- Email: [email protected]
Rapid and sensitive detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick
Journal of Virological Methods 181 (2012) 117–124
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Rapid and sensitive detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick Su-Ming Tsai a , Hung-Jen Liu b , Jui-Hung Shien c , Long-Huw Lee c , Po-Chung Chang a , Chi-Young Wang c,∗ a
Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan Institute of Molecular Biology, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan c Department of Veterinary Medicine, College of Veterinary Medicine, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan b
a b s t r a c t Article history: Received 5 April 2011 Received in revised form 25 August 2011 Accepted 1 September 2011 Available online 7 September 2011 Keywords: Infectious bursal disease virus Reverse transcription loop-mediated isothermal amplification (RT-LAMP) Nested RT-PCR Lateral flow dipstick (LFD)
Infectious bursal disease (IBD), an immunosuppressive disease that affects all ages of chickens, results in significant losses in the poultry industry. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) combined with a chromatographic lateral flow dipstick (LFD) for the detection of infectious bursal disease virus (IBDV) was developed. The whole process of testing can be completed in less than 70 min using biotin-labeled primers, an FITC-labeled DNA probe, and the LFD. The detection limits for IBDV using RT-LAMP and RT-LAMP-LFD were the same at 10−1 plaque forming units (PFU). When other unrelated viruses and cells were tested, no false positive results were observed. In addition, the amplification efficiency of RT-LAMP was enhanced when a loop primer was used. The RT-LAMP-LFD product started to be detected after 40 min. Clinical samples were used to compare assays using RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD and the positive rates were 16%, 40%, 40%, and 40%, respectively. In conclusion, this assay is an easy, rapid, accurate, and sensitive method for the detection of IBDV and will improve the screening of field samples, especially when veterinarians have limited resources. © 2011 Elsevier B.V. All rights reserved.
Infectious bursal disease (IBD) is a contagious and immunosuppressive disease of young chickens. It is caused by infectious bursal disease virus (IBDV), which belongs to the genus Avibirnavirus of the Birnaviridae (Azad et al., 1985). There are two serotypes. Serotype 1 is pathogenic and causes severe destructions of the dividing and differentiating B lymphocytes in the bursa of Fabricius. This leads to deficiencies in the humoral immunity and makes birds vulnerable to other bacterial and viral infections (Burkhardt and Muller, 1987). IBD still causes serious economic losses in the poultry industry worldwide (Saif, 1991). IBDV is a non-enveloped icosahedral virus with a diameter of 60 nm and its genome consists of two segments of double stranded RNA (Kibenge et al., 1988). A 110 kDa polyprotein (pVP2–VP3–VP4), which is encoded by an open reading frame (ORF) of segment A is cleaved proteolytically into two structural proteins (VP2 and VP3) and a viral protease (VP4) (Muller and Nitschke, 1987). The 38 kDa viral capsid protein VP2, which can elicit neutralizing antibodies is the primary determinant of viral serotype (Fahey et al., 1989). The 91 kDa VP1 encoded by an ORF of segment B is a double stranded RNA polymerase as well as a capping enzyme and methyltransferase
∗ Corresponding author. Tel.: +886 4 22840369 48; fax: +886 4 22862073. E-mail address: [email protected] (C.-Y. Wang). 0166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2011.09.002
(Spies et al., 1987; Spies and Muller, 1990). To date, immunoassays and molecular biology techniques such as ELISA, agar gel precipitation (AGP), immunofluorescence assays, neutralization assays, probe hybridization, reverse-transcription polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction have been used for the routine diagnosis (Kataria et al., 2001). Most of these methods require a long processing time, the availability of expensive equipments, and trained operators (Liu et al., 2001; Qian and Kibenge, 1996; Stram et al., 1994; Wu et al., 2007). Recently, a number of auto-cycling cDNA synthesis methods have been invented and applied for the detection of avian pathogens including avian influenza virus (AIV), Newcastle disease virus (NDV), and IBDV (Chen et al., 2008; Curtis et al., 2008; Li et al., 2009; Notomi et al., 2000; Xu et al., 2009; Xue et al., 2009). One of these is RT-LAMP, where the concomitant bindings of four to six primers and the presence of reverse transcriptase together with Bst DNA polymerase allow the DNA amplification of a target sequence. After amplification, the restriction enzyme digestion or the nucleotide hybridization can be used to validate the specificity of the RT-LAMP products (Tsai et al., 2009). In this study, a RT-LAMP combined a lateral flow dipstick (LFD) was developed for the detection of IBDV. RT-LAMP products amplified using biotin-labeled primers were hybridized with a FITC-labeled probe. This hybrid was then bounded dually to the
118
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 1. Sequence alignment of the partial VP2 gene of IBDVs (GenBank accession nos. AF109154, AF279287, AF279288, AF303219, AF312371, AF499929, AF533670, D10065, DQ355819, and X92760). The regions used to design the inner primers (FIP and BIP), the outer primers (F3 and B3), the loop primer (LB), and the FITC-conjugated probe (IBDV-P) as well as the position of a restriction enzyme site (Bts I) are denoted. Nucleotide position numbers are primarily based on GenBank accession no. AF109154. Dots are used to represent omitted sequences.
gold-labeled anti-FITC antibody and the anti-biotin antibody coated on a LFD. The final complexes were trapped at the test line of the LFD. Otherwise, without the FITC probe, complexes bound with the gold-labeled anti-FITC antibody were trapped only at the control line. This approach has been used successfully to develop tests for infectious spleen and kidney necrosis virus, shrimp hepatopancreatic parvovirus, shrimp infectious myonecrosis virus, and Penaeus monodon nucleopolyhedronvirus (PemoNPV) (Ding et al., 2010; Nimitphak et al., 2008, 2010; Puthawibool et al., 2009). This system is a user friendly alternative to other techniques and is both rapid and sensitive, while at the same time showing the excellent specificity. This test possesses the great potential when applied in the field. The P3009 strain of IBDV (GenBank accession number AF109154) was propagated in DF-1 cells cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 5% fetal bovine serum. At 48 hpi, total RNA was extracted using Trizol reagent (MD Bio, Taipei, Taiwan) according to the manufacturer’s instructions. For the field samples and other viruses, RNA was also extracted using the above reagent. The cDNA amplification used RNA, 1× RT buffer, 5 units of reverse transcriptase (RTAce, Toyobo, Osaka, Japan), 1 mM
each dNTP, 0.4 mM P1 primer, and 0.4 mM P2 primer. PCR or nested PCR was carried out in cDNA, 1× PCR buffer, 1.5 mM MgCl2 , 0.2 mM each dNTP, 0.4 mM of both P1 and P2 primers or both P3 and P4 primers, and 0.2 units of Taq polymerase (MD Bio). For synthesis of cDNA, the RT-PCR reaction was performed initially at 42 ◦ C for 1 h and then 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 60 ◦ C for 1 min, and 72 ◦ C for 1 min and a final extension at 72 ◦ C for 10 min. The nested RT-PCR was subjected to 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, and 72 ◦ C for 1 min and a final extension at 72 ◦ C for 10 min. Ten microliters of either the RT-PCR or nested RT-PCR products were then separated by 2% agarose gel electrophoresis. The RT-PCR primers (P1 and P2 primers) and the nested RT-PCR primers (P3 and P4 primers) were described by Liu et al. (2001) and Giambrone and Dormitorio (1997), respectively. The aim of this study was to develop an universal assay for the detection of different strains of IBDV. Selected IBDV strains were used, including several recent Taiwan isolates, vaccine strains, and a number of very virulent IBDV isolates (Liu et al., 2001). Taking into account the fact that the VP2 gene of IBDV is used frequently as the target for the detection of
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
119
Table 1 The primers and probe used for the detection of IBDV. Type
Sequences (5 –3 )
Nucleotide positionf
IBDV-P1 IBDV-P2a IBDV-P3b IBDV-P4b F3c B3c FIP(F1c + F2)c , d
Forward outer Reverse outer Forward inner Reverse inner Forward outer Reverse outer Forward inner
TCACCGTCCTCAGCTTAC TCAGGATTGGGATCAGC GCCCAGAGTCTACACCATAACTGC GCGACCGTAACGACAGATCC CCCAGCCAATCACATCCATC TCAGCTCGAAGTTGCTCAC ACTGCTAGGCTCCCACTTGCTCCAAAAGTGGTGGTCAGGC
BIP(B1c + B2)c
Reverse inner
AACTATCCAGGGGCCCTCCGKGCGACCGTAACGACRGA
LBc IBDV-Pe
Reverse loop Probe
CCGTCACACTAGTAGCCTATGAAAG GGGACCAGATGTCATGG
515–532 1140–1157 630–653 1102–1121 929–948 1126–1144 F1c:1009–1028 F2:967–986 B1c:1045–1064 B2:1105–1122 1067–1091 989–1005
Primer name a
a b c d e f
RT-PCR primers. Nested RT-PCR primers. RT-LAMP primers. Primer labeled with biotin. Probe modified with 5 -terminal FITC. Nucleotide position numbers are primarily based on GenBank accession no. AF109154.
