- Email: [email protected]
Rapid and visible detection of Mycoplasma synoviae using a novel polymerase spiral reaction assay
Rapid and visible detection of Mycoplasma synoviae using a novel polymerase spiral reaction assay
∗
Henan Provincial Engineering Laboratory of Insects Bio-reactor, China-UK-NYNU-RRes Joint Laboratory of Insect Biology, Nanyang Normal University, Nanyang 473061, PR China; † Veterinary Laboratory, Guangzhou Zoo, Guangzhou 510642, PR China; and ‡ College of Animal Science, South China Agricultural University, Guangzhou 510642, PR China say for MS detection was 100 times more than that of the polymerase chain reaction assay based on agarose gel electrophoresis results and color change detected by the naked eye. Further experiments demonstrated that the primers specifically detected MS and showed no cross-reaction with other prevalent avian pathogens. Clinical sample testing confirmed that the MS–PSR assay is simple, rapid, specific, and sensitive, and thereby very suitable for application and promotion in the field and laboratories of grassroots units.
ABSTRACT In this study, a rapid, specific, and sensitive detection assay for Mycoplasma synoviae (MS) was established using a polymerase spiral reaction (PSR) method. A pair of primers were designed according to the conserved region of the vlhA gene of MS, and PSR results were assessed using agarose gel electrophoresis and color rendering with a dye indicator. The optimum reaction temperature and time for PSR using the specific primers were 62◦ C and 40 min in a water bath, respectively. The sensitivity of the PSR as-
Key words: molecular detection, Mycoplasma synoviae, polymerase spiral reaction 2019 Poultry Science 0:1–6 http://dx.doi.org/10.3382/ps/pez356
INTRODUCTION
preventing and controlling the spread of this disease. Diagnostic methods include isolation culture, serological diagnosis, and molecular detection (Ramirez et al., 2006; Haesendonck et al., 2014; Xue et al., 2017). Mycoplasma isolation and serological diagnosis are relatively less sensitive and time-consuming, requiring key reagents, skilled labor, and well-equipped laboratories (Kleven et al., 2001). Molecular analysis, such as that using conventional or real-time PCR, is more sensitive. Real-time PCR detection is a particularly rapid and sensitive method (Mekkes and Feberwee, 2005; Muhammad et al., 2018); however, these methods require sophisticated thermal cyclers that might be expensive for most basic laboratories and highly skilled technicians, both of which render them unsuitable for widespread use in the field. To counteract these disadvantages, isothermal molecular methods for MS detection have been developed, including methods based on loopmediated isothermal amplification (LAMP) and insulated isothermal polymerase chain reaction (iiPCR) (Kaewphinit et al., 2013; Kuo et al., 2017; Kursa et al., 2015). LAMP requires 6 complementary primers for MS detection and is performed in a water bath (Kaewphinit et al., 2013). However, the use of multiple primers greatly increases the design difficulty and development cost (Notomi et al., 2000; Kaewphinit et al., 2013). The iiPCR assay for MS detection can be accomplished in 1 h, but it requires a specific device to partly restrict the
Mycoplasma synoviae (MS), which is widely distributed throughout the world, has imposed huge economic losses to the poultry industry (Mohammed et al., 1987). Chicken and turkey are natural hosts of MS (Kleven, 2008). Typically, acute or chronic infectious synovitis, air sacculitis synovitis, and eggshell apex abnormality develop following MS infection which result in reduced egg production (Zhu et al., 2017; Kursa et al., 2019). In addition, MS infection can produce subclinical symptoms and lead to co-infection with Mycoplasma gallisepticum (MG), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and other avian pathogens (Sun et al., 2017; Ball et al., 2018; Derksen et al., 2018). Currently, control treatments for MS include the use of vaccines and antibiotics, and doxycycline, oxytetracycline, tylvalosin, tylosin, and pleuromutilins are sensitive antimicrobial agents for MS; however long-term drug use can lead to drug resistance (Kreizinger et al., 2017). Therefore, rapid and accurate MS diagnosis is one of the key factors for C 2019 Poultry Science Association Inc. Received February 6, 2019. Accepted June 1, 2019. 1 Both authors contributed equally to this work. 2 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
Qianqian Wu,∗,1 Xin Xu,∗,1 Qinxi Chen,∗ Kejing Zuo,† Yiting Zhou,∗ Zhibin Zhang,∗ Yunchao Kan,∗ Lunguang Yao,∗ Jun Ji ,∗,2 Yingzuo Bi,‡ and Qingmei Xie‡
2
WU ET AL. Table 1. Primer sets for PSR and PCR. Sequence 5 -3
Primer name
acgaattcgtacatagaagtatag-GTGATCAAACTCCR1 GCACCTGC gatatgaagatacatgcttaagca-ACCTGGGTTTTCTGGGTTTCCT GTGATCAAACTCCR1 GCACCTGC ACCTGGGTTTTCTGGGTTTCCT
(Lower-case letters stands for the stuffing sequences; 1 the italic stands for the degenerate oligonucleotide, R = A+G).
detection throughput and a fluorescent probe, which raise the detection cost (Kuo et al., 2017). In this study, we detected MS using polymerase spiral reaction (PSR), a novel nucleic acid isothermal amplification method invented by Liu Wei (Liu et al., 2015). PSR has the advantages of both PCR and LAMP, but it requires only 1 pair of routine primers to efficiently amplify nucleic acids using a water bath, which reduces detection cost and increases practical application.
MATERIALS AND METHODS Viruses and Clinical Samples Samples were acquired from respiratory laryngeal swabs or synovial fluid of chickens suspected to have MS infection or from the trachea or synovial bursa of chickens suspected to have died from MS infection. Respiratory swabs or tissues were collected under sterile conditions and stored at −80◦ C until further use. MG, MS-H (commercial live attenuated vaccine strain), NDV, infectious laryngotracheitis virus (ILTV), H9 subtype avian influenza virus (H9 AIV), and IBV, as described above, were stored in the Henan Provincial Engineering Laboratory of Insects Bio-reactor, Nanyang Normal University.
from the Chinese MS strain (CHN-QZ114-1-2013) in the NCBI database (Accession number: KU572389). A pair of specific primers for PSR and PCR was designed using Oligo 7.37. The primers were synthesized by Hongxun Technology Co., Ltd (Suzhou, China). Sequences of primers used in this study are listed in Table 1.
