Rapid biodegradation of atrazine by Ensifer sp. strain and its degradation genes

International Biodeterioration & Biodegradation 116 (2017) 133e140

Contents lists available at ScienceDirect

International Biodeterioration & Biodegradation journal homepage: www.elsevier.com/locate/ibiod

Rapid biodegradation of atrazine by Ensifer sp. strain and its degradation genes Limin Ma a, *, Songsong Chen b, Jing Yuan b, Panpan Yang a, Ying Liu b, Kathryn Stewart b, ** a b

Key Laboratory of Yangzi River Water Environment, Ministry of Education, Tongji University, Shanghai, 200092, China State Key Laboratory of Pollution Control and Resources Reuse, Tongji University, Shanghai, 200092, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 23 May 2016 Received in revised form 11 October 2016 Accepted 13 October 2016

A bacterial strain (CX-T) capable of utilizing atrazine as a nitrogen source for growth was isolated from an industrial soil sample via enrichment culture. The isolate was identified as an Ensifer sp. which can metabolize atrazine (100 mg L
1) completely within 30 h in a liquid culture medium. Factors such as temperature, pH and the shaker speed were analyzed with regard to their effect on atrazine degradation in liquid medium. It was found that atrazine removal efficiency varied significantly depending on temperature (mean degradation efficiency: 54.30% at 25  C, 99.71% at 30  C and 84.7% at 35  C, P<0.01) and is optimal under neutral to acidic conditions (pH 5, 91.54%; pH 7, 99.71%; pH 9, 91.71%, P<0.01), as well as low shaker speeds (100 rpm (99.38%) and 180 rpm (99.71%) P<0.01). Additionally through Polymerase Chain Reaction (PCR), degradation genes atzA, atzB, atzC, atzD, atzE and atzF were amplified successfully using highly conserved primers, while trzN and trzD were not detected. We propose these unique genes enabled the CX-T strain to mineralize atrazine, supported by the observation of its growth in the cyanuric acid medium. We conclude CX-T could be a useful bioremediation tool for atrazine polluted soils. © 2016 Published by Elsevier Ltd.

Keywords: Atrazine Degrading strains Ensifer sp. Degradation genes Degradation pathway

1. Introduction Atrazine (2-chloro-4-2-isopropylamino-6-ethylamino-striazine) a member of triazine family herbicides has been extensively used as a pre-and post-emergence herbicide to control annual grass and broadleaf weeds in the agriculture of corn, sorghum and other crops. After decades of application, the parent compound and transformation products were frequently detected in groundwater and even in raw drinking water (significantly beyond phase-out period), sometimes even at concentration(s) above legal limits (3 mg L
1, US. EPA) (Houot et al., 2000; Singh et al., 2004; Omotayo et al., 2013). Due to its relative persistence in soil and water, atrazine has shown risks to ecological systems and public health, such as reduced biodiversity, contaminated food, and even damaged future crops (Delmonte and Bedmar, 1997; Popov et al., 2005). Researchers to date also suggests that as an environmental endocrine disruptor, atrazine can interrupt regular

* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (K. Stewart). http://dx.doi.org/10.1016/j.ibiod.2016.10.022 0964-8305/© 2016 Published by Elsevier Ltd.

(L.

Ma),

[email protected]

hormone function and cause birth defects, reproductive tumors, and weight loss in amphibians as well as in human (Ribas et al., 1998; Sanderson et al., 2000; Singh et al., 2004; Mizota and Ueda, 2006). Therefore, removal of atrazine in the environment is of increasing public concern. Environmental atrazine removal involves either biotic transformation processes mediated by microorganisms (Meyer et al., 2009), or abiotic processes such as chemical and photochemical reactions (Azenha et al., 2003; Baranda et al., 2012). Biodegradation involving microbial communities is generally recognized as the most important route of pesticide degradation (Fenner et al., 2013). Some fungi (Eukaryota) and bacteria (Prokaryota) typically transform atrazine for detoxification or through fortuitous metabolism by broad-spectrum enzymes, and more commonly metabolize them for assimilation as essential nutrients and energy. As some studies have shown, certain soil bacteria can degrade atrazine effectively (Topp et al., 2000; Singh et al., 2004; Satsuma, 2010;
ndez et al., 2012) however, hydrolytic dechlorination, dealFerna kylation and s-triazine ring cleavage are all key steps involved in complete atrazine biodegradation (Mandelbaum et al., 1993). For example, the gram-negative bacterium Pseudomonas sp. strain ADP was one of the first organisms demonstrated to be able to