IBDV and only limited areas outside the hypervariable region of the VP2 gene were available, the RT-LAMP primers were designed based on the aligned nucleotide sequences of IBDVs (GenBank accession nos. AF109154 (P3009), AF279288 (2512/TW), AF279287 (V97/TW), AF303219 (T1/TW), AF312371 (T2/China), AF499929 (D78), D10065, DQ355819, X92760 (vvIBDV/European), and AF533670 (SH192)) (Fig. 1). Only a single loop primer (LB primer) was used in this assay. The free energies of the 3 ends of F2/B2, F3/B3, and LB and of the 5 ends of F1c/B1c primers were
less than −4 kcal/mol, which complied with the Primer Explorer V3 software requirements. The primers were listed in Table 1. All primers were synthesized and labeled by MD Bio Inc. The RT-LAMP reaction was conducted in a 25 l reaction mixture in a thermostatic water bath containing 1× ThermoPol buffer (NEB, Ipswich, CA, USA), LB primer, FIP and BIP primers, F3 and B3 primers, dNTP, AMV reverse transcriptase (Invitrogen, Carlsbad, CA, USA), betaine (Sigma, Saint Louis, MO, USA), MgSO4 , Bst DNA polymerase (NEB), and 5 l of RNA as templates. The amplification
Fig. 2. Optimization of the RT-LAMP reaction for IBDV. (A) The effect of MgSO4 : lanes 1–7 (2, 4, 6, 8, 10, 12, and 14 mM, respectively). (B) The effect of betaine: lanes 1–5 (0, 0.2, 0.4, 0.6, and 0.8 M, respectively). (C) The effect of temperature: lanes 1–5 (59, 61, 63, 65, and 67 ◦ C, respectively). (D) The effect of dNTPs: lanes 1–4 (0, 0.4, 0.8, and 1.2 mM, respectively). (E) The effect of the ratio of outer and inner primers: lanes 1–5 (1:1, 1:2, 1:4, 1:8, and 1:12, respectively). (F) The effect of Bst DNA polymerase: lanes 1–5 (0, 1, 2, 4, and 8 units, respectively). (G) The effect of AMV reverse transcriptase: lanes 1–5 (0, 2.5, 5, 10, and 15 units, respectively).
120
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
was incubated at 59 ◦ C for 60 min and then 80 ◦ C for 5 min to inactivate enzymes. A negative control without templates was included in each test. For optimization of the RT-LAMP reaction, several parameters including the concentration of MgSO4 (2–14 mM), the concentration of betaine (0–0.8 M), the amplification temperature (59–67 ◦ C), the concentration of dNTPs (0–1.2 mM), the ratio of outer and inner primers (1:1–1:12), the amount of Bst DNA polymerase added (0–8 units), and the amount of AMV reverse transcriptase added (0–15 units) were tested. No amplified products were obtained when the concentrations of Mg2+ were at 2 mM and 4 mM. Similar amounts of products were generated when Mg2+ concentration was equal to or was greater than 6 mM (Fig. 2A). There were no differences in yields when the amount of betaine was adjusted except for 0.8 M (Fig. 2B). The same amount of product was given at both 59 ◦ C and 61 ◦ C but the yield was reduced beyond this (Fig. 2C). To acquire an appropriate amount of products, at least 0.4 mM of dNTPs needed to be used (Fig. 2D). Direct proportionality was observed between the yield of product and an increased primer ratio over the range 1:1–1:12 (Fig. 2E). The minimum amount of Bst DNA polymerase for a positive reaction was 2 units but no increase in product was observed up to 8 units of Bst DNA polymerase (Fig. 2F). For AMV reverse transcriptase, a positive RT-LAMP could be achieved using as little as 2.5 units (Fig. 2G). Accordingly, conditions for the optimal RT-LAMP assay were determined to be 59 ◦ C with 6 mM MgSO4 , 0.4 mM dNTPs, 0.2 M betaine, 0.2 M each of outer primer, 2.4 M each of inner primer, 0.8 M of LB primer, 2.5 units AMV reverse transcriptase, and 2 units Bst DNA polymerase. The amplified products were visualized as white precipitate with naked eye, In addition, to further confirm the identity of amplified products, 5 units of Bts I (NEB) were added to digest 5 l of the RT-LAMP products at 37 ◦ C for 2 h and the results checked on a 2% agarose gel stained with ethidium bromide. This restriction enzyme site located within the IBDV VP2 gene which was indicated in Fig. 1. Typical ladder-like products composed of various different sizes were demonstrated in the positive RT-LAMP reactions. This pattern vanished after digestions using Bts I, which confirmed the specificity of the RT-LAMP products (Fig. 3A). A significant amount of white precipitate derived from the accumulation of magnesium pyrophosphate was also visualized in the positive reactions (Fig. 3B). A DNA probe was designed from the sequence between the F2 and F1c region of RT-LAMP product. The single stranded DNA probe was synthesized and labeled with FITC at the 5 -end (Bio Basic Inc., Ontario, Canada). Ten picomoles of the FITC-labeled probes were added directly into the biotin-labeled RT-LAMP products for hybridization at 63 ◦ C for 5 min. A hundred microliters of the assay buffer were premixed with 8 l of hybridized products and then the LFD strip was dipped into it for 5 min. The heteroduplex bound by the gold-labeled anti-FITC antibodies were captured on the test line; otherwise, when there was a negative reaction, the complexes were only formed by non-hybridized FITC probes; in these circumstances the gold-labeled anti-FITC antibody was trapped at the control line (Fig. 4). The presence of amplicon-probe hybrids was determined by examining the stick. Therefore, when the RT-LAMPLFD assay was carried out, an intense control band was found in tested samples, which confirmed the validity of each assay. Furthermore, a dark purple color was only seen at the test line in a sample that was positive for IBDV and not in any other sample (Fig. 3C). To compare the time kinetics of RT-LAMP and RT-LAMP-LFD assays with or without a loop primer, IBDV RNA was amplified using RT-LAMP with or without the LB primer for 5, 15, 30, 45, and 60 min. The products were analyzed by electrophoresis using a 2% agarose gel containing ethidium bromide and by the RT-LAMPLFD assay as described above. The RT-LAMP reaction products
Fig. 3. Agarose gel electrophoresis of RT-LAMP products (A) and visual inspection of RT-LAMP products using turbidity (B) and the RT-LAMP-LFD assay (C). M: DNA markers; lane 1: RT-LAMP products; lane 2: RT-LAMP products digested with Bts I; lane 3: negative control; lane 4: RT-LAMP products; lane 5: negative control; lane 6: RT-LAMP products; lane 7: negative control.
Fig. 4. A schematic representation of the immune complex trapped at the test band showing that it is composed of gold-labeled anti-FITC antibodies bound with the FITC-labeled IBDV-specific probes that have hybridized to the biotin-labeled IBDV RT-LAMP products. When there is a negative reaction, only complexes formed by gold-labeled anti-FITC antibody and non-hybridized FITC probes are trapped at the control line.