PSR Optimization Reaction mixture (25 uL) included 10 mM (NH4 )2 SO4 , 50 mM KCl, 0.1% v/v Tween-20, 1.4 mM dNTPs, 0.8 M Betaine, 4 mM MgSO4 , 8 U Bst DNA polymerase, and 0.8 uM forward and reverse PSR primers (S1 and S2). A pH-sensitive dye (1 μL; 0.025 mM phenol red and 0.08 mM cresol red) was added to each tube. Additionally, 25 uL mineral oil was added to prevent product volatilization. To evaluate the best reaction conditions, temperature optimization was performed using the reaction temperature gradient at 60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, and 65◦ C. Time optimization PSR was performed at gradients of 20, 30, 40, 50, and 60 min. Reaction results were discriminated according to the clarity and brightness of bands obtained using 2% agarose gel electrophoresis.
PCR Assay DNA and RNA Extraction The respiratory laryngeal swabs and synovial fluid swabs were washed with PBS. The obtained trachea or synovial bursa was ground using an appropriate amount of liquid nitrogen and suspended in PBS. Genomic DNA was extracted from each clinical sample (ChargeSwitch gDNA Mini Tissue Kit; Invitrogen Biotech, Waltham, MA) according to the manufacturer’s instructions and stored at −20◦ C. Total RNA from positive samples loaded with control viruses (IB, ND, and H9 AIV) was extracted (RNAiso reagent; TaKaRa Biotechnology, Dalian, China) according to the manufacturers’ instructions. RNA was reverse transcribed into cDNA and stored at −20◦ C.
Primer Design Primer design was based on a previous description (Liu et al., 2015). Conserved region of the vlhA gene was used as the target for primer design, which was retrieved
The PCR reaction system (20 μL) included 1 μL DNA template, 0.25 mM upstream and downstream primers (P1 and P2), 10 × PCR buffer, and 2.5 mM dNTPs. The PCR reaction program comprised 3 min pre-denaturation at 94◦ C for 1 cycle, followed by 30 s denaturation at 94◦ C, 40 s at 53◦ C, 40 s extending at 72◦ C for 30 cycles, and final extension at 72◦ C for 10 min. Then, 2% agarose gel electrophoresis was used to identify amplification products.
Sensitivity and Specificity of the PSR Assay The 369-bp conserved fragment of the vlhA gene of a Chinese MS strain (CHN-QZ114-1-2013, Accession number: KU572389) was cloned into a commercial clone vector pMD 18-T (TaKaRa Biotech Corporation, Dalian, China) to develop a standard plasmid (MSvlha). It was diluted 10 times from 8.97 × 106 copies to 8.97 copies to evaluate the sensitivity of the PSR assay compared with that of conventional PCR. PSR
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
S1 S2 P1 P2
VISIBLE DETECTION OF MS USING PSR ASSAY
3
Clinical Sample Testing To further evaluate the efficiency of the PSR assay, 329 clinical samples (including laryngeal swabs, synovial fluid swabs, synovial bursa tissues, and trachea tissues) collected from flocks suspected to have MS infection from Henan, Hubei, and Jiangsu provinces of China were identified using PSR and conventional PCR; positive detection rates were calculated and compared. Samples singly or doubly negative detected by the PCR and PSR assays were tested by MS isolation and culture in Frey Mycoplasma Broth (BD Biosciences, Franklin Lakes, NJ) supplemented with 10% porcine serum, as described in a previous report (Sun et al., 2017).
Figure 1. PSR products at different temperatures in 2% gel electrophoresis, 1 to 6: 60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, 65◦ C, respectively; M: 2,000 marker; N: negative control.
Ethics Statement Swabs collecting and the autopsy protocols for dead chickens were conducted in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The approval of using animals during the process of this study was obtained from South China Agricultural University Committee for Animal Experiments (approved ID: SYXK-2014-0136).
Figure 2. PSR products at different intervals in 2% gel electrophoresis, 1 to 5: 20, 30, 40, 50, 60 min, respectively; M: 2,000 marker; N: negative control.
RESULTS Temperature and Time Optimization of the PSR Assay The optimum temperature was selected using temperatures ranging from 60◦ C to 65◦ C at a gradient of 1◦ C. Electrophoresis revealed no remarkable differences. Finally, the midpoint 62◦ C was selected as the optimum temperature for PSR assay performing in a water bath (Figure 1). Optimum time was selected using a gradient of 20, 30, 40, 50, and 60 min. As time increased, the amplification bands became clearer, reaching a peak at 40 min. There was no further improvement with longer durations, so the optimal time was 40 min (Figure 2). Thus, the optimal PSR time and temperature settings were 40 min and 62◦ C, respectively.
Specificity of the PSR Assay DNA of MS isolates was used as the template for positive control, and MS-H, MG, H9 AIV, IB, ILTV,
Figure 3. (a) PSR-specific products in 2% gel electrophoresis, 1: MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV, and ND; M: 2,000 marker; N: negative control. (b) Visual detection of negative and positive PSR amplification products, 1: MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV, and ND; M: 2,000 marker; yellow represents positive and purple represents negative.
and ND were used as control pathogens for evaluating detection specificity (Figures 3a and 3b). Only the positive control displayed electrophoresis bands and reaction-liquid turned orange, but other negative control displayed no band and reaction-liquid remained
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
and routine PCR were performed in parallel, and reaction products were detected using 2% gel electrophoresis. The specificity of the PSR assay was evaluated using the DNA of MS, MG, and MS-H and cDNA of NDV, ILTV, H9 AIV, and IBV; results were assessed using agarose gel electrophoresis and color rendering with a dye indicator.
4
WU ET AL.
Clinical Sample Testing Routine PCR and PSR were used to detect MS in 329 suspected samples (Table 2). The results highlighted high prevalence of MS infection in China. The positive rate of routine PCR was 65.3% (215/329), while that of PSR was 69.9% (229/329). MS in negative samples detected by both PCR and PSR assays could not be isolated and cultured, but MS in 9 samples undetected by PCR was isolated by the PSR assays. Thus, PSR was more sensitive and suitable for MS detection in the field.