134

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

mineralize the s-trazine herbicid atrazine, utilizing atrazine as a sole nitrogen source via the transformation to cyanuric acid through a pathway encoded by two sets of genes: the constitutively expressed atzA (Souza et al., 1995), atzB (BoundyMills et al., 1997), and atzC (Sadowsky et al., 1998) located on plasmid pADP-1, and genes of the lower pathway including atzD, atzE, and atzF (Martinez et al., 2001). Additionally, trzN encoding the enzyme atrazine chlorohydrolase in Arthrobacter sp. TC1 (Sajjaphan et al., 2004) and Nocardioides sp. (Topp et al., 2000), and trzD encoding the enzyme cyanuric acid hydrolase in Pseudomonas sp. (Karns, 1999) and Chelatobacter sp. (Rousseaux et al., 2001), have been observed to metabolize atrazine in a similar way. However, of these four degradation pathways, few species have been thoroughly studied in detail (Altschul et al., 1990; Rousseaux et al., 2001). Given large-scale agricultural utilization, and the extreme toxicity of atrazine to humans and the environment, there is an urgent need to find new soil microorganisms capable of complete atrazine biodegradation. To achieve this, our study focused on the strains isolated from atrazine contamination soils and characterized their genes, mechanisms, and efficacy of degradation. This research will assist in our understanding of how to remediate and/ or control wide-spread pesticide pollution effectively in the environment. 2. Materials and methods 2.1. Soil samples and reagents Soil samples (1.5 kg) were collected on 23rd May 2013 at a depth of 0e10 cm near an atrazine production plant located in Changxing County, Zhejiang Province China (310100800 N, 119 500 5800 E). The physical and chemical properties of the soil sample and original atrazine content are shown in Table 1. Pure atrazine (purity 98%, TCI Development Co., Ltd, Shanghai, China) was used as a standard to characterize atrazine-degrading bacteria. Bacterial strains were cultured on cyanuric acid with purity 98% (TCI Shanghai, China) medium, and atrazine standard with purity 99% (Germany, Dr. Ehrenstorfer) was used for HPLC analytical measures. Culture medium, as described by Mandelbaum et al. (1995), and an improved liquid culture medium (LCM) were employed to produce higher cell densities. LCM comprised of 1.6 g L
1 K2PO4, 0.4 g L
1 KH2PO4, 0.2 g L
1 MgSO4, 0.1 g L
1 NaCl, and 3 g L
1 sucrose, further containing a trace element solution of 5 mL and 100 ppm atrazine as the sole nitrogen source. After preparation, the LCM was then sterilized at 121  C for 30 min. The trace elements solution contained 2.75 g L
1 of FeSO4$7H2O, 0.33 g L
1 of MnSO4$7H2O, 0.24 g L
1 of CoCl2$6H2O, 1.15 g L
1 of ZnSO4$7H2O, 0.24 g L
1 of CuSO4$5H2O, and 0.17 g L
1 of Na2MoO4. Alternatively, the cyanuric acid medium treatments contained 100 ppm of cyanuric acid as the sole nitrogen source instead of atrazine, with all other protocols remaining the same. 2.2. Enrichment and isolation 5.0 g of each collected (and homogenized) soil sample was added to a 250 mL flask with 100 mL LCM. The flasks were then