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 5. Time kinetics of RT-LAMP (A) and RT-LAMP-LFD (B). Lanes 1 and 6: 5 min of amplification; lanes 2 and 7: 15 min of amplification; lanes 3 and 8: 30 min of amplification; lanes 4 and 9: 45 min of amplification; lanes 5 and 10: 60 min of amplification; with a loop primer (lanes 1–5) or without a loop primer (lanes 6–10).
increased in a time-dependent manner. As early as 30 min and 45 min, the amplified products could be detected using RT-LAMP with and without a loop primer, respectively. Distinct laddering patterns were observed with the RT-LAMP products amplified with or without a loop primer. The plateau of amplification was reached 15 min earlier with the RT-LAMP reaction in the presence of the loop primer compared to without the loop primer (Fig. 5A). For the RT-LAMP-LFD assay, a purple line was initially present at 30 min and 45 min using RT-LAMP with and without a loop primer, respectively (Fig. 5B). These results suggested that a loop primer improved
121
the amplification efficiency of the RT-LAMP and the RT-LAMP-LFD assays. Original and a 10-fold dilutions of the IBDV stocks using DMEM were inoculated onto DF-1 cell monolayers cultured in DMEM containing 5% fetal bovine serum. After adsorption at 37 ◦ C for 1 h, inoculated viruses were removed and cells were washed with PBS and overlaid with DMEM containing 5% fetal bovine serum and 0.3% UltraPure agarose (Invitrogen). The incubation was carried out at 37 ◦ C for 24 h and then 1 ml of 1% neutral red was added to cells. After further incubation at 37 ◦ C for 48 h, the presence of plaques was observed, counted, and their sizes were measured. Round and clear plaques were visualized in DF-1 cells. The diameters of individual plaques were determined to be 2.13 ± 0.64 mm using Vernier calipers (Fig. 6A–C). When the images of plaque areas were magnified, most cells were lysed and only a few shrunken cells remained (Fig. 6D and E). To compare the sensitivities of the detection of IBDV using RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD assays, RNA samples from 104 , 103 , 102 , 10, 1, 10−1 , and 10−2 plaque forming units (PFU) of IBDV were extracted and used as templates for tests. PicoGreen (Invitrogen) or ethidium bromide was added directly into RT-LAMP products before they were visualized under a UV lamp. The detection limits for RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD were 103 , 1, 10−1 , and 10−1 PFU of IBDV, respectively. No amplified products or signal at the test line were observed in the negative controls (Fig. 7A). Fluorescent orange and green signals were visualized, respectively under a UV lamp after staining of RT-LAMP products with ethidium bromide or Picogreen when 10−1 PFU of IBDV was used as the template (Fig. 7B). The sensitivities of RT-LAMP, RT-LAMP-LFD, and either ethidium bromide or Picogreen staining of the RT-LAMP products were the same. They were 10 and 104 folds higher than those of nested RT-PCR and RT-PCR, respectively. To ensure the specificity of the RT-LAMP
Fig. 6. Plaque appearance of DF-1 cells infected with the IBDV P3009 strain. M: mock cells; A: plaques formed by virus stocks; B: plaques formed by a 10-fold dilution of virus stock; C: magnification of the plaques (100×); D: magnification of the plaques (200×); E: magnification of plaques (400×).
122
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 7. Sensitivities of RT-LAMP, RT-PCR, nested RT-PCR, and RT-LAMP-LFD (A) and visual inspection with PicoGreen or ethidium bromide staining of the RT-LAMP products (B). Lane M: DNA markers; lanes 1–7 (104 , 103 , 102 , 10, 1, 10−1 , and 10−2 PFU, respectively); lane 8: negative control.
and RT-LAMP-LFD assays, IBDV, Marek’s disease virus (MDV), avian reovirus (ARV), NDV, avian pox virus, chicken anemia virus (CAV), infectious bronchitis virus (IBV), avian encephalomyelitis virus (AEV), and DF-1 cells were also examined. Neither amplified products were seen nor were signals found at the test line for uninfected DF1 cells and with any other virus except for IBDV (Fig. 8A and B). Twenty-eight bursas samples collected from chicken farms located in the central Taiwan area in 2009 were tested. Four, ten, ten, and ten samples were detected, respectively as positive by RTPCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD. Bi-directional sequencing validated the authenticity of RT-PCR and nested RTPCR products. Available background information on the samples is listed in Table 2. The detection rates for RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD were (4/25) 16%, (10/25) 40%, (10/25) 40%, and (10/25) 40%, respectively. Therefore, the developed
Fig. 8. Specificities of the RT-LAMP (A) and RT-LAMP-LFD (B). Lane M: DNA markers; lanes 1–9 (IBDV, MDV, ARV, NDV, avian pox virus, CAV, IBV, AEV, and DF-1 cells, respectively); lane 10: no template control.
RT-LAMP and RT-LAMP-LFD systems both exhibited better sensitivities than RT-PCR and were at least as sensitive to nested RT-PCR when detecting IBDV in the field samples. A comprehensive study characterizing each parameter that affects the RT-LAMP was presented. Although not always necessary in such a reaction, betaine was able to reduce melting temperatures and facilitate the denaturation of DNA templates, which improved the efficiency of the PCR and LAMP assays (Tsai et al., 2009). A noticeable increasing in RT-LAMP yields was obtained at 0.2 M betaine, which suggested that betaine was also likely to promote a separation of double-stranded viral RNA leading to more productive amplifications. When the concentration of betaine reached 0.6 M, the yield of RT-LAMP products decreased. These results were consistent with the RT-LAMP results for red-spotted grouper nervous necrosis virus (Xu et al., 2010). In the present study, enough dNTP (at least 0.4 mM), a suitable concentration of Mg2+ as a cofactor for the Bst DNA polymerase, an adequate amount of AMV reverse transcriptase, and a correct ratio for outer and inner primers allowed the efficient formation of the stem-loop DNA that initiated the RT-LAMP; these factors held the key to an optimized RT-LAMP reaction (Notomi et al., 2000). Although the working temperature range was from 59 ◦ C to 67 ◦ C, when the temperature tolerance of the reverse transcriptase was taken into the account, an appropriate optimal temperature for the RT-LAMP of IBDV was 59–61 ◦ C. With a loop primer, the RT-LAMP reaction was accelerated by at least 15 min compared to without a loop primer. Due to the differences in interactions when this additional primer was present during amplification, it is logical that there should be different laddering patterns when these two conditions were compared. These findings demonstrated that, in addition to DNA viruses and single stranded RNA viruses, the inclusion of a loop primer was also able to speed up the reaction time for double stranded RNA viruses such as IBDV (Jaroenram et al., 2009; Kono et al., 2004; Pillai et al., 2006). Although consistent results were obtained using RTLAMP-LFD and RT-LAMP in this study, it is worthy of note that an important advantage of RT-LAMP-LFD over other methods is that the small reaction products, which are below the detection limit when using an agarose gel stained with ethidium bromide, are able to be readily picked up by the RT-LAMP-LFD system. As expected with a validated specificity, the sensitivities of the RT-LAMP and RT-LAMP-LFD were about equal and superior to RT-PCR and nested RT-PCR. This was similar to the situation with other avian pathogens, including AIV, NDV, and West Nile virus (Chen et al., 2008; Li et al., 2009; Parida et al., 2004). Several possible factors contribute to the above fact. These factors included that the RT-LAMP reaction was less sensitive to inhibitors, was less affected by the presence of various salts, and was able to tolerate the inhibitory effect of large amounts of templates (Kaneko et al., 2007; Sahul Hameed et al., 2004). Although a rapid screen by naked eye for the presence of a white precipitate derived from magnesium pyrophosphate or visualization of the RT-LAMP products under a UV lamp after adding Picogreen or ethidium bromide were convenient, there was always the possibility that a sample may be somewhat ambiguous to the naked eye (Tsai et al., 2009). It is important to note that the use of the RT-LAMP-LFD assay will reduce if not eliminate this problem. In addition, only a minimum requirement of the apparatus is needed. To enhance the resistance to harsh conditions and to increase the propagation efficiency, multiple genomes were packaged into a single IBDV particle (Luque et al., 2009). Recent studies have demonstrated that the average ratio of physical particle to PFU to be 2.36 × 103 , which confirmed that a detection limit for the RT-LAMP and RT-LAMP-LFD of below 1 PFU at 10−1 PFU was reasonable. This developed assay, unlike a direct isolation of viable IBDV, is primarily targeted on IBDV RNA. Such nucleic acid-based methods
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
123
Table 2 Detection of IBDV in clinical samples by RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD. Sample
Date
Geographic location
Chicken age and breed
RT-PCR
Nested RT-PCR
RT-LAMP
RT-LAMP-LFD
B01 B02 B04 B05 B06 B08 B09 B10 B11 B12 B13 B14 B15 B16 B17 B18 B19 B20 B22 B23 B24 B25 B26 B27 B28
2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04
Nantou county Nantou county Nantou county Nantou county Nantou county Changhua county Changhua county Changhua county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county
26 days, broiler 26 days, broiler 26 days, broiler 26 days, broiler 26 days, broiler 56 days, layer 56 days, layer 56 days, layer 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler
− + − − + − + + − − − − − − − − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
16% (4/25)
40% (10/25)
40% (10/25)
40% (10/25)
Detection ratea a
Detection rate was defined by no. of positive samples/no. of total samples (%).