DISCUSSION Figure 4. (a) PSR sensitivity products in 2% gel electrophoresis, 1 to 7: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control. (b) Visual detection of negative and positive PSR amplification products, 1 to 7: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control. (c) PCR sensitivity products in 2% gel electrophoresis, 1 to 6: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control.
purple-red. Thus, the designed primers had good specificity.
Sensitivity of the PSR Assay Under optimum reaction conditions, DNA was diluted in the order of 10 gradient to test the sensitivity of the PSR assay; PCR was performed at the same
As one of the major avian mycoplasmas, MS has overtaken MG in commercial poultry. Recently, MS has become increasingly prevalent in chickens of various age groups (Moreira et al., 2015). MS is mainly transmitted by contact, and sick chickens are the main source of infection. MS can spread through food, water, and feathers (Xue et al., 2017). In addition to horizontal transmission, MS can be transmitted vertically from infected hens to their offspring through eggs (Landman, 2014). We developed a rapid, sensitive, and accurate assay for MS identification in clinical cases; the PSR assay could detect MS strains within 40 min, and the assay could be accomplished using a water bath at a relatively wide temperature range (60◦ C to 65◦ C). Furthermore, the primers could specifically detect MS without cross-reaction with other prevalent pathogens
Table 2. Comparison of the results generated by the PSR and PCR assays using clinical samples. Positive rates Sampling place
Breeds
Date
Sample type
PSR
PCR
Henan Nanyang Hubei Xiangyang Hubei Suizhou Henan Anyang Henan Xuchang Hubei Jingmen Jiangsu Huaian Henan Shangqiu Henan Yuzhou Henan Nanyang Hubei Yichang Hubei Xiaogan Henan Hebi Henan Xinyang Jiangsu Xuzhou Henan Luoyang Henan Nanyang Henan Nanyang
Layer Layer Broiler Layer Broiler Layer Layer Layer Layer Layer Broiler Broiler Layer Layer Layer Layer Layer Layer
2017.04 2017.09 2017.10 2017.10 2017.11 2018.01 2018.01 2018.01 2018.03 2018.03 2018.03 2018.09 2018.09 2018.10 2018.11 2018.11 2018.11 2018.12
Laryngeal swabs Joint fluid swabs Synovial bursa tissues Trachea tissues Joint fluid swabs Synovial bursa tissues Trachea tissues Synovial bursa tissues Synovial bursa tissues Laryngeal swabs Trachea tissues Joint fluid swabs Synovial bursa tissues Trachea tissues Trachea tissues Trachea tissues Laryngeal swabs Synovial bursa tissues
25/39 17/29 7/8 5/7 23/41 11/13 14/15 4/6 9/12 7/19 5/8 13/14 9/9 8/13 12/14 15/19 31/48 14/15
21/39 17/29 7/8 5/7 18/41 11/13 14/15 4/6 9/12 6/19 5/8 13/14 9/9 8/13 12/14 15/19 27/48 14/15
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
template concentration. PSR was more sensitive than conventional PCR (Figure 4). The concentration limit detected by PSR was 8.97 × 10 copies, whereas that detected by PCR was >8.97 × 103 copies. Therefore, the sensitivity of PSR was 100 times more than that of the conventional PCR.
VISIBLE DETECTION OF MS USING PSR ASSAY
ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (grant numbers 31802185 and 31870917), the Scientific and Technological Project of Henan Province (grant numbers 182107000040 and 182102110084), the Key Scientific and Technological Project of The Education Department of Henan Province (grant number 18A230012), Key Scientific and Technological Project of Nanyang City (grant numbersKJGG2018144 and KJGG2018069), and Technological Project of Nanyang normal university (grant numbers 16134, 18046, and 2018CX012).
REFERENCES Ball, C., A. Forresterand, and K. Ganapathy. 2018. Co-circulation of genetically diverse population of vaccine related and unrelated respiratory mycoplasmas and viruses in UK poultry flocks with health or production problems. Vet. Microbiol. 225:132–138. Derksen, T., R. Lampron, R. Hauck, M. Piteskyand, and R. A. Gallardo. 2018. Biosecurity assessment and seroprevalence of respiratory diseases in backyard poultry flocks located close to and far from commercial premises. Avian Dis. 62:1–5. Gupta, V., S. Chakravarti, V. Chander, S. Majumder, S. A. Bhat, V. K. Guptaand, and S. Nandi. 2017. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA. Arch. Virol. 162:1995– 2001. Haesendonck, R., M. Verlinden, G. Devos, T. Michiels, P. Butaye, F. Haesebrouck, F. Pasmansand, and A. Martel. 2014. High seroprevalence of respiratory pathogens in hobby poultry. Avian Dis. 58:623–627. Kaewphinit, T., N. Arunrut, W. Kiatpathomchai, S. Santiwatanakul, P. Jaratsingand, and K. Chansiri. 2013. Detection of Mycobacterium tuberculosis by using loop-mediated isothermal amplification combined with a lateral flow dipstick in clinical samples. Biomed Res. Int. 2013:1–6. Kleven, S. H. 2008. Control of avian mycoplasma infections in commercial poultry. Avian Dis. 52:367–374. Kleven, S. H., G. N. Rowlandand, and M. C. Kumar. 2001. Poor serologic response to upper respiratory infection with Mycoplasma synoviae in turkeys. Avian Dis. 45:719–723. Kreizinger, Z., D. Grozner, K. M. Sulyok, K. Nilsson, V. Hrivnak, D. Bencina, and M. Gyuraneczand. 2017. Antibiotic susceptibility profiles of Mycoplasma synoviae strains originating from Central and Eastern Europe. BMC Vet. Res. 13:342. Kuo, H. C., D. Y. Lo, C. L. Chen, Y. L. Tsai, J. F. Ping, C. H. Lee, P. A. Leeand, and H. G. Chang. 2017. Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device. Poult. Sci. 96:35–41. Kursa, O., A. Pakula, G. Tomczyk, S. Pa´skoand, and A. Sawicka. 2019. Eggshell apex abnormalities caused by two different Mycoplasma synoviae genotypes and evaluation of eggshell anomalies by full-field optical coherence tomography. BMC Vet. Res. 15:1. Kursa, O., G. Wozniakowski, G. Tomczyk, A. Sawickaand, and Z. Minta. 2015. Rapid detection of Mycoplasma synoviae by loopmediated isothermal amplification. Arch. Microbiol. 197:319– 325. Landman, W. J. 2014. Is Mycoplasma synoviae outrunning Mycoplasma gallisepticum? A viewpoint from the Netherlands. Avian Pathol. 43:2–8. Liu, W., D. Dong, Z. Yang, D. Zou, Z. Chen, J. Yuanand, and L. Huang. 2015. Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method. Sci. Rep. 5:12723. Liu, W., D. Zou, X. He, D. Ao, Y. Su, Z. Yang, S. Huang, Q. Zhao, Y. Tang, W. Ma, Y. Lu, J. Wang, X. Wangand, and L. Huang. 2018. Development and application of a rapid Mycobacterium
