCACCACAAACAGAAACTAAAGCAAGT CTTCACAAGCAGCAGCTAGTTCAGGACTCC
30 30
48.0
1380
B – (C, G, T); D – (A, G, T).
Korea. The fibre produced from ramie is strongest of all known plant based fibres bearing more than twofold strength of cotton fibre with a very high fibre cell length/breadth ratio (>3500) (Sarkar et al., 2010). Besides, the fibre bears additional useful properties, such as resistance to bacterial degradation and higher tensile strength under hygroscopic condition. The root of the plant is also used for medicinal purpose as antioxidant, anti-inflammatory and hepatoprotective agent (Lin et al., 1998; Huang et al., 2009). The stem of ramie contains high amount of mucilaginous and complex pectinaceous substances, commonly described as gum. During processing, the gummy substances are removed chemically or enzymatically before fibre extraction (Bruhlmann et al., 1994). Presence of such complex polysaccharides reduces the efficiency of CTAB based DNA isolation methods and also may interfere with PCR (Kaufman et al., 1999). There are some reports of extraction of genomic DNA from cotyledons or young ramie leaves using CTAB based methods (Liang et al., 2009; Li et al., 2010), but no rapid method for direct PCR or quick DNA extraction from leaves or stem is available. Here we describe methods for direct PCR from ramie stem and leaf tissues, using NaOH and Tris/Tris–HCl/Tris–EDTA. The NaOH based direct PCR method is modified from the alkali based quick DNA extraction method developed by Wang et al. (1993). Since these methods work well with high gum containing species like ramie, we believe it will be useful for direct PCR for many plant species. 2. Materials and methods 2.1. Plant material Ramie (B. nivea L. Gaud) material was cv. R 67-94, grown at Central Research Institute for Jute and Allied Fibres, Kolkata, India. Leaf and stem samples were collected from 35 days old plant at active vegetative growth phase. Stem samples were collected from apical soft stem region as well as basal hard stem region. All samples were collected in polypropylene bags and stored at −20 ◦ C prior to use. 2.2. Direct PCR Three protocols for quick DNA extraction from plant tissues were first tested to develop a direct PCR amplification protocol in ramie using leaves, soft (upper) stem and hard (lower) stem tissues as described below. A total of four replicates (five samples per replicate) were tested for each method. 1. Rapid one step extraction method (ROSE) (Steiner et al., 1995) – Fresh tissues (50 mg) were ground in 500 l extraction buffer (10 mM Tris–HCl, pH 8.0; 312.5 mM EDTA, pH 8.0; 1% PVP; 1% sodium lauryl sulphate, SDS) in a 2 ml Eppendorf tube, and incubated at 90 ◦ C for 20 min, followed by freezing for 5 min. We used SDS instead of sodium lauryl sarcosinate, as it is more common anionic agent for DNA extraction (Goldenberger et al., 1995). 10 l of the extract were diluted in 1690 l of sterile H2 O. Five microlitre of the dilution was used as the DNA template for PCR.