have been used for the rapid diagnosis of IBDV based on various benefits including high specificity, good sensitivity, and easier standardization (Qian and Kibenge, 1996; Stram et al., 1994; Wu et al., 2007). The system is of significant value because it allows the initial screening of samples during the early phase of an outbreak when the birds have lower viral titers and lower loads of viral RNA (Kono et al., 2004; Xu et al., 2009; Xue et al., 2009). In this study, the new assay exhibited the same detection rate using field samples as nested RT-PCR, which has been widely accepted as the standard method for examining IBDV RNA. However, further testing on additional field samples is needed to improve the validation of this RT-LAMP-LFD assay. To our knowledge, this is the first report describing the development of a RT-LAMP-LFD for the diagnosis of IBDV. Compared to currently available RT-LAMP assays for IBDV, this strip assay simplifies greatly the post-amplification operations, which will help to avoid serendipitous contamination. Furthermore, under emergency conditions in the field with limited equipments, a result can be acquired in as short as 40 min. In this regard, this RT-LAMP-LFD assay stands out as a promising alternative for the diagnosis of IBDV in rural areas and developing countries where there is a lack of complex laboratory services. Acknowledgement This work was supported partly by the grant awarded to Dr. ChiYoung Wang by the National Science Council (96-2314-B-020-001), Taiwan. References Azad, A.A., Barett, S.A., Fahey, K.J., 1985. The characterization and molecular cloning of the double-stranded RNA genome of an Australian strain of infectious bursal disease virus. Virology 143, 35–44. Burkhardt, E., Muller, H., 1987. Susceptibility of chicken blood lymphoblasts and monocytes to infectious bursal disease virus (IBDV). Arch. Virol. 94, 297–303. Chen, H.T., Zhang, J., Sun, D.H., Ma, L.N., Liu, X.T., Cai, X.P., Liu, Y.S., 2008. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of H9 avian influenza virus. J. Virol. Methods 151, 200–203. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270.
Ding, W.C., Chen, J., Shi, Y.H., Lu, X.J., Li, M.Y., 2010. Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch. Virol. 155, 385–389. Fahey, K.J., Erny, K., Crooks, J., 1989. A conformational immunogen on VP2 of infectious bursal disease virus that induces virus-neutralizing antibodies that passively protect chickens. J. Gen. Virol. 70, 1473–1481. Giambrone, J.J., Dormitorio, T., 1997. Polymerase chain reaction. In: Giambrone, J.J., Dormitorio, T. (Eds.), Advanced Laboratory Techniques in Avian Medicine. Auburn University, Auburn, USA, pp. 141–155. Jaroenram, W., Kiatpathomchai, W., Flegel, T.W., 2009. Rapid and sensitive detection of white spot syndrome virus by loop-mediated amplification combined with a lateral flow dipstick. Mol. Cell. Probes 23, 65–70. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499–501. Kataria, R.S., Tiwari, A.K., Nanthakumar, T., Goswami, P.P., 2001. One-step RT-PCR for the detection of infectious bursal virus in clinical samples. Vet. Res. Commun. 25, 429–436. Kibenge, F.S.B., Dhillon, A.S., Russell, R.G., 1988. Biochemistry and immunology of infectious bursal disease virus. J. Gen. Virol. 69, 1757–1775. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J. Virol. Methods 115, 59–65. Li, Q., Xue, C., Qin, J., Zhou, Q., Chen, F., Bi, Y., Cao, Y., 2009. An improved reverse transcription loop-mediated isothermal amplification assay for sensitive and specific detection of Newcastle disease virus. Arch. Virol. 154, 1433–1440. Liu, H.J., Huang, P.H., Wu, Y.H., Lin, M.Y., Laio, M.H., 2001. Molecular characterization of very virulent infectious bursal disease viruses in Taiwan. Res. Vet. Sci. 70, 139–147. Luque, D., Rivas, G., Alfonso, C., Carrascosa, J.L., Rodriguez, J.F., Caston, J.R., 2009. Infectious bursal disease virus is an icosahedral polyploid dsRNA virus. Proc. Natl. Acad. Sci. U.S.A. 106, 2148–2152. Muller, H., Nitschke, R., 1987. The two segments of infectious bursal disease virus are circularized by a 90 kDa protein. Virology 159, 174–177. Nimitphak, T., Kiatpathomchai, W., Flegel, T.W., 2008. Shrimp hepatopancreatic parvovirus detection by combining loop-mediated isothermal amplification with a lateral flow dipstick. J. Virol. Methods 154, 56–60. Nimitphak, T., Meemetta, W., Arunrut, N., Senapin, S., Kiatpathomchai, W., 2010. Rapid and sensitive detection of Penaeus monodon nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal amplification combined with a lateralflow dipstick. Mol. Cell. Probes 24, 1–5. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Parida, M., Posadas, G., Inoue, S., Hasebe, F., Morita, K., 2004. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42, 257–263. Pillai, D., Bonami, J.R., Sri Widada, J., 2006. Rapid detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), the pathogenic agents of
124
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
white tail disease of Macrobrachium rosenbergii (De Man) by loop mediated isothermal amplification. J. Fish Dis. 29, 275–283. Puthawibool, T., Senapin, S., Kiatpathomchai, W., Flegel, T.W., 2009. Detection of shrimp infectious myonecrosis virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 156, 27–31. Qian, B., Kibenge, F.S.B., 1996. Restriction fragment profiles of genome segment A of infectious bursal disease virus correlate with serotype and geographical origin of avibirnaviruses. Can. J. Microbiol. 42, 93–97. Sahul Hameed, A.S., Yoganandhan, K., Sri Widada, J., Bonami, J.R., 2004. Studies on the occurrence and RT-PCR detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus like particles (XSV) associated with white tail disease (WTD) of Macrobrachium rosenbergii in India. Aquaculture 238, 127–133. Saif, Y.M., 1991. Immunosuppression induced by infectious bursal disease virus. Vet. Immunol. Immunopathol. 30, 45–50. Spies, U., Muller, H., 1990. Demonstration of enzyme activities required for cap structure formation in infectious bursal disease virus, a member of the birnavirus group. J. Gen. Virol. 71, 977–981.
Spies, U., Muller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res. 8, 127–140. Stram, Y., Meir, R., Molad, T., Blumenkranz, R., Malkinson, M., Weisman, Y., 1994. Applications of the polymerase chain reaction to detect infectious bursal disease virus in naturally infected chickens. Avian Dis. 51, 512–526. Tsai, S.M., Chan, K.W., Hsu, W.L., Chang, T.J., Wong, M.L., Wang, C.Y., 2009. Development of a loop-mediated isothermal amplification for rapid detection of orf virus. J. Virol. Methods 157, 200–204. Wu, C.C., Rubinelli, P., Lin, T.L., 2007. Molecular detection and differentiation of infectious bursal disease virus. Avian Dis. 51, 512–526. Xu, H., Feng, J., Guo, Z., Ou, Y., Wang, J., 2010. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Virol. Methods 163, 123–128. Xu, J., Zhang, Z., Yin, Y., Cui, S., Xu, S., Guo, Y., Li, J., Wang, J., Liu, X., Han, L., 2009. Development of reverse-transcription loop-mediated isothermal amplification for the detection of infectious bursal disease virus. J. Virol. Methods 162, 267–271. Xue, C., Zhang, Y., Zhou, Q., Xu, C., Li, X., Cao, Y., 2009. Rapid detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J. Vet. Diagn. Invest. 21, 841–843.