incubated at 30  C for 24 h (QHZ-98A, Taicang Huamei Biochemistry Instrument Factor, China). In total, 1.0 mL of enrichment culture was then sub-cultured into fresh medium every 5e7 days. After 4 weeks, the final culture was diluted and plated on atrazine agar plates where the isolates of interest were surrounded by a hydrolysis circle. Incubation conditions and experimental protocols were performed as those described in previous report (Stelting et al., 2014). The bacterial isolate strain CX-T was subsequently selected for further experiments. All experiments were done in triplicate. 2.3. Biodegradation Culture temperature, pH and shaker speed in liquid culture medium were reported important factors influencing microorganism degradation efficiency (Zhang et al., 2009), therefore we further studied the growth and degradation characteristic of the CX-T strain at different pHs, temperatures, and shaker speeds during the culture process. We set the pH at 5, 7 and 9, culture temperature at 25  C, 30  C and 35  C, and varied shaker speed from 100 rpm, 180 rpm and 260 rpm to investigate any possible effects of these factors on biodegradation. All experiments were carried out in triplicate and one uninoculated medium was used as a negative control. Bacteria grown on the medium were harvested by centrifugation at 6000 rpm for 20 min, washed twice with phosphate buffered saline, and then re-suspended in phosphate buffered saline (OD600 ¼ 2.0). Thereafter 1 mL of the bacterial suspension was inoculated in 100 mL fresh medium for 45 h (see Mollstam and Connolly, 2013). 2.4. Degradation of atrazine and its potential metabolites Concentrations of remaining atrazine and its metabolites were measured using a LC-A10 series HPLC system and quantified with to, Japan) using 25 mL CLASS VP V6.10 software (both Shimadzu, Kyo samples and an Allure C18 column (5 mm, 150  4.6 mm, Restek, Beijing, China). Peak separation was conducted using gradient elution at a flow rate of 0.8 mL min
1, with oven temperature set to 45  C. Initial eluent conditions were 15% acetonitrile and 85% KH2PO4 buffer (1 mmol L
1, pH 7) isocratic for 1 min followed by a linear gradient to 55% acetonitrile within 9 min, afterwards increasing linearly to 75% acetonitrile within 3 min (hold 2 min). Subsequently, initial conditions were reached within 2 min. Compounds were detected by UV absorbance at 220 nm (Schürner et al., 2015). For the identification of the other metabolites, 150 mL sample were frozen until analysis. 10 mL sub-samples were analyzed using an Agilent HP 1200 HPLC system coupled to a Q-Trap MS/MS system (Applied Biosystems, Toronto, Canada). Mass spectrometry was carried out in the enhanced product ion scan mode. Ionization was accomplished by electrospray ionization (ESI) in the positive ion mode, with an ion spray voltage of 4600 V. De-clustering potential (DP) was 46 V, entrance potential (EP) 4.5 V, collision energy (CE) 23 eV, and collision cell exit potential was 4 eV. Nitrogen was used as a curtain gas, collision gas, turbo gas and nebulizer gas, with the turbo gas temperature at 400  C (Schürner et al., 2015; Meyer et al.,

Table 1 : Physical and chemical properties of the soil sample. TN signifies total nitrogen, TP for total phosphorus, TK for total potassium, and SOM for soil organic matter. Soil type

Bulk density (g cm
3)

Porosity (%)

Clay (g kg
1)

Silt (g kg
1)

Sand (g kg
1)

Moisture content (%)

pH

TN (g kg
1)

TP (g kg
1)

TK (g kg
1)

SOM (g kg
1)

Atrazine (mg kg
1)

Paddy Soil

1.04

60.75

326.1

446.5

227.4

37%

7.36

1.84

0.38

0.30

37.39

73.85

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

2014).

KX91222-KX912227, NC_00871.2).

2.5. DNA extraction and amplification

3. Results

Bacterial DNA was extracted according to manufacturer's protocols for the Fast DNA®SPIN Kit for Soil (Mpbio, USA). To approximate the taxonomic affinity, 16S rRNA was amplified by Polymerase Chain Reaction (PCR) using the universal primers 27f (50 -AGAGTTTGATCMTGGCTCAG-30 ), positions 8e27 of Escherichia coli 16S rRNA gene, and 1492r (50 -TACGGHTACCTTGTTACGACTT-30 ), positions 1492e1513 of E. coli 16S rRNA gene, and cloned in pGEMT. PCR reactions were conducted in a final volume of 25 mL using 2.5 mL, 20e50 ng mL
1 of DNA template, 2.5 mM of dNTPs, 5 mM of each specific primer and 1.00 U of Taq DNA polymerase. We used ABI Applied Biosystem (Veriti 96 Well, ABI, USA) using modified PCR conditions from Devers et al. (2007) as follows: initial denaturation step of 98  C for 3 min, followed by 30 cycles of 95  C for 25 s, 55  C for 25 s, and 72  C for 1 min, followed by a final elongation step of 72  C for 10 min. All PCR reactions were checked on 1% agarose gel electrophoresis, run at 150 V, 100 mA for 20 min stained with 4S Red Plus Nucleic Acid Stain (BBI). The 16S rRNA amplicons were sequenced bi-directionally with primers7F and 1540R at Sangon Biotech (Shanghai, China). Resulting bacterial sequences where then compared with those available in the NCBI database using BLAST (Altschul et al., 1990). Neighbor-joining trees (bootstrapping 1000 times) were constructed using MEGA version 5.0 (Tamura et al., 2011) to assess the most likely bacterial strain kinship. Atrazine-degrading genes of pure strains were detected by PCR with the gene-specific oligonucleotide primers (Table 2). Amplifications were carried out in ABI Applied Biosystem (Veriti 96 Well, ABI, USA) as follows: 94  C for 3 min, 35e50 cycles at 94  C for 30 s, optimal annealing temperature (Table 2) for 30 s, and 72  C for 3 min, plus an additional 10 min at 72  C for elongation. The amplicons were visualized and assessed in a 1% agarose gel (as described above) and analyzed with a FR-980 gel electrophoresis image analysis system (China, Furi).