2. Sucrose prep method (Berendzen et al., 2005) – DNA was extracted from fresh tissues (25 mg) on ice using 500 l extraction buffer (50 mM Tris–HCl, pH 7.5; 300 mM NaCl, 300 mM sucrose), heated at 99 ◦ C for 5 min and centrifuged at 5000 × g for 5 s. One microlitre of the dilution was used for PCR. 3. NaOH extraction method (Wang et al., 1993) – Tissue samples (30–50 mg) were ground in 300–500 l of 0.5–1.0 N NaOH in a 2 ml Eppendorf tube with the help of a small plastic pestle for a few minutes (alternatively, tissue can be ground in a mortar by pestle and transferred to tube). The material was then spun at 5000 × g for 30 s using a standard low speed bench top centrifuge to precipitate the large particles. Five microlitre of the supernatant was then diluted to 1:100 ratio in 0.1 M Tris (pH 8), vortexed for a few seconds and further diluted to 1:10 ratio in 0.1 M Tris (pH 8). At this stage, the material can be stored at −20 ◦ C or −80 ◦ C for future use if required. One microlitre of the solution was used as PCR template either in a 0.2 ml PCR tube or in strips of 8 tubes using multichannel pipettes. We have modified the original method by varying the concentration of NaOH used, by introducing an additional step of centrifugation to avoid pipetting of larger tissue particles and also by optimizing the dilution of the aliquot. The protocol was further modified by replacing Tris by Tris–HCl (0.1 M) or Tris–EDTA (0.1 M) in the dilution buffer. We also tried to use 1:1 dilution of the NaOH extract in Tris (0.1 M) to develop a single step PCR method. Here, after grinding of tissue samples in 0.5 M NaOH, equal volume of 0.1 M Tris (pH 8.0) was added in the same Eppendorf tube and 1 l of the solution was directly used as PCR template. PCR amplifications were carried out using the following protocols. The final reaction volume was 20 l containing 1 l (NaOH and Sucrose Prep methods) or 5 l (ROSE method) of template DNA, 2 l of 10× PCR buffer, 0.4 l of 10 pmol dNTPs (Invitrogen, USA), 0.4 l of 25 mM MgCl2 , 0.8–1.2 M of primers and 0.5 l of 3 U Taq DNA polymerase (Invitrogen, USA). The amplification was carried out in a thermal cycler (Agilent, USA) with following programme: 4 min at 94 ◦ C, 43 cycles of 1 min at 94 ◦ C, 1 min at primer specific annealing temperature and 2 min at 72 ◦ C followed by 8 min at 72 ◦ C for final extension. Three different marker systems, nuclear simple sequence repeat (SSR) from jute (Corchorus olitorius) (SSR 634), inter simple sequence repeat (ISSR) from potato (Solanum tuberosum) (SISSR 6) and primers for the chloroplast rbcL gene sequence were tested for direct PCR amplification (Table 1). Amplified products using ISSR and SSR primers were resolved at 1% agarose gel, while for chloroplast primer, 1.5% agarose gel was used. Amplified products were visualized and photographed using a gel documentation system (Biorad, USA). The intensity of the amplicons was compared using gel image analysis software (Quantity one Ver.4.6.3, Biorad, USA). 3. Results Out of ROSE, sucrose-prep and NaOH based DNA extraction methods, only the NaOH based direct PCR method yielded
534
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
Fig. 1. Direct PCR amplification from NaOH method (lanes 1–5), ROSE (lanes 6–10) and sucrose-prep (lanes 11–15) using ISSR marker. M – marker lane containing 50 bp DNA ladder.
Fig. 3. Direct PCR amplification for rbcL. Lane descriptions are same as in Fig. 2. M – marker lane containing 1 kb DNA ladder.
Fig. 2. Direct PCR amplification from leaf (lanes 1–4), soft stem (lanes 5–8) and hard stem (lanes 9–12) of ramie using ISSR (a) and SSR marker (b). A – 0.5 N NaOH, 1/100 dilution in Tris–EDTA, B – 0.5 N NaOH, 1/1000 dilution in Tris–EDTA, C – 1 N NaOH, 1/100 dilution in Tris–EDTA, D – 1 N NaOH, 1/1000 dilution in Tris–EDTA. M – marker lane containing 50 bp DNA ladder.