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Rapid and sensitive detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick Su-Ming Tsai a , Hung-Jen Liu b , Jui-Hung Shien c , Long-Huw Lee c , Po-Chung Chang a , Chi-Young Wang c,∗ a
Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan Institute of Molecular Biology, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan c Department of Veterinary Medicine, College of Veterinary Medicine, 250 Road Kuo Kuang, National Chung Hsing University, Taichung 402, Taiwan b
a b s t r a c t Article history: Received 5 April 2011 Received in revised form 25 August 2011 Accepted 1 September 2011 Available online 7 September 2011 Keywords: Infectious bursal disease virus Reverse transcription loop-mediated isothermal amplification (RT-LAMP) Nested RT-PCR Lateral flow dipstick (LFD)
Infectious bursal disease (IBD), an immunosuppressive disease that affects all ages of chickens, results in significant losses in the poultry industry. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) combined with a chromatographic lateral flow dipstick (LFD) for the detection of infectious bursal disease virus (IBDV) was developed. The whole process of testing can be completed in less than 70 min using biotin-labeled primers, an FITC-labeled DNA probe, and the LFD. The detection limits for IBDV using RT-LAMP and RT-LAMP-LFD were the same at 10−1 plaque forming units (PFU). When other unrelated viruses and cells were tested, no false positive results were observed. In addition, the amplification efficiency of RT-LAMP was enhanced when a loop primer was used. The RT-LAMP-LFD product started to be detected after 40 min. Clinical samples were used to compare assays using RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD and the positive rates were 16%, 40%, 40%, and 40%, respectively. In conclusion, this assay is an easy, rapid, accurate, and sensitive method for the detection of IBDV and will improve the screening of field samples, especially when veterinarians have limited resources. © 2011 Elsevier B.V. All rights reserved.
Infectious bursal disease (IBD) is a contagious and immunosuppressive disease of young chickens. It is caused by infectious bursal disease virus (IBDV), which belongs to the genus Avibirnavirus of the Birnaviridae (Azad et al., 1985). There are two serotypes. Serotype 1 is pathogenic and causes severe destructions of the dividing and differentiating B lymphocytes in the bursa of Fabricius. This leads to deficiencies in the humoral immunity and makes birds vulnerable to other bacterial and viral infections (Burkhardt and Muller, 1987). IBD still causes serious economic losses in the poultry industry worldwide (Saif, 1991). IBDV is a non-enveloped icosahedral virus with a diameter of 60 nm and its genome consists of two segments of double stranded RNA (Kibenge et al., 1988). A 110 kDa polyprotein (pVP2–VP3–VP4), which is encoded by an open reading frame (ORF) of segment A is cleaved proteolytically into two structural proteins (VP2 and VP3) and a viral protease (VP4) (Muller and Nitschke, 1987). The 38 kDa viral capsid protein VP2, which can elicit neutralizing antibodies is the primary determinant of viral serotype (Fahey et al., 1989). The 91 kDa VP1 encoded by an ORF of segment B is a double stranded RNA polymerase as well as a capping enzyme and methyltransferase
∗ Corresponding author. Tel.: +886 4 22840369 48; fax: +886 4 22862073. E-mail address: [email protected] (C.-Y. Wang). 0166-0934/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2011.09.002
(Spies et al., 1987; Spies and Muller, 1990). To date, immunoassays and molecular biology techniques such as ELISA, agar gel precipitation (AGP), immunofluorescence assays, neutralization assays, probe hybridization, reverse-transcription polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction have been used for the routine diagnosis (Kataria et al., 2001). Most of these methods require a long processing time, the availability of expensive equipments, and trained operators (Liu et al., 2001; Qian and Kibenge, 1996; Stram et al., 1994; Wu et al., 2007). Recently, a number of auto-cycling cDNA synthesis methods have been invented and applied for the detection of avian pathogens including avian influenza virus (AIV), Newcastle disease virus (NDV), and IBDV (Chen et al., 2008; Curtis et al., 2008; Li et al., 2009; Notomi et al., 2000; Xu et al., 2009; Xue et al., 2009). One of these is RT-LAMP, where the concomitant bindings of four to six primers and the presence of reverse transcriptase together with Bst DNA polymerase allow the DNA amplification of a target sequence. After amplification, the restriction enzyme digestion or the nucleotide hybridization can be used to validate the specificity of the RT-LAMP products (Tsai et al., 2009). In this study, a RT-LAMP combined a lateral flow dipstick (LFD) was developed for the detection of IBDV. RT-LAMP products amplified using biotin-labeled primers were hybridized with a FITC-labeled probe. This hybrid was then bounded dually to the
118
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 1. Sequence alignment of the partial VP2 gene of IBDVs (GenBank accession nos. AF109154, AF279287, AF279288, AF303219, AF312371, AF499929, AF533670, D10065, DQ355819, and X92760). The regions used to design the inner primers (FIP and BIP), the outer primers (F3 and B3), the loop primer (LB), and the FITC-conjugated probe (IBDV-P) as well as the position of a restriction enzyme site (Bts I) are denoted. Nucleotide position numbers are primarily based on GenBank accession no. AF109154. Dots are used to represent omitted sequences.
gold-labeled anti-FITC antibody and the anti-biotin antibody coated on a LFD. The final complexes were trapped at the test line of the LFD. Otherwise, without the FITC probe, complexes bound with the gold-labeled anti-FITC antibody were trapped only at the control line. This approach has been used successfully to develop tests for infectious spleen and kidney necrosis virus, shrimp hepatopancreatic parvovirus, shrimp infectious myonecrosis virus, and Penaeus monodon nucleopolyhedronvirus (PemoNPV) (Ding et al., 2010; Nimitphak et al., 2008, 2010; Puthawibool et al., 2009). This system is a user friendly alternative to other techniques and is both rapid and sensitive, while at the same time showing the excellent specificity. This test possesses the great potential when applied in the field. The P3009 strain of IBDV (GenBank accession number AF109154) was propagated in DF-1 cells cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 5% fetal bovine serum. At 48 hpi, total RNA was extracted using Trizol reagent (MD Bio, Taipei, Taiwan) according to the manufacturer’s instructions. For the field samples and other viruses, RNA was also extracted using the above reagent. The cDNA amplification used RNA, 1× RT buffer, 5 units of reverse transcriptase (RTAce, Toyobo, Osaka, Japan), 1 mM
each dNTP, 0.4 mM P1 primer, and 0.4 mM P2 primer. PCR or nested PCR was carried out in cDNA, 1× PCR buffer, 1.5 mM MgCl2 , 0.2 mM each dNTP, 0.4 mM of both P1 and P2 primers or both P3 and P4 primers, and 0.2 units of Taq polymerase (MD Bio). For synthesis of cDNA, the RT-PCR reaction was performed initially at 42 ◦ C for 1 h and then 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 60 ◦ C for 1 min, and 72 ◦ C for 1 min and a final extension at 72 ◦ C for 10 min. The nested RT-PCR was subjected to 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, and 72 ◦ C for 1 min and a final extension at 72 ◦ C for 10 min. Ten microliters of either the RT-PCR or nested RT-PCR products were then separated by 2% agarose gel electrophoresis. The RT-PCR primers (P1 and P2 primers) and the nested RT-PCR primers (P3 and P4 primers) were described by Liu et al. (2001) and Giambrone and Dormitorio (1997), respectively. The aim of this study was to develop an universal assay for the detection of different strains of IBDV. Selected IBDV strains were used, including several recent Taiwan isolates, vaccine strains, and a number of very virulent IBDV isolates (Liu et al., 2001). Taking into account the fact that the VP2 gene of IBDV is used frequently as the target for the detection of
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
119
Table 1 The primers and probe used for the detection of IBDV. Type
Sequences (5 –3 )
Nucleotide positionf
IBDV-P1 IBDV-P2a IBDV-P3b IBDV-P4b F3c B3c FIP(F1c + F2)c , d
Forward outer Reverse outer Forward inner Reverse inner Forward outer Reverse outer Forward inner
TCACCGTCCTCAGCTTAC TCAGGATTGGGATCAGC GCCCAGAGTCTACACCATAACTGC GCGACCGTAACGACAGATCC CCCAGCCAATCACATCCATC TCAGCTCGAAGTTGCTCAC ACTGCTAGGCTCCCACTTGCTCCAAAAGTGGTGGTCAGGC
BIP(B1c + B2)c
Reverse inner
AACTATCCAGGGGCCCTCCGKGCGACCGTAACGACRGA
LBc IBDV-Pe
Reverse loop Probe
CCGTCACACTAGTAGCCTATGAAAG GGGACCAGATGTCATGG
515–532 1140–1157 630–653 1102–1121 929–948 1126–1144 F1c:1009–1028 F2:967–986 B1c:1045–1064 B2:1105–1122 1067–1091 989–1005
Primer name a
a b c d e f
RT-PCR primers. Nested RT-PCR primers. RT-LAMP primers. Primer labeled with biotin. Probe modified with 5 -terminal FITC. Nucleotide position numbers are primarily based on GenBank accession no. AF109154.