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
as well as the live vaccine strain MS-H, and its sensitivity was 100 times higher than that of the routine PCR assay. Reportedly, the PSR assay has great potential to rapidly detect Mycobacterium tuberculosis, canine parvovirus 2, and bovine herpesvirus 1 in clinical laboratories for point-of-care diagnosis in low-resource settings (Gupta et al., 2017; Liu et al., 2018; Malla et al., 2018). Compared with other established molecular methods for MS detection, MS–PSR has advantages in terms of practical application. The LAMP assay for MS detection requires 6 primers to target at least 6 sequence regions, strict primer coordination, and low primer mismatch tolerance for a more conserved sequence. MS–PSR requires only 1 pair of primers for amplification, which reduces the method amend cost for primer updates against mismatching caused by MS gene variations. Additionally, MS–PSR results can be observed through color change using a phenol red indicator which shows change in the pH of reaction mixture caused by massive amounts of pyrophosphatic acid byproducts (Tanner et al., 2015). Although LAMP assay results for MS detection can be observed with the naked eye using SYBR Green, the inhibitory effect determining SYBR Green I must be added after the reaction termination. Opening-cap for analysis of detection results increases the probability of aerosol contamination by LAMP-amplified products because both PSR and LAMP assays are very sensitive. In this study, all field isolates positive for MS–PCR (n = 215) could be accurately detected using the novel assay. Of the 14 samples positive for PSR but negative for PCR, 9 were finally confirmed by MS isolation and 5 positive for PSR remained negative by MS isolation. In sample type analysis, all samples were swabs (n = 14), which might contain less MS load than did tissue samples, suggesting that the sensitivity of PCR was lower than that of PSR for MS detection in field samples. Meanwhile, MS isolation from field samples was not as simple as that from bacterial cultures owing the lack of bacterial cell walls and strict requirements of growth environment, both of which reduce the culture sensitivity. Despite these factors, tissue samples from dead birds of the same flocks were confirmed to be positive using both PSR and PCR. Therefore, the 5 swab samples detected negative by PSR assay might be because the Mycoplasma load was lower than that of the actually detectable limit of the PSR assay. In recent years, MS has become widespread, and its eradication after infection remains challenging. Owing to the advantages of the PSR assay, such as simple design, convenient operation, rapid processing, and high sensitivity and specificity, combined with constant temperature conditions, MS can be detected in the field without the use of sophisticated equipment to effectively monitor chickens at point-of-need. Therefore, preventive and treatment measures that allow a timely response to block MS spread will avoid great economic losses.
5
6
WU ET AL. Ramirez, A. S., C. J. Naylor, P. P. Hammondand, and J. M. Bradbury. 2006. Development and evaluation of a diagnostic PCR for Mycoplasma synoviae using primers located in the intergenic spacer region and the 23S rRNA gene. Vet. Microbiol. 118: 76–82. Sun, S. K., X. Lin, F. Chen, D. A. Wang, J. P. Lu, J. P. Qinand, and T. R. Luo. 2017. Epidemiological investigation of Mycoplasma Synoviae in native chicken breeds in China. BMC Vet. Res. 13:115. Tanner, N. A., Y. Zhangand, and T. C. J. Evans. 2015. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques. 58:59–68. Xue, J., M. Y. Xu, Z. J. Ma, J. Zhao, N. Jinand, and G. Z. Zhang. 2017. Serological investigation of Mycoplasma synoviae infection in China from 2010 to 2015. Poult. Sci. 96:3109– 3112. Zhu, L., B. M. Konsak, O. M. Olaogun, R. Agnew-Crumptona, A. Kanci, M. S. Marenda, G. F. Browningand, and A. H. Noormohammadi. 2017. Identification of a new genetic marker in Mycoplasma synoviae vaccine strain MS-H and development of a strategy using polymerase chain reaction and high-resolution melting curve analysis for differentiating MS-H from field strains. Vet. Microbiol. 210:49–55.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
tuberculosis detection technique using polymerase spiral reaction. Sci. Rep. 8:3003. Malla, J. A., S. Chakravarti, V. Gupta, V. Chander, G. K. Sharma, S. Qureshi, A. Mishra, V. K. Guptaand, and S. Nandi. 2018. Novel Polymerase Spiral Reaction (PSR) for rapid visual detection of Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus and semen. Gene 644:107–112. Mekkes, D. R., and A. Feberwee. 2005. Real-time polymerase chain reaction for the qualitative and quantitative detection of Mycoplasma gallisepticum. Avian Pathol. 34:348–354. Mohammed, H. O., T. E. Carpenterand, and R. Yamamoto. 1987. Economic impact of Mycoplasma gallisepticum and M. synoviae in commercial layer flocks. Avian Dis. 31:477–482. Moreira, F. A., L. Cardosoand, and A. C. Coelho. 2015. Epidemiological survey on Mycoplasma synoviae infection in Portuguese broiler breeder flocks. Vet. Ital. 51:93–98. Muhammad, F., J. Hussain, S. K. Fareed, K. T. Ahmad, K. S. Ahmadand, and A. Ahmad. 2018. Diagnosis of avian mycoplasmas: a comparison between PCR and culture technique. Arch Razi Inst 73:239–244. Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Aminoand, and T. Hase. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:63e.