reliable PCR amplification from all the samples tested (95.0% strong amplification, 5.0% weak amplification) (Fig. 1). We did not find any strong amplification for ISSR marker using ROSE (20% weak amplification, 80% negative) and sucrose-prep (100% negative). The A260/280 ratio varied from 0.77 for the ROSE method to 1.36 for NaOH–Tris method. The DNA yield was also lowest for ROSE method (38.7 ng/l) and highest for NaOH–Tris method (288.5 ng/l). NaOH based direct PCR resulted in amplification of different size group amplicons ranging from 280 to 1380 bp. The ISSR marker designed from potato genome produced a total of five amplicons ranging from 280 to 720 bp in all the tissues, of which four exhibited weaker amplification (Fig. 2a). We have earlier used this ISSR marker in Hibiscus and obtained six amplicons (Satya et al., 2012). The SSR primer SSR 634, designed from a fibre crop species, Corchorus capsularis amplified a single fragment (650 bp) of equal intensity from all tissues, indicating possibility of cross-species transferability of SSR markers (Fig. 2b). The primer for rbcL amplified a single fragment of 1380 bp from all the tissues. The intensities of the fragment were higher from leaf tissues using 0.5–1.0 N NaOH at 1:100 and 1:1000 dilutions, while for soft stem tissues, the intensity was higher using 0.5 N NaOH at 1:100 dilution (Fig. 3). Use of 1:1000 dilution of extract from 0.5 N NaOH resulted in weaker amplification of rbcL gene from soft stem tissues. In case of hard
stem tissues, all the methods produced relatively weaker amplification. This result was expected, as the amount of chloroplast DNA gradually decreases from leaf tissues to soft and hard stem tissues. Sample extraction in NaOH followed by dilution in Tris, Tris–HCl or Tris–EDTA produced amplified fragments from leaf, soft stem and hard stem tissues of ramie for all the DNA marker systems (Fig. 4a). Treatment with Tris–HCl (A260/280 = 1.46) and Tris–EDTA
Fig. 4. Comparison of different dilution buffers, Tris (lanes 1–5), Tris–HCl (lanes 6–10) and Tris–EDTA (lanes 11–15) for direct PCR using NaOH based extraction using ISSR marker. (a) Electrophoresis pattern of SISSR 6, (b) comparative intensity of fragments of different molecular weight amplified using SISSR 6. M – marker lane containing 50 bp DNA ladder.
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
(A260/280 = 1.54) also improved DNA quality. For each treatment, two replicates of five samples were taken to estimate the reliability of the protocols. All these three methods provided distinct, reproducible amplification patterns for nuclear DNA markers (ISSR and SSR) and chloroplast DNA marker (rbcL). Dilution in Tris–EDTA exhibited stronger amplification compared to that of Tris–HCl (t4 ,0.01% = 4.72, Pr = 0.02) and Tris (t4 ,0.01% = 5.89, Pr = 0.01), suggesting Tris–EDTA as more efficient dilution buffer (Fig. 4b). We obtained good PCR amplification using 1:100 or 1:1000 dilutions of Tris/Tris–HCl/Tris–EDTA, but did not get any amplification from 1:1 dilution of these buffers.
4. Discussion Direct PCR is an attractive option in PCR based experiments because it eliminates DNA isolation step, which is very useful when large number of samples are processed. However, in the published literature for DNA marker and other PCR based experiments, there is limited use of direct PCR either for large scale genotyping, DNA barcoding, molecular breeding, transgene detection or other studies. The reasons may be issues related to reliability of direct PCR assays, suitability to different marker systems, storability of the extracts, DNA quality demanded by the protocol, or simple mental bias of the user towards DNA extraction based protocols. Our results suggest that direct PCR can increase efficiency and reduce cost of nuclear and chloroplast marker based genotyping; however, all direct PCR protocols may not be suitable for ramie. Since ramie tissues contain high amount of complex polysaccharides, sucrose may not be suitable for removal of these compounds. The detergent based ROSE method did not use any dilution, which may not work for tissues with high amount of complex polysaccharides. Further researches are thus necessary to increase the efficiency of these two methods in species like ramie. The NaOH based direct PCR methods described above required about 10–12 min to prepare PCR template including sample grinding, and another 2–2.5 h to complete PCR. It considerably reduces the time compared to other direct PCR methods described by Flores et al. (2012), which requires about 45 min to prepare sample for PCR or by Bellstedt et al. (2010), where considerable time is required for preparation of buffers. The method is also less expensive than other direct PCR methods. For example, it requires only two chemicals (NaOH and Tris/Tris–HCl/Tris–EDTA) compared to 10–15 chemicals required for direct PCR protocol described by Bellstedt et al. (2010). The final dilution exhibited successful PCR amplification after one week of storage at −20 ◦ C, indicating good stability of the extract. NaOH based DNA extraction method has been proved to be superior compared