IBDV and only limited areas outside the hypervariable region of the VP2 gene were available, the RT-LAMP primers were designed based on the aligned nucleotide sequences of IBDVs (GenBank accession nos. AF109154 (P3009), AF279288 (2512/TW), AF279287 (V97/TW), AF303219 (T1/TW), AF312371 (T2/China), AF499929 (D78), D10065, DQ355819, X92760 (vvIBDV/European), and AF533670 (SH192)) (Fig. 1). Only a single loop primer (LB primer) was used in this assay. The free energies of the 3 ends of F2/B2, F3/B3, and LB and of the 5 ends of F1c/B1c primers were
less than −4 kcal/mol, which complied with the Primer Explorer V3 software requirements. The primers were listed in Table 1. All primers were synthesized and labeled by MD Bio Inc. The RT-LAMP reaction was conducted in a 25 l reaction mixture in a thermostatic water bath containing 1× ThermoPol buffer (NEB, Ipswich, CA, USA), LB primer, FIP and BIP primers, F3 and B3 primers, dNTP, AMV reverse transcriptase (Invitrogen, Carlsbad, CA, USA), betaine (Sigma, Saint Louis, MO, USA), MgSO4 , Bst DNA polymerase (NEB), and 5 l of RNA as templates. The amplification
Fig. 2. Optimization of the RT-LAMP reaction for IBDV. (A) The effect of MgSO4 : lanes 1–7 (2, 4, 6, 8, 10, 12, and 14 mM, respectively). (B) The effect of betaine: lanes 1–5 (0, 0.2, 0.4, 0.6, and 0.8 M, respectively). (C) The effect of temperature: lanes 1–5 (59, 61, 63, 65, and 67 ◦ C, respectively). (D) The effect of dNTPs: lanes 1–4 (0, 0.4, 0.8, and 1.2 mM, respectively). (E) The effect of the ratio of outer and inner primers: lanes 1–5 (1:1, 1:2, 1:4, 1:8, and 1:12, respectively). (F) The effect of Bst DNA polymerase: lanes 1–5 (0, 1, 2, 4, and 8 units, respectively). (G) The effect of AMV reverse transcriptase: lanes 1–5 (0, 2.5, 5, 10, and 15 units, respectively).
120
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
was incubated at 59 ◦ C for 60 min and then 80 ◦ C for 5 min to inactivate enzymes. A negative control without templates was included in each test. For optimization of the RT-LAMP reaction, several parameters including the concentration of MgSO4 (2–14 mM), the concentration of betaine (0–0.8 M), the amplification temperature (59–67 ◦ C), the concentration of dNTPs (0–1.2 mM), the ratio of outer and inner primers (1:1–1:12), the amount of Bst DNA polymerase added (0–8 units), and the amount of AMV reverse transcriptase added (0–15 units) were tested. No amplified products were obtained when the concentrations of Mg2+ were at 2 mM and 4 mM. Similar amounts of products were generated when Mg2+ concentration was equal to or was greater than 6 mM (Fig. 2A). There were no differences in yields when the amount of betaine was adjusted except for 0.8 M (Fig. 2B). The same amount of product was given at both 59 ◦ C and 61 ◦ C but the yield was reduced beyond this (Fig. 2C). To acquire an appropriate amount of products, at least 0.4 mM of dNTPs needed to be used (Fig. 2D). Direct proportionality was observed between the yield of product and an increased primer ratio over the range 1:1–1:12 (Fig. 2E). The minimum amount of Bst DNA polymerase for a positive reaction was 2 units but no increase in product was observed up to 8 units of Bst DNA polymerase (Fig. 2F). For AMV reverse transcriptase, a positive RT-LAMP could be achieved using as little as 2.5 units (Fig. 2G). Accordingly, conditions for the optimal RT-LAMP assay were determined to be 59 ◦ C with 6 mM MgSO4 , 0.4 mM dNTPs, 0.2 M betaine, 0.2 M each of outer primer, 2.4 M each of inner primer, 0.8 M of LB primer, 2.5 units AMV reverse transcriptase, and 2 units Bst DNA polymerase. The amplified products were visualized as white precipitate with naked eye, In addition, to further confirm the identity of amplified products, 5 units of Bts I (NEB) were added to digest 5 l of the RT-LAMP products at 37 ◦ C for 2 h and the results checked on a 2% agarose gel stained with ethidium bromide. This restriction enzyme site located within the IBDV VP2 gene which was indicated in Fig. 1. Typical ladder-like products composed of various different sizes were demonstrated in the positive RT-LAMP reactions. This pattern vanished after digestions using Bts I, which confirmed the specificity of the RT-LAMP products (Fig. 3A). A significant amount of white precipitate derived from the accumulation of magnesium pyrophosphate was also visualized in the positive reactions (Fig. 3B). A DNA probe was designed from the sequence between the F2 and F1c region of RT-LAMP product. The single stranded DNA probe was synthesized and labeled with FITC at the 5 -end (Bio Basic Inc., Ontario, Canada). Ten picomoles of the FITC-labeled probes were added directly into the biotin-labeled RT-LAMP products for hybridization at 63 ◦ C for 5 min. A hundred microliters of the assay buffer were premixed with 8 l of hybridized products and then the LFD strip was dipped into it for 5 min. The heteroduplex bound by the gold-labeled anti-FITC antibodies were captured on the test line; otherwise, when there was a negative reaction, the complexes were only formed by non-hybridized FITC probes; in these circumstances the gold-labeled anti-FITC antibody was trapped at the control line (Fig. 4). The presence of amplicon-probe hybrids was determined by examining the stick. Therefore, when the RT-LAMPLFD assay was carried out, an intense control band was found in tested samples, which confirmed the validity of each assay. Furthermore, a dark purple color was only seen at the test line in a sample that was positive for IBDV and not in any other sample (Fig. 3C). To compare the time kinetics of RT-LAMP and RT-LAMP-LFD assays with or without a loop primer, IBDV RNA was amplified using RT-LAMP with or without the LB primer for 5, 15, 30, 45, and 60 min. The products were analyzed by electrophoresis using a 2% agarose gel containing ethidium bromide and by the RT-LAMPLFD assay as described above. The RT-LAMP reaction products
Fig. 3. Agarose gel electrophoresis of RT-LAMP products (A) and visual inspection of RT-LAMP products using turbidity (B) and the RT-LAMP-LFD assay (C). M: DNA markers; lane 1: RT-LAMP products; lane 2: RT-LAMP products digested with Bts I; lane 3: negative control; lane 4: RT-LAMP products; lane 5: negative control; lane 6: RT-LAMP products; lane 7: negative control.
Fig. 4. A schematic representation of the immune complex trapped at the test band showing that it is composed of gold-labeled anti-FITC antibodies bound with the FITC-labeled IBDV-specific probes that have hybridized to the biotin-labeled IBDV RT-LAMP products. When there is a negative reaction, only complexes formed by gold-labeled anti-FITC antibody and non-hybridized FITC probes are trapped at the control line.