∗
Henan Provincial Engineering Laboratory of Insects Bio-reactor, China-UK-NYNU-RRes Joint Laboratory of Insect Biology, Nanyang Normal University, Nanyang 473061, PR China; † Veterinary Laboratory, Guangzhou Zoo, Guangzhou 510642, PR China; and ‡ College of Animal Science, South China Agricultural University, Guangzhou 510642, PR China say for MS detection was 100 times more than that of the polymerase chain reaction assay based on agarose gel electrophoresis results and color change detected by the naked eye. Further experiments demonstrated that the primers specifically detected MS and showed no cross-reaction with other prevalent avian pathogens. Clinical sample testing confirmed that the MS–PSR assay is simple, rapid, specific, and sensitive, and thereby very suitable for application and promotion in the field and laboratories of grassroots units.
ABSTRACT In this study, a rapid, specific, and sensitive detection assay for Mycoplasma synoviae (MS) was established using a polymerase spiral reaction (PSR) method. A pair of primers were designed according to the conserved region of the vlhA gene of MS, and PSR results were assessed using agarose gel electrophoresis and color rendering with a dye indicator. The optimum reaction temperature and time for PSR using the specific primers were 62◦ C and 40 min in a water bath, respectively. The sensitivity of the PSR as-
Key words: molecular detection, Mycoplasma synoviae, polymerase spiral reaction 2019 Poultry Science 0:1–6 http://dx.doi.org/10.3382/ps/pez356
INTRODUCTION
preventing and controlling the spread of this disease. Diagnostic methods include isolation culture, serological diagnosis, and molecular detection (Ramirez et al., 2006; Haesendonck et al., 2014; Xue et al., 2017). Mycoplasma isolation and serological diagnosis are relatively less sensitive and time-consuming, requiring key reagents, skilled labor, and well-equipped laboratories (Kleven et al., 2001). Molecular analysis, such as that using conventional or real-time PCR, is more sensitive. Real-time PCR detection is a particularly rapid and sensitive method (Mekkes and Feberwee, 2005; Muhammad et al., 2018); however, these methods require sophisticated thermal cyclers that might be expensive for most basic laboratories and highly skilled technicians, both of which render them unsuitable for widespread use in the field. To counteract these disadvantages, isothermal molecular methods for MS detection have been developed, including methods based on loopmediated isothermal amplification (LAMP) and insulated isothermal polymerase chain reaction (iiPCR) (Kaewphinit et al., 2013; Kuo et al., 2017; Kursa et al., 2015). LAMP requires 6 complementary primers for MS detection and is performed in a water bath (Kaewphinit et al., 2013). However, the use of multiple primers greatly increases the design difficulty and development cost (Notomi et al., 2000; Kaewphinit et al., 2013). The iiPCR assay for MS detection can be accomplished in 1 h, but it requires a specific device to partly restrict the
Mycoplasma synoviae (MS), which is widely distributed throughout the world, has imposed huge economic losses to the poultry industry (Mohammed et al., 1987). Chicken and turkey are natural hosts of MS (Kleven, 2008). Typically, acute or chronic infectious synovitis, air sacculitis synovitis, and eggshell apex abnormality develop following MS infection which result in reduced egg production (Zhu et al., 2017; Kursa et al., 2019). In addition, MS infection can produce subclinical symptoms and lead to co-infection with Mycoplasma gallisepticum (MG), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), and other avian pathogens (Sun et al., 2017; Ball et al., 2018; Derksen et al., 2018). Currently, control treatments for MS include the use of vaccines and antibiotics, and doxycycline, oxytetracycline, tylvalosin, tylosin, and pleuromutilins are sensitive antimicrobial agents for MS; however long-term drug use can lead to drug resistance (Kreizinger et al., 2017). Therefore, rapid and accurate MS diagnosis is one of the key factors for C 2019 Poultry Science Association Inc. Received February 6, 2019. Accepted June 1, 2019. 1 Both authors contributed equally to this work. 2 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
Qianqian Wu,∗,1 Xin Xu,∗,1 Qinxi Chen,∗ Kejing Zuo,† Yiting Zhou,∗ Zhibin Zhang,∗ Yunchao Kan,∗ Lunguang Yao,∗ Jun Ji ,∗,2 Yingzuo Bi,‡ and Qingmei Xie‡
2
WU ET AL. Table 1. Primer sets for PSR and PCR. Sequence 5 -3
Primer name
acgaattcgtacatagaagtatag-GTGATCAAACTCCR1 GCACCTGC gatatgaagatacatgcttaagca-ACCTGGGTTTTCTGGGTTTCCT GTGATCAAACTCCR1 GCACCTGC ACCTGGGTTTTCTGGGTTTCCT
(Lower-case letters stands for the stuffing sequences; 1 the italic stands for the degenerate oligonucleotide, R = A+G).
detection throughput and a fluorescent probe, which raise the detection cost (Kuo et al., 2017). In this study, we detected MS using polymerase spiral reaction (PSR), a novel nucleic acid isothermal amplification method invented by Liu Wei (Liu et al., 2015). PSR has the advantages of both PCR and LAMP, but it requires only 1 pair of routine primers to efficiently amplify nucleic acids using a water bath, which reduces detection cost and increases practical application.
MATERIALS AND METHODS Viruses and Clinical Samples Samples were acquired from respiratory laryngeal swabs or synovial fluid of chickens suspected to have MS infection or from the trachea or synovial bursa of chickens suspected to have died from MS infection. Respiratory swabs or tissues were collected under sterile conditions and stored at −80◦ C until further use. MG, MS-H (commercial live attenuated vaccine strain), NDV, infectious laryngotracheitis virus (ILTV), H9 subtype avian influenza virus (H9 AIV), and IBV, as described above, were stored in the Henan Provincial Engineering Laboratory of Insects Bio-reactor, Nanyang Normal University.
from the Chinese MS strain (CHN-QZ114-1-2013) in the NCBI database (Accession number: KU572389). A pair of specific primers for PSR and PCR was designed using Oligo 7.37. The primers were synthesized by Hongxun Technology Co., Ltd (Suzhou, China). Sequences of primers used in this study are listed in Table 1.