3.1. Identification and degradation efficiency

2.6. Statistical analysis Batch experiments were done in triplicate. Analysis of Variance (ANOVA) followed by multiple comparison testing using the Friedman ANOVA procedure was performed at the 0.05 level using SPSS version 9.0 (IBM Corp. 2012). All data and genetic sequences have been deposited in DRYAD (GeneBank accession numbers

135

In this study we observed only one organism, CX-T, to metabolize atrazine for assimilation as sole nitrogen source (Fig. 1). After sequence identification and comparison in BLAST and GenBank, and subsequent alignment in MEGA, the 1398 bp sequence of CX-T demonstrated more than 98% nucleotide similarity with strains from the genus Ensifer sp., suggesting a high likelihood it originated from the same genera (Fig. 2). CX-T was observed to degrade atrazine in the LCM at a constant rate within the first 28 h (Fig. 3). Degradation rate from 28 to 30 h substantially slowed down, likely due to a lack of substrate, with complete degradation within 30 h (Fig. 3). Our negative control with no inoculated CX-T showed no discernable degradation of atrazine over the same 30 h. The degradation efficiency of CX-T was also found to vary based on temperature, with atrazine degradation at 30  C to be better than at 25  C and 35  C (P < 0.01, Table 3). The mean degradation efficiency of CX-T at 25  C, 30  C and 35  C was 54.3%, 99.7% and 84.7%, respectively (Fig. 4). CX-T degradation also fluctuated with pH, with a neutral LCM showing complete degradation, whereas higher pH showed less atrazine degradation (5, 91.5%; 7, 99.7%; 9, 91.7%, P < 0.01) (Fig. 4, Table 3). Shaker speed similarly altered the rate of atrazine degradation, with 100 rpm (99.4%) and 180 rpm (99.7%) showing near equal rates of degradation, but substantially higher than at speeds of 260 rpm (61.3%) (P < 0.01, Fig. 4, Table 3). 3.2. Degradation pathway and genes Ion at m/z 198 and m/z129 were detected in the 30 h sample of CX-T culture via mass spectrum (Figs. 5 and 6), corresponding to the molecular ions of 2-hydroxyatrazine (m/z 197) reported by Liang et al. (2016) and cyanuric acid (m/z 129) reported by Draher et al. (2016). Results of gene amplification are shown in Table 4. To determine the degradation pathway of CX-T was similar to those found in Nocardioides sp. C190 (Mulbry et al., 2002), in Pseudomonas sp. ADP (de Souza et al., 1998) and in Pseudomonas sp. NRRLB-12227 (Karns, 1999), gene-specific oligonucleotide primers were used to amplify the degradation genes and complementary LC-MS was used for products analysis (Table 4). Product analysis (Fig. 5) illustrated 2-hydroxyatrazine (HA) detection by LC-MS,

Table 2 Previously published primers (F for forward, R for reverse) used for PCR amplification of atrazine degradation genes, including individual nucleotide sequences and annealing temperatures. Gene

Primer

Nucleotide Sequence (50 -30 )

Annealing Temperature ( C)

Reference

trzN

trzN-F trzN-R atzA-F atzA-R atzB-F at B-R atzC-F atzC-R atzD392f atzD949r trzD274f trzD936r atzE-F atzE-R atzF-F atzF-R

CACCAGCACCTGTACGAAGG GATTCGAACCATTCCAAACG CCATGTGAACCAGATCCT TGAAGCGTCCACATTACC TCACCGGGGATGTCGCGGGC CTCTCCCGCATGGCATCGGG GCTCACATGCAGGTACTCCA GTACCATATCACCGTTTGCCA ACGCTCAGATAACGGAGA TGTCGGAGTCACTTAGCA CACTGCACCATCTTCACC GTTACGAACCTCACCGTC TACGCGGTAAAGAATCTGTT GGAGACCGGCTGAGTGAGA CGATCGGAAAAACGAACCTC CGATCGCCCCATCTTCGAAC

55

Mulbry et al., 2002

50

de Souza et al., 1998

63

de Souza et al., 1998

55

de Souza et al., 1998

50

Fruchey et al., 2003

50

Fruchey et al., 2003

50

Martinez et al., 2001

55

Martinez et al., 2001

atzA atzB atzC atzD trzD atzE atzF

136

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

Fig. 1. Growth curve of Ensifer sp. in liquid culture medium with atrazine as nitrogen source (blue-) and no nitrogen (redC).