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 5. Time kinetics of RT-LAMP (A) and RT-LAMP-LFD (B). Lanes 1 and 6: 5 min of amplification; lanes 2 and 7: 15 min of amplification; lanes 3 and 8: 30 min of amplification; lanes 4 and 9: 45 min of amplification; lanes 5 and 10: 60 min of amplification; with a loop primer (lanes 1–5) or without a loop primer (lanes 6–10).
increased in a time-dependent manner. As early as 30 min and 45 min, the amplified products could be detected using RT-LAMP with and without a loop primer, respectively. Distinct laddering patterns were observed with the RT-LAMP products amplified with or without a loop primer. The plateau of amplification was reached 15 min earlier with the RT-LAMP reaction in the presence of the loop primer compared to without the loop primer (Fig. 5A). For the RT-LAMP-LFD assay, a purple line was initially present at 30 min and 45 min using RT-LAMP with and without a loop primer, respectively (Fig. 5B). These results suggested that a loop primer improved
121
the amplification efficiency of the RT-LAMP and the RT-LAMP-LFD assays. Original and a 10-fold dilutions of the IBDV stocks using DMEM were inoculated onto DF-1 cell monolayers cultured in DMEM containing 5% fetal bovine serum. After adsorption at 37 ◦ C for 1 h, inoculated viruses were removed and cells were washed with PBS and overlaid with DMEM containing 5% fetal bovine serum and 0.3% UltraPure agarose (Invitrogen). The incubation was carried out at 37 ◦ C for 24 h and then 1 ml of 1% neutral red was added to cells. After further incubation at 37 ◦ C for 48 h, the presence of plaques was observed, counted, and their sizes were measured. Round and clear plaques were visualized in DF-1 cells. The diameters of individual plaques were determined to be 2.13 ± 0.64 mm using Vernier calipers (Fig. 6A–C). When the images of plaque areas were magnified, most cells were lysed and only a few shrunken cells remained (Fig. 6D and E). To compare the sensitivities of the detection of IBDV using RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD assays, RNA samples from 104 , 103 , 102 , 10, 1, 10−1 , and 10−2 plaque forming units (PFU) of IBDV were extracted and used as templates for tests. PicoGreen (Invitrogen) or ethidium bromide was added directly into RT-LAMP products before they were visualized under a UV lamp. The detection limits for RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD were 103 , 1, 10−1 , and 10−1 PFU of IBDV, respectively. No amplified products or signal at the test line were observed in the negative controls (Fig. 7A). Fluorescent orange and green signals were visualized, respectively under a UV lamp after staining of RT-LAMP products with ethidium bromide or Picogreen when 10−1 PFU of IBDV was used as the template (Fig. 7B). The sensitivities of RT-LAMP, RT-LAMP-LFD, and either ethidium bromide or Picogreen staining of the RT-LAMP products were the same. They were 10 and 104 folds higher than those of nested RT-PCR and RT-PCR, respectively. To ensure the specificity of the RT-LAMP
Fig. 6. Plaque appearance of DF-1 cells infected with the IBDV P3009 strain. M: mock cells; A: plaques formed by virus stocks; B: plaques formed by a 10-fold dilution of virus stock; C: magnification of the plaques (100×); D: magnification of the plaques (200×); E: magnification of plaques (400×).
122
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
Fig. 7. Sensitivities of RT-LAMP, RT-PCR, nested RT-PCR, and RT-LAMP-LFD (A) and visual inspection with PicoGreen or ethidium bromide staining of the RT-LAMP products (B). Lane M: DNA markers; lanes 1–7 (104 , 103 , 102 , 10, 1, 10−1 , and 10−2 PFU, respectively); lane 8: negative control.
and RT-LAMP-LFD assays, IBDV, Marek’s disease virus (MDV), avian reovirus (ARV), NDV, avian pox virus, chicken anemia virus (CAV), infectious bronchitis virus (IBV), avian encephalomyelitis virus (AEV), and DF-1 cells were also examined. Neither amplified products were seen nor were signals found at the test line for uninfected DF1 cells and with any other virus except for IBDV (Fig. 8A and B). Twenty-eight bursas samples collected from chicken farms located in the central Taiwan area in 2009 were tested. Four, ten, ten, and ten samples were detected, respectively as positive by RTPCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD. Bi-directional sequencing validated the authenticity of RT-PCR and nested RTPCR products. Available background information on the samples is listed in Table 2. The detection rates for RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD were (4/25) 16%, (10/25) 40%, (10/25) 40%, and (10/25) 40%, respectively. Therefore, the developed
Fig. 8. Specificities of the RT-LAMP (A) and RT-LAMP-LFD (B). Lane M: DNA markers; lanes 1–9 (IBDV, MDV, ARV, NDV, avian pox virus, CAV, IBV, AEV, and DF-1 cells, respectively); lane 10: no template control.
RT-LAMP and RT-LAMP-LFD systems both exhibited better sensitivities than RT-PCR and were at least as sensitive to nested RT-PCR when detecting IBDV in the field samples. A comprehensive study characterizing each parameter that affects the RT-LAMP was presented. Although not always necessary in such a reaction, betaine was able to reduce melting temperatures and facilitate the denaturation of DNA templates, which improved the efficiency of the PCR and LAMP assays (Tsai et al., 2009). A noticeable increasing in RT-LAMP yields was obtained at 0.2 M betaine, which suggested that betaine was also likely to promote a separation of double-stranded viral RNA leading to more productive amplifications. When the concentration of betaine reached 0.6 M, the yield of RT-LAMP products decreased. These results were consistent with the RT-LAMP results for red-spotted grouper nervous necrosis virus (Xu et al., 2010). In the present study, enough dNTP (at least 0.4 mM), a suitable concentration of Mg2+ as a cofactor for the Bst DNA polymerase, an adequate amount of AMV reverse transcriptase, and a correct ratio for outer and inner primers allowed the efficient formation of the stem-loop DNA that initiated the RT-LAMP; these factors held the key to an optimized RT-LAMP reaction (Notomi et al., 2000). Although the working temperature range was from 59 ◦ C to 67 ◦ C, when the temperature tolerance of the reverse transcriptase was taken into the account, an appropriate optimal temperature for the RT-LAMP of IBDV was 59–61 ◦ C. With a loop primer, the RT-LAMP reaction was accelerated by at least 15 min compared to without a loop primer. Due to the differences in interactions when this additional primer was present during amplification, it is logical that there should be different laddering patterns when these two conditions were compared. These findings demonstrated that, in addition to DNA viruses and single stranded RNA viruses, the inclusion of a loop primer was also able to speed up the reaction time for double stranded RNA viruses such as IBDV (Jaroenram et al., 2009; Kono et al., 2004; Pillai et al., 2006). Although consistent results were obtained using RTLAMP-LFD and RT-LAMP in this study, it is worthy of note that an important advantage of RT-LAMP-LFD over other methods is that the small reaction products, which are below the detection limit when using an agarose gel stained with ethidium bromide, are able to be readily picked up by the RT-LAMP-LFD system. As expected with a validated specificity, the sensitivities of the RT-LAMP and RT-LAMP-LFD were about equal and superior to RT-PCR and nested RT-PCR. This was similar to the situation with other avian pathogens, including AIV, NDV, and West Nile virus (Chen et al., 2008; Li et al., 2009; Parida et al., 2004). Several possible factors contribute to the above fact. These factors included that the RT-LAMP reaction was less sensitive to inhibitors, was less affected by the presence of various salts, and was able to tolerate the inhibitory effect of large amounts of templates (Kaneko et al., 2007; Sahul Hameed et al., 2004). Although a rapid screen by naked eye for the presence of a white precipitate derived from magnesium pyrophosphate or visualization of the RT-LAMP products under a UV lamp after adding Picogreen or ethidium bromide were convenient, there was always the possibility that a sample may be somewhat ambiguous to the naked eye (Tsai et al., 2009). It is important to note that the use of the RT-LAMP-LFD assay will reduce if not eliminate this problem. In addition, only a minimum requirement of the apparatus is needed. To enhance the resistance to harsh conditions and to increase the propagation efficiency, multiple genomes were packaged into a single IBDV particle (Luque et al., 2009). Recent studies have demonstrated that the average ratio of physical particle to PFU to be 2.36 × 103 , which confirmed that a detection limit for the RT-LAMP and RT-LAMP-LFD of below 1 PFU at 10−1 PFU was reasonable. This developed assay, unlike a direct isolation of viable IBDV, is primarily targeted on IBDV RNA. Such nucleic acid-based methods
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
123
Table 2 Detection of IBDV in clinical samples by RT-PCR, nested RT-PCR, RT-LAMP, and RT-LAMP-LFD. Sample
Date
Geographic location
Chicken age and breed
RT-PCR
Nested RT-PCR
RT-LAMP
RT-LAMP-LFD
B01 B02 B04 B05 B06 B08 B09 B10 B11 B12 B13 B14 B15 B16 B17 B18 B19 B20 B22 B23 B24 B25 B26 B27 B28
2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/04/09 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04 2009/11/04
Nantou county Nantou county Nantou county Nantou county Nantou county Changhua county Changhua county Changhua county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Yunlin county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county Miaoli county
26 days, broiler 26 days, broiler 26 days, broiler 26 days, broiler 26 days, broiler 56 days, layer 56 days, layer 56 days, layer 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 6 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler 10 days, broiler
− + − − + − + + − − − − − − − − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
− + + + + − + + − − − + + + + − − − − − − − − − −
16% (4/25)
40% (10/25)
40% (10/25)
40% (10/25)
Detection ratea a
Detection rate was defined by no. of positive samples/no. of total samples (%).