PSR Optimization Reaction mixture (25 uL) included 10 mM (NH4 )2 SO4 , 50 mM KCl, 0.1% v/v Tween-20, 1.4 mM dNTPs, 0.8 M Betaine, 4 mM MgSO4 , 8 U Bst DNA polymerase, and 0.8 uM forward and reverse PSR primers (S1 and S2). A pH-sensitive dye (1 μL; 0.025 mM phenol red and 0.08 mM cresol red) was added to each tube. Additionally, 25 uL mineral oil was added to prevent product volatilization. To evaluate the best reaction conditions, temperature optimization was performed using the reaction temperature gradient at 60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, and 65◦ C. Time optimization PSR was performed at gradients of 20, 30, 40, 50, and 60 min. Reaction results were discriminated according to the clarity and brightness of bands obtained using 2% agarose gel electrophoresis.
PCR Assay DNA and RNA Extraction The respiratory laryngeal swabs and synovial fluid swabs were washed with PBS. The obtained trachea or synovial bursa was ground using an appropriate amount of liquid nitrogen and suspended in PBS. Genomic DNA was extracted from each clinical sample (ChargeSwitch gDNA Mini Tissue Kit; Invitrogen Biotech, Waltham, MA) according to the manufacturer’s instructions and stored at −20◦ C. Total RNA from positive samples loaded with control viruses (IB, ND, and H9 AIV) was extracted (RNAiso reagent; TaKaRa Biotechnology, Dalian, China) according to the manufacturers’ instructions. RNA was reverse transcribed into cDNA and stored at −20◦ C.
Primer Design Primer design was based on a previous description (Liu et al., 2015). Conserved region of the vlhA gene was used as the target for primer design, which was retrieved
The PCR reaction system (20 μL) included 1 μL DNA template, 0.25 mM upstream and downstream primers (P1 and P2), 10 × PCR buffer, and 2.5 mM dNTPs. The PCR reaction program comprised 3 min pre-denaturation at 94◦ C for 1 cycle, followed by 30 s denaturation at 94◦ C, 40 s at 53◦ C, 40 s extending at 72◦ C for 30 cycles, and final extension at 72◦ C for 10 min. Then, 2% agarose gel electrophoresis was used to identify amplification products.
Sensitivity and Specificity of the PSR Assay The 369-bp conserved fragment of the vlhA gene of a Chinese MS strain (CHN-QZ114-1-2013, Accession number: KU572389) was cloned into a commercial clone vector pMD 18-T (TaKaRa Biotech Corporation, Dalian, China) to develop a standard plasmid (MSvlha). It was diluted 10 times from 8.97 × 106 copies to 8.97 copies to evaluate the sensitivity of the PSR assay compared with that of conventional PCR. PSR
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
S1 S2 P1 P2
VISIBLE DETECTION OF MS USING PSR ASSAY
3
Clinical Sample Testing To further evaluate the efficiency of the PSR assay, 329 clinical samples (including laryngeal swabs, synovial fluid swabs, synovial bursa tissues, and trachea tissues) collected from flocks suspected to have MS infection from Henan, Hubei, and Jiangsu provinces of China were identified using PSR and conventional PCR; positive detection rates were calculated and compared. Samples singly or doubly negative detected by the PCR and PSR assays were tested by MS isolation and culture in Frey Mycoplasma Broth (BD Biosciences, Franklin Lakes, NJ) supplemented with 10% porcine serum, as described in a previous report (Sun et al., 2017).
Figure 1. PSR products at different temperatures in 2% gel electrophoresis, 1 to 6: 60◦ C, 61◦ C, 62◦ C, 63◦ C, 64◦ C, 65◦ C, respectively; M: 2,000 marker; N: negative control.
Ethics Statement Swabs collecting and the autopsy protocols for dead chickens were conducted in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The approval of using animals during the process of this study was obtained from South China Agricultural University Committee for Animal Experiments (approved ID: SYXK-2014-0136).
Figure 2. PSR products at different intervals in 2% gel electrophoresis, 1 to 5: 20, 30, 40, 50, 60 min, respectively; M: 2,000 marker; N: negative control.
RESULTS Temperature and Time Optimization of the PSR Assay The optimum temperature was selected using temperatures ranging from 60◦ C to 65◦ C at a gradient of 1◦ C. Electrophoresis revealed no remarkable differences. Finally, the midpoint 62◦ C was selected as the optimum temperature for PSR assay performing in a water bath (Figure 1). Optimum time was selected using a gradient of 20, 30, 40, 50, and 60 min. As time increased, the amplification bands became clearer, reaching a peak at 40 min. There was no further improvement with longer durations, so the optimal time was 40 min (Figure 2). Thus, the optimal PSR time and temperature settings were 40 min and 62◦ C, respectively.
Specificity of the PSR Assay DNA of MS isolates was used as the template for positive control, and MS-H, MG, H9 AIV, IB, ILTV,
Figure 3. (a) PSR-specific products in 2% gel electrophoresis, 1: MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV, and ND; M: 2,000 marker; N: negative control. (b) Visual detection of negative and positive PSR amplification products, 1: MS, 2 to 7: MS-H, MG, H9 AIV, IB, ILTV, and ND; M: 2,000 marker; yellow represents positive and purple represents negative.
and ND were used as control pathogens for evaluating detection specificity (Figures 3a and 3b). Only the positive control displayed electrophoresis bands and reaction-liquid turned orange, but other negative control displayed no band and reaction-liquid remained
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
and routine PCR were performed in parallel, and reaction products were detected using 2% gel electrophoresis. The specificity of the PSR assay was evaluated using the DNA of MS, MG, and MS-H and cDNA of NDV, ILTV, H9 AIV, and IBV; results were assessed using agarose gel electrophoresis and color rendering with a dye indicator.
4
WU ET AL.
Clinical Sample Testing Routine PCR and PSR were used to detect MS in 329 suspected samples (Table 2). The results highlighted high prevalence of MS infection in China. The positive rate of routine PCR was 65.3% (215/329), while that of PSR was 69.9% (229/329). MS in negative samples detected by both PCR and PSR assays could not be isolated and cultured, but MS in 9 samples undetected by PCR was isolated by the PSR assays. Thus, PSR was more sensitive and suitable for MS detection in the field.