Fig. 2. 16S rRNA electrophoresis image, and the neighbor-joining phylogenetic tree with bootstrap values, of the bacterial strain CX-T (highlighted with a box).

suggesting CX-T likely contains hydrolytic dechlorination gene trzN or atzA. PCR amplification of gene atzA validated CX-T harbors the gene atzA rather than trzN. After sequence identification in BLAST, sequence of atzA has 98% similarity with Alicycliphilus sp. CRZ1. (Sequence ID: NZ_ALEE01000045.1). We further detected cyanuric acid through the LC-MS implying CX-T contains atzB and atzC which was corroborated through the successful amplification of both atzB and atzC. After sequence identification in BLAST, sequence of atzB has 100% similarity with Arthrobacter aurescens TC1 plasmid TC1 (Sequence ID: NC_00871.2). Gene atzB encodes the AtzB enzyme which catalyzes 2-hydroxyatrazine to yield N-isopropylammelide. Gene atzC encodes for the AtzC enzyme, which then further catalyzes N-isopropylammelide to yield cyanuric acid, similar to many other species (e.g. Sinorhizobium sp. NEA-B, Devers et al., 2007; Arthrobacter sp. AD26, Prapaipong et al., 2008; Nocardioides sp. EAA-3; Nocardioides sp. EAA-4, Omotayo et al., 2013; Polaromonas sp. NEA-C, Devers et al., 2007). Meanwhile, CX-T was shown to

Fig. 3. Mean ± SD of the remaining concentration of atrazine over time for Ensifer. sp. CX-T (C) and the sterile control (-).

utilize cyanuric acid as a nitrogen source, implying strain CX-T also contains one of the following genes, trzD or atzD. The enzymes TrzD and AtzD, encoded by trzD and atzD, can individually catalyze cyanuric acid to yield carbon dioxide and biuret (Karns, 1999; Martinez et al., 2001). The successful amplification of gene atzD (no significant similarity found after sequence identification in BLAST) implies CX-T harbors the gene atzD rather than trzD. Genes atzE and atzF, were also amplified successfully suggesting CX-T has the capacity to mineralize atrazine completely however no significant similarity found after sequence identification of atzE and atzF (Fig. 7). 4. Discussion Just as plant rhizosphere may be important in promoting the biological degradation of xenobiotics, ultimately facilitating the isolation of pollutant degraders (Fruchey et al., 2003), studies also show numerous atrazine degrading strains via soil enrichment.

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

137

Table 3 P value for the effects of pH, Temperature (T) and shaker speed (SP) on degradation efficiency.

p-value

pH

T

SP

pH  T

pH  SP

T  SP

pH  T  SP

0.000117

1.61  10
7

5.01  10
6

5.47  10
12

8.45  10
8

4.1  10
11

1.56  10
15

Fig. 4. Mean ± SD degradation efficiencies (% of converted atrazine) under different conditions of temperature, pH, and shaker speed (value of p < 0.01 are marked **, p > 0.05 are marked ns (no significant)).

Fig. 5. Metabolites as demonstrated via HPLC-MS/MS, with illustrated target fragment-ions (198.78) of 2-hydroxyatrazine.

Supporting a previously made hypothesis (Udikovic-Kolic et al., 2011), Matin-Laurent and colleagues (2004) demonstrated with prolonged exposure and/or repeated atrazine application,

degrading bacterial communities can be stimulated within the environment. Here we show bacterial strain CX-T, enriched from soil that remained highly contaminated with atrazine over

138

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

Fig. 6. Metabolites detected via HPLC-MS/MS, with illustrated target fragmention-ions (129.82) of cyanuric acid.

Table 4 Cyanuric acid (CA) specificity test and atrazine degrading-genes. (þrepresents the strain CX-T can grow on cyanuric acid agar plates in substrate experiment and target genes were amplified in DNA extraction and amplification experiment, -represents target genes were not amplified in the experiment.)