have been used for the rapid diagnosis of IBDV based on various benefits including high specificity, good sensitivity, and easier standardization (Qian and Kibenge, 1996; Stram et al., 1994; Wu et al., 2007). The system is of significant value because it allows the initial screening of samples during the early phase of an outbreak when the birds have lower viral titers and lower loads of viral RNA (Kono et al., 2004; Xu et al., 2009; Xue et al., 2009). In this study, the new assay exhibited the same detection rate using field samples as nested RT-PCR, which has been widely accepted as the standard method for examining IBDV RNA. However, further testing on additional field samples is needed to improve the validation of this RT-LAMP-LFD assay. To our knowledge, this is the first report describing the development of a RT-LAMP-LFD for the diagnosis of IBDV. Compared to currently available RT-LAMP assays for IBDV, this strip assay simplifies greatly the post-amplification operations, which will help to avoid serendipitous contamination. Furthermore, under emergency conditions in the field with limited equipments, a result can be acquired in as short as 40 min. In this regard, this RT-LAMP-LFD assay stands out as a promising alternative for the diagnosis of IBDV in rural areas and developing countries where there is a lack of complex laboratory services. Acknowledgement This work was supported partly by the grant awarded to Dr. ChiYoung Wang by the National Science Council (96-2314-B-020-001), Taiwan. References Azad, A.A., Barett, S.A., Fahey, K.J., 1985. The characterization and molecular cloning of the double-stranded RNA genome of an Australian strain of infectious bursal disease virus. Virology 143, 35–44. Burkhardt, E., Muller, H., 1987. Susceptibility of chicken blood lymphoblasts and monocytes to infectious bursal disease virus (IBDV). Arch. Virol. 94, 297–303. Chen, H.T., Zhang, J., Sun, D.H., Ma, L.N., Liu, X.T., Cai, X.P., Liu, Y.S., 2008. Development of reverse transcription loop-mediated isothermal amplification for rapid detection of H9 avian influenza virus. J. Virol. Methods 151, 200–203. Curtis, K.A., Rudolph, D.L., Owen, S.M., 2008. Rapid detection of HIV-1 by reversetranscription, loop-mediated isothermal amplification (RT-LAMP). J. Virol. Methods 151, 264–270.
Ding, W.C., Chen, J., Shi, Y.H., Lu, X.J., Li, M.Y., 2010. Rapid and sensitive detection of infectious spleen and kidney necrosis virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. Arch. Virol. 155, 385–389. Fahey, K.J., Erny, K., Crooks, J., 1989. A conformational immunogen on VP2 of infectious bursal disease virus that induces virus-neutralizing antibodies that passively protect chickens. J. Gen. Virol. 70, 1473–1481. Giambrone, J.J., Dormitorio, T., 1997. Polymerase chain reaction. In: Giambrone, J.J., Dormitorio, T. (Eds.), Advanced Laboratory Techniques in Avian Medicine. Auburn University, Auburn, USA, pp. 141–155. Jaroenram, W., Kiatpathomchai, W., Flegel, T.W., 2009. Rapid and sensitive detection of white spot syndrome virus by loop-mediated amplification combined with a lateral flow dipstick. Mol. Cell. Probes 23, 65–70. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499–501. Kataria, R.S., Tiwari, A.K., Nanthakumar, T., Goswami, P.P., 2001. One-step RT-PCR for the detection of infectious bursal virus in clinical samples. Vet. Res. Commun. 25, 429–436. Kibenge, F.S.B., Dhillon, A.S., Russell, R.G., 1988. Biochemistry and immunology of infectious bursal disease virus. J. Gen. Virol. 69, 1757–1775. Kono, T., Savan, R., Sakai, M., Itami, T., 2004. Detection of white spot syndrome virus in shrimp by loop-mediated isothermal amplification. J. Virol. Methods 115, 59–65. Li, Q., Xue, C., Qin, J., Zhou, Q., Chen, F., Bi, Y., Cao, Y., 2009. An improved reverse transcription loop-mediated isothermal amplification assay for sensitive and specific detection of Newcastle disease virus. Arch. Virol. 154, 1433–1440. Liu, H.J., Huang, P.H., Wu, Y.H., Lin, M.Y., Laio, M.H., 2001. Molecular characterization of very virulent infectious bursal disease viruses in Taiwan. Res. Vet. Sci. 70, 139–147. Luque, D., Rivas, G., Alfonso, C., Carrascosa, J.L., Rodriguez, J.F., Caston, J.R., 2009. Infectious bursal disease virus is an icosahedral polyploid dsRNA virus. Proc. Natl. Acad. Sci. U.S.A. 106, 2148–2152. Muller, H., Nitschke, R., 1987. The two segments of infectious bursal disease virus are circularized by a 90 kDa protein. Virology 159, 174–177. Nimitphak, T., Kiatpathomchai, W., Flegel, T.W., 2008. Shrimp hepatopancreatic parvovirus detection by combining loop-mediated isothermal amplification with a lateral flow dipstick. J. Virol. Methods 154, 56–60. Nimitphak, T., Meemetta, W., Arunrut, N., Senapin, S., Kiatpathomchai, W., 2010. Rapid and sensitive detection of Penaeus monodon nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal amplification combined with a lateralflow dipstick. Mol. Cell. Probes 24, 1–5. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Parida, M., Posadas, G., Inoue, S., Hasebe, F., Morita, K., 2004. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J. Clin. Microbiol. 42, 257–263. Pillai, D., Bonami, J.R., Sri Widada, J., 2006. Rapid detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV), the pathogenic agents of
124
S.-M. Tsai et al. / Journal of Virological Methods 181 (2012) 117–124
white tail disease of Macrobrachium rosenbergii (De Man) by loop mediated isothermal amplification. J. Fish Dis. 29, 275–283. Puthawibool, T., Senapin, S., Kiatpathomchai, W., Flegel, T.W., 2009. Detection of shrimp infectious myonecrosis virus by reverse transcription loop-mediated isothermal amplification combined with a lateral flow dipstick. J. Virol. Methods 156, 27–31. Qian, B., Kibenge, F.S.B., 1996. Restriction fragment profiles of genome segment A of infectious bursal disease virus correlate with serotype and geographical origin of avibirnaviruses. Can. J. Microbiol. 42, 93–97. Sahul Hameed, A.S., Yoganandhan, K., Sri Widada, J., Bonami, J.R., 2004. Studies on the occurrence and RT-PCR detection of Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus like particles (XSV) associated with white tail disease (WTD) of Macrobrachium rosenbergii in India. Aquaculture 238, 127–133. Saif, Y.M., 1991. Immunosuppression induced by infectious bursal disease virus. Vet. Immunol. Immunopathol. 30, 45–50. Spies, U., Muller, H., 1990. Demonstration of enzyme activities required for cap structure formation in infectious bursal disease virus, a member of the birnavirus group. J. Gen. Virol. 71, 977–981.
Spies, U., Muller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res. 8, 127–140. Stram, Y., Meir, R., Molad, T., Blumenkranz, R., Malkinson, M., Weisman, Y., 1994. Applications of the polymerase chain reaction to detect infectious bursal disease virus in naturally infected chickens. Avian Dis. 51, 512–526. Tsai, S.M., Chan, K.W., Hsu, W.L., Chang, T.J., Wong, M.L., Wang, C.Y., 2009. Development of a loop-mediated isothermal amplification for rapid detection of orf virus. J. Virol. Methods 157, 200–204. Wu, C.C., Rubinelli, P., Lin, T.L., 2007. Molecular detection and differentiation of infectious bursal disease virus. Avian Dis. 51, 512–526. Xu, H., Feng, J., Guo, Z., Ou, Y., Wang, J., 2010. Detection of red-spotted grouper nervous necrosis virus by loop-mediated isothermal amplification. J. Virol. Methods 163, 123–128. Xu, J., Zhang, Z., Yin, Y., Cui, S., Xu, S., Guo, Y., Li, J., Wang, J., Liu, X., Han, L., 2009. Development of reverse-transcription loop-mediated isothermal amplification for the detection of infectious bursal disease virus. J. Virol. Methods 162, 267–271. Xue, C., Zhang, Y., Zhou, Q., Xu, C., Li, X., Cao, Y., 2009. Rapid detection of infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J. Vet. Diagn. Invest. 21, 841–843.