DISCUSSION Figure 4. (a) PSR sensitivity products in 2% gel electrophoresis, 1 to 7: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control. (b) Visual detection of negative and positive PSR amplification products, 1 to 7: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control. (c) PCR sensitivity products in 2% gel electrophoresis, 1 to 6: 8.97 × 106 to 8.97 copies, diluted 10 times in turn; M: 2,000 marker; N: negative control.
purple-red. Thus, the designed primers had good specificity.
Sensitivity of the PSR Assay Under optimum reaction conditions, DNA was diluted in the order of 10 gradient to test the sensitivity of the PSR assay; PCR was performed at the same
As one of the major avian mycoplasmas, MS has overtaken MG in commercial poultry. Recently, MS has become increasingly prevalent in chickens of various age groups (Moreira et al., 2015). MS is mainly transmitted by contact, and sick chickens are the main source of infection. MS can spread through food, water, and feathers (Xue et al., 2017). In addition to horizontal transmission, MS can be transmitted vertically from infected hens to their offspring through eggs (Landman, 2014). We developed a rapid, sensitive, and accurate assay for MS identification in clinical cases; the PSR assay could detect MS strains within 40 min, and the assay could be accomplished using a water bath at a relatively wide temperature range (60◦ C to 65◦ C). Furthermore, the primers could specifically detect MS without cross-reaction with other prevalent pathogens
Table 2. Comparison of the results generated by the PSR and PCR assays using clinical samples. Positive rates Sampling place
Breeds
Date
Sample type
PSR
PCR
Henan Nanyang Hubei Xiangyang Hubei Suizhou Henan Anyang Henan Xuchang Hubei Jingmen Jiangsu Huaian Henan Shangqiu Henan Yuzhou Henan Nanyang Hubei Yichang Hubei Xiaogan Henan Hebi Henan Xinyang Jiangsu Xuzhou Henan Luoyang Henan Nanyang Henan Nanyang
Layer Layer Broiler Layer Broiler Layer Layer Layer Layer Layer Broiler Broiler Layer Layer Layer Layer Layer Layer
2017.04 2017.09 2017.10 2017.10 2017.11 2018.01 2018.01 2018.01 2018.03 2018.03 2018.03 2018.09 2018.09 2018.10 2018.11 2018.11 2018.11 2018.12
Laryngeal swabs Joint fluid swabs Synovial bursa tissues Trachea tissues Joint fluid swabs Synovial bursa tissues Trachea tissues Synovial bursa tissues Synovial bursa tissues Laryngeal swabs Trachea tissues Joint fluid swabs Synovial bursa tissues Trachea tissues Trachea tissues Trachea tissues Laryngeal swabs Synovial bursa tissues
25/39 17/29 7/8 5/7 23/41 11/13 14/15 4/6 9/12 7/19 5/8 13/14 9/9 8/13 12/14 15/19 31/48 14/15
21/39 17/29 7/8 5/7 18/41 11/13 14/15 4/6 9/12 6/19 5/8 13/14 9/9 8/13 12/14 15/19 27/48 14/15
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
template concentration. PSR was more sensitive than conventional PCR (Figure 4). The concentration limit detected by PSR was 8.97 × 10 copies, whereas that detected by PCR was >8.97 × 103 copies. Therefore, the sensitivity of PSR was 100 times more than that of the conventional PCR.
VISIBLE DETECTION OF MS USING PSR ASSAY
ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (grant numbers 31802185 and 31870917), the Scientific and Technological Project of Henan Province (grant numbers 182107000040 and 182102110084), the Key Scientific and Technological Project of The Education Department of Henan Province (grant number 18A230012), Key Scientific and Technological Project of Nanyang City (grant numbersKJGG2018144 and KJGG2018069), and Technological Project of Nanyang normal university (grant numbers 16134, 18046, and 2018CX012).
REFERENCES Ball, C., A. Forresterand, and K. Ganapathy. 2018. Co-circulation of genetically diverse population of vaccine related and unrelated respiratory mycoplasmas and viruses in UK poultry flocks with health or production problems. Vet. Microbiol. 225:132–138. Derksen, T., R. Lampron, R. Hauck, M. Piteskyand, and R. A. Gallardo. 2018. Biosecurity assessment and seroprevalence of respiratory diseases in backyard poultry flocks located close to and far from commercial premises. Avian Dis. 62:1–5. Gupta, V., S. Chakravarti, V. Chander, S. Majumder, S. A. Bhat, V. K. Guptaand, and S. Nandi. 2017. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA. Arch. Virol. 162:1995– 2001. Haesendonck, R., M. Verlinden, G. Devos, T. Michiels, P. Butaye, F. Haesebrouck, F. Pasmansand, and A. Martel. 2014. High seroprevalence of respiratory pathogens in hobby poultry. Avian Dis. 58:623–627. Kaewphinit, T., N. Arunrut, W. Kiatpathomchai, S. Santiwatanakul, P. Jaratsingand, and K. Chansiri. 2013. Detection of Mycobacterium tuberculosis by using loop-mediated isothermal amplification combined with a lateral flow dipstick in clinical samples. Biomed Res. Int. 2013:1–6. Kleven, S. H. 2008. Control of avian mycoplasma infections in commercial poultry. Avian Dis. 52:367–374. Kleven, S. H., G. N. Rowlandand, and M. C. Kumar. 2001. Poor serologic response to upper respiratory infection with Mycoplasma synoviae in turkeys. Avian Dis. 45:719–723. Kreizinger, Z., D. Grozner, K. M. Sulyok, K. Nilsson, V. Hrivnak, D. Bencina, and M. Gyuraneczand. 2017. Antibiotic susceptibility profiles of Mycoplasma synoviae strains originating from Central and Eastern Europe. BMC Vet. Res. 13:342. Kuo, H. C., D. Y. Lo, C. L. Chen, Y. L. Tsai, J. F. Ping, C. H. Lee, P. A. Leeand, and H. G. Chang. 2017. Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device. Poult. Sci. 96:35–41. Kursa, O., A. Pakula, G. Tomczyk, S. Pa´skoand, and A. Sawicka. 2019. Eggshell apex abnormalities caused by two different Mycoplasma synoviae genotypes and evaluation of eggshell anomalies by full-field optical coherence tomography. BMC Vet. Res. 15:1. Kursa, O., G. Wozniakowski, G. Tomczyk, A. Sawickaand, and Z. Minta. 2015. Rapid detection of Mycoplasma synoviae by loopmediated isothermal amplification. Arch. Microbiol. 197:319– 325. Landman, W. J. 2014. Is Mycoplasma synoviae outrunning Mycoplasma gallisepticum? A viewpoint from the Netherlands. Avian Pathol. 43:2–8. Liu, W., D. Dong, Z. Yang, D. Zou, Z. Chen, J. Yuanand, and L. Huang. 2015. Polymerase Spiral Reaction (PSR): A novel isothermal nucleic acid amplification method. Sci. Rep. 5:12723. Liu, W., D. Zou, X. He, D. Ao, Y. Su, Z. Yang, S. Huang, Q. Zhao, Y. Tang, W. Ma, Y. Lu, J. Wang, X. Wangand, and L. Huang. 2018. Development and application of a rapid Mycobacterium