to other quick DNA extraction methods for fungi in terms of success rate, cost and speed of experiment with better storability of extract (Osmundson et al., 2013). The success of these methods may lie in the dilution factor, which tends to reduce the concentration of PCR inhibitors significantly (Wang et al., 1993). We have also failed to obtain any amplification in NaOH based extraction at 1:1 dilution, suggesting dilution may play critical role in success of PCR. As NaOH is itself used as major chemical agent for precipitation of gum from ramie fibre during degumming of fibre (Bruhlmann et al., 1994), the low speed centrifugation step might have precipitated some of the high molecular weight pectinaceous gummy materials bound with NaOH along with cellular debris. A low speed centrifugation step during DNA extraction has been proposed to remove polysaccharides from high polysaccharide containing plant tissues (Kaufman et al., 1999). Higher concentration of gum in lower part of the stem may be the reason for weaker PCR amplification at lower NaOH concentration (0.5 N) compared to higher concentration (1.0 N) in some reactions using hard stem, although for leaf and soft stem tissues all the concentrations were equally effective
535
for nuclear markers. The method is also observed to be effective to produce amplicons with broad size range (280–1380 bp). The direct PCR methods described here are simpler, cheaper and more rapid compared to other direct PCR systems and are expected to be very useful in projects having versatile PCR based applications. A single extraction process can produce 300 l extract, which is sufficient for 3 × 105 PCRs, allowing screening of large number of DNA markers at a time. Both ISSR and SSR reveal variation associated with nuclear repetitive DNA sequences dispersed throughout the genome, and are extensively used for genetic diversity analysis, genetic mapping, evolutionary and ecological genetic studies and molecular breeding in plants (Agarwal et al., 2008). The rbcL gene, coding the large subunit of ribulose 1,5 bisphosphate carboxylase/oxygenase (RUBISCO) is one of the most widely studied genes for plant phylogenetic analysis (Doebley et al., 1990; Chandler and Bayer, 2000; Kress and Erickson, 2007). Sequence comparison of rbcL gene has helped to establish monophylectic origin of Boehmeria in Urticaceae family (Hadiah et al., 2003). Successful amplification of nuclear repetitive DNA associated sequences and rbcL gene sequence proves suitability of the NaOH based direct PCR methods for PCR based studies on nuclear as well as organelle genome. Broad applicability of these methods for diverse DNA marker studies would help in large scale, high throughput genotyping for molecular breeding and genomics researches in ramie as well as in other plant species. Acknowledgements The authors acknowledge financial support for the research work from ‘National Fund for Basic, Strategic and Frontier Area Research in Agriculture, Indian Council of Agricultural Research’ (Project No. FQ 3030/2012-13) and also thank the two anonymous reviewers for their comments. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.indcrop.2013. 07.049. References Agarwal, M., Shrivastava, N., Padh, H., 2008. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Reports 27, 617–631. Bellstedt, D.U., Pirie, M.D., Visser, J.C., de Villiers, M.J., Gehrke, B., 2010. A rapid and inexpensive method for the direct PCR amplification of DNA from plants. American Journal of Botany, e65–e68, http://dx.doi.org/10.3732/ajb.1000181. Berendzen, K., Searle, I., Ravenscroft, D., Koncz, C., Batschauer, A., Coupland, G., Somssich, I.E., Ülker, B., 2005. A rapid and versatile combined DNA/RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods 1, http://dx.doi.org/10.1186/1746-4811-1-4. Berthomieu, P., Meyer, C., 1991. Direct amplification of plant genomic DNA from leaf and root pieces using PCR. Plant Molecular Biology 17, 555–557. Bruhlmann, F., Kim, K.S., Zimmerman, T.W., Fiechter, A., 1994. Pectinolytic enzymes from actinomycetes for the degumming of ramie bast fibers. Applied and Environment Microbiology 60 (6), 2107–2112. Chandler, G.T., Bayer, R.J., 2000. Phylogenetic placement of the enigmatic Western Australian genus Emblingia based on rbcL sequences. Plant Species Biology 15, 67–72. Doebley, J., Durbin, M., Golenberg, E.M., Clegg, M.T., Ma, D.P., 1990. Evolutionary analysis of the large subunit of carboxylase (rbcL) nucleotide sequence among the grasses (Gramineae). Evolution 44, 1097–1108. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19, 11–15. Flores, G.E., Henley, J.B., Fierer, N., 2012. A direct PCR approach to accelerate analyses of human-associated microbial communities. PLoS ONE 7, e44563, http://dx.doi.org/10.1371/journal.pone.0 044563. Goldenberger, D., Perschil, I., Ritzler, M., Altwegg, M., 1995. A simple “universal” DNA extraction procedure using SDS and proteinase K is compatible with direct PCR amplification. Genome Research 4, 368–370. Hadiah, J.T., Quinn, C.J., Conn, B.J., 2003. Phylogeny of Elatostema (Urticaceae) using chloroplast DNA data. Telopia 10 (1), 235–246.
536
P. Satya et al. / Industrial Crops and Products 50 (2013) 532–536
Huang, K.L., Lai, Y.K., Lin, C.C., Chang, J.M., 2009. Involvement of GRP78 in inhibition of HBV secretion by Boehmeria nivea extract in human HepG2 2.2.15 cells. Journal of Viral Hepatitis 16, 367–375. Kaufman, B., Richards, S., Dierig, D.A., 1999. DNA isolation method for high polysaccharide Lesquerella species. Industrial Crops and Products 9, 111–114. Kirby, R.H., 1963. Vegetable Fibres. World Crops Books, Leonard Hill, London. Kress, W.J., Erickson, D.L., 2007. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2 (6), e508, http://dx.doi.org/10.1371/journal.pone.0000508. Li, C.I., Chiou, S.J., Tong, T.S., Lee, C.Y., Lee, L.T., Cheng, C.M., 2010. Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima. Chinese Medicine 5 (40.), http://dx.doi.org/10.1186/1749-8546-5-40. Liang, L., Li, T.J., Liu, Z.L., Deng, H.S., Xu, L.L., Pan, Q.H., Lai, Z.J., Shi, Q.H., 2009. Phylogenetic relationship of ramie and its wild relatives based on cytogenetic and DNA sequence analyses. Acta Agronomica Sinica 35, 1778–1790, http://dx.doi.org/10.1016/S1875-2780(08)60107-8. Lin, C.C., Yen, M.H., Lo, T.S., Lin, J.M., 1998. Evaluation of the hepatoprotective and antioxidant activity of Boehmeria nivea var. nivea and B. nivea var. tenacissima. Journal of Ethnopharmacology 60, 9–17.
Mullis, K.B., Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods in Enzymology 155, 335–350. Osmundson, T.W., Eyre, C.A., Hayden, K.M., Dhillon, J., Garbelotto, M.M., 2013. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples. Molecular Ecology Resources 13, 66–74. Rogers, H.G., Parkes, H.C., 1999. Direct PCR amplification from leaf discs. Plant Science 143, 183–186. Sarkar, D., Sinha, M.K., Kundu, A., Kar, C.S., Saha, A., Kharbikar, L.L., Mahapatra, B.S., 2010. Why is ramie the strongest yet stiffest bast fibre? Current Science 98, 1570–1572. Satya, P., Karan, M., Sarkar, D., Sinha, M.K., 2012. Genome synteny and evolution of AABB allotetraploids in Hibiscus section Furcaria revealed by interspecific hybridization, ISSR and SSR markers. Plant Systematics and Evolution 298 (7), 1257–1270, http://dx.doi.org/10.1007/s00606-012-0632-6. Steiner, J.J., Poklemba, C.J., Fjellstrom, R.G., Elliott, L.F., 1995. A rapid one-tube genomic DNA extraction process for PCR and RAPD analyses. Nucleic Acids Research 23, 2569. Wang, H., Qi, M., Cutler, A.J., 1993. A simple method of preparing plant samples for PCR. Nucleic Acids Research 21, 4153–4154.