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
as well as the live vaccine strain MS-H, and its sensitivity was 100 times higher than that of the routine PCR assay. Reportedly, the PSR assay has great potential to rapidly detect Mycobacterium tuberculosis, canine parvovirus 2, and bovine herpesvirus 1 in clinical laboratories for point-of-care diagnosis in low-resource settings (Gupta et al., 2017; Liu et al., 2018; Malla et al., 2018). Compared with other established molecular methods for MS detection, MS–PSR has advantages in terms of practical application. The LAMP assay for MS detection requires 6 primers to target at least 6 sequence regions, strict primer coordination, and low primer mismatch tolerance for a more conserved sequence. MS–PSR requires only 1 pair of primers for amplification, which reduces the method amend cost for primer updates against mismatching caused by MS gene variations. Additionally, MS–PSR results can be observed through color change using a phenol red indicator which shows change in the pH of reaction mixture caused by massive amounts of pyrophosphatic acid byproducts (Tanner et al., 2015). Although LAMP assay results for MS detection can be observed with the naked eye using SYBR Green, the inhibitory effect determining SYBR Green I must be added after the reaction termination. Opening-cap for analysis of detection results increases the probability of aerosol contamination by LAMP-amplified products because both PSR and LAMP assays are very sensitive. In this study, all field isolates positive for MS–PCR (n = 215) could be accurately detected using the novel assay. Of the 14 samples positive for PSR but negative for PCR, 9 were finally confirmed by MS isolation and 5 positive for PSR remained negative by MS isolation. In sample type analysis, all samples were swabs (n = 14), which might contain less MS load than did tissue samples, suggesting that the sensitivity of PCR was lower than that of PSR for MS detection in field samples. Meanwhile, MS isolation from field samples was not as simple as that from bacterial cultures owing the lack of bacterial cell walls and strict requirements of growth environment, both of which reduce the culture sensitivity. Despite these factors, tissue samples from dead birds of the same flocks were confirmed to be positive using both PSR and PCR. Therefore, the 5 swab samples detected negative by PSR assay might be because the Mycoplasma load was lower than that of the actually detectable limit of the PSR assay. In recent years, MS has become widespread, and its eradication after infection remains challenging. Owing to the advantages of the PSR assay, such as simple design, convenient operation, rapid processing, and high sensitivity and specificity, combined with constant temperature conditions, MS can be detected in the field without the use of sophisticated equipment to effectively monitor chickens at point-of-need. Therefore, preventive and treatment measures that allow a timely response to block MS spread will avoid great economic losses.
5
6
WU ET AL. Ramirez, A. S., C. J. Naylor, P. P. Hammondand, and J. M. Bradbury. 2006. Development and evaluation of a diagnostic PCR for Mycoplasma synoviae using primers located in the intergenic spacer region and the 23S rRNA gene. Vet. Microbiol. 118: 76–82. Sun, S. K., X. Lin, F. Chen, D. A. Wang, J. P. Lu, J. P. Qinand, and T. R. Luo. 2017. Epidemiological investigation of Mycoplasma Synoviae in native chicken breeds in China. BMC Vet. Res. 13:115. Tanner, N. A., Y. Zhangand, and T. C. J. Evans. 2015. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. BioTechniques. 58:59–68. Xue, J., M. Y. Xu, Z. J. Ma, J. Zhao, N. Jinand, and G. Z. Zhang. 2017. Serological investigation of Mycoplasma synoviae infection in China from 2010 to 2015. Poult. Sci. 96:3109– 3112. Zhu, L., B. M. Konsak, O. M. Olaogun, R. Agnew-Crumptona, A. Kanci, M. S. Marenda, G. F. Browningand, and A. H. Noormohammadi. 2017. Identification of a new genetic marker in Mycoplasma synoviae vaccine strain MS-H and development of a strategy using polymerase chain reaction and high-resolution melting curve analysis for differentiating MS-H from field strains. Vet. Microbiol. 210:49–55.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez356/5521383 by Nottingham Trent University user on 18 July 2019
tuberculosis detection technique using polymerase spiral reaction. Sci. Rep. 8:3003. Malla, J. A., S. Chakravarti, V. Gupta, V. Chander, G. K. Sharma, S. Qureshi, A. Mishra, V. K. Guptaand, and S. Nandi. 2018. Novel Polymerase Spiral Reaction (PSR) for rapid visual detection of Bovine Herpesvirus 1 genomic DNA from aborted bovine fetus and semen. Gene 644:107–112. Mekkes, D. R., and A. Feberwee. 2005. Real-time polymerase chain reaction for the qualitative and quantitative detection of Mycoplasma gallisepticum. Avian Pathol. 34:348–354. Mohammed, H. O., T. E. Carpenterand, and R. Yamamoto. 1987. Economic impact of Mycoplasma gallisepticum and M. synoviae in commercial layer flocks. Avian Dis. 31:477–482. Moreira, F. A., L. Cardosoand, and A. C. Coelho. 2015. Epidemiological survey on Mycoplasma synoviae infection in Portuguese broiler breeder flocks. Vet. Ital. 51:93–98. Muhammad, F., J. Hussain, S. K. Fareed, K. T. Ahmad, K. S. Ahmadand, and A. Ahmad. 2018. Diagnosis of avian mycoplasmas: a comparison between PCR and culture technique. Arch Razi Inst 73:239–244. Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Aminoand, and T. Hase. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28:63e.