Isolate CX-T

Substrate

genes

CA þ

trzN d

atzA þ

atzB þ

atzC þ

atzD þ

trzD d

atzE þ

atzF þ

Fig. 7. Degradation genes of CX-T and degradation pathway of atrazine to the left of the electrophoresis image of each amplified gene. Each lane represents the following genes: Lane 1, atz A; Lane 2, atz B; Lane 3 atz C; Lane 4, atz D; Lane 5, atz E; Lane 6, atz F.

prolonged periods of time and likely a close relative of Ensifer sp., can degrade atrazine within 30 h. CX-T genes also suggest that this strain can mineralize atrazine to cyanuric acid and use cyanuric acid as a nitrogen source, thus completely biodegrading this environmental pollutant. Belonging to the Rhizobiaceae family, Ensifer sp. is widely distributed in soil and has been reported previously to successfully degrade atrazine. For example, Rhizobium sp. PATR (Bouquard et al., 1997), was previously isolated from agricultural soil and found to actively transform atrazine to 2-hydroxy-atrazine. The enzymatic reaction showed Rhizobium sp. PATR had 92% identity with an internal sequence of atrazine chlorohydrolase (AtzA) from Pseudomonas sp. ADP. Similarly, 76 rhizobial isolates (belonging to 4 different genera) obtained from the root nodules of several legumes were found to have only a few strains that were unable to utilize
mez, 2005). While atrazine as nitrogen source (Zabaloy and Go demonstrating the ability of soil microbiota to degrade atrazine was pivotal in these studies, they were unable to further demonstrate the specific degradation genes and degradation pathways. On the other hand, Sinorhizobium sp. NEA-B (Devers et al., 2007) and Arthrobacter aurescens TC1 (Sajjaphan et al., 2004) isolated from soil, have been demonstrated to utilize the trzN, atzB, atzC pathway. Indeed, few studies have reported the identification, characterization and pathway of atrazine-degrading microbial strains in detail. Importantly, CX-T may mineralize cyanuric acid completely, a function restricted to merely a few microbial species (Omotayo et al., 2013). For example, 2-hydroxyatrazine has been noted as the first metabolite in mineralizing cyanuric acid, and is catalyzed by enzyme atzA or trzN for most strains known to utilize atrazine (E.g. Rhizobium sp., Fajardo et al., 2012; Sinorhizobium sp., Bellini et al., 2014). Cyanuric acid has been regarded as an important metabolic intermediate for such strains as Pseudomonas sp. ADP

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

and Arthrobacter sp. MCM B-436 which can mineralize atrazine to H2O, CO2 and NH3. Meanwhile, it is viewed as a dead-end metabolite of the strains Arthrobacter sp. DAT1 (Wang and Xie, 2012) and Arthrobacter sp. TC1 (Sajjaphan et al., 2004), unable to mineralize atrazine completely. Atrazine mineralization is seldom known with Rhizobium sp. let alone Ensifer sp, however here we demonstrate CX-T can degrade atrazine and even utilize cyanuric acid as nitrogen source for complete biodegradation. Further research is certainly warranted however, to fully understand the degradation mechanism of CX-T, particularly for a range of microbial communities. Remarkably, cleavage of the s-triazine ring is a key step in the process that microorganism utilize to remove s-triazine from the environment, wherein their carbon and nitrogen are recycled (Karns, 1999). However, related genes trzD and atzD have not previously been found in the Rhizobiaceae family of bacteria thus far. This is the first study that we know where atzD from a Rhizobiaceae was successfully amplified. Our research reveals a pathway of Rhizobiaceae which has been demonstrated in Pseudomonas sp. ADP (de Souza et al., 1998) yet dissimilar from other strains belonging to the family Rhizobiacea, (e.g. Sinorhizobium sp. NEA-B; Devers et al., 2007). Rhizobiacea may thus contain myriad novel biodegradation mechanisms (Ralebitso et al., 2002) worth further investigation. 5. Conclusion CX-T, a close Ensifer sp. SB2 relative, is a naturally occurring bacterial strain found in riverside soil capable of degrading atrazine by utilizing it as its main nitrogen source. Substrate experiments demonstrate CX-T utilizes cyanuric acid as a nitrogen source further implying that CX-T may mineralize atrazine completely from the surrounding environment. Until now, the presence of specific atrazine degrading genes in Ensifier sp. have not been reported, however our PCR experiment demonstrates the CX-T strain harbors aztA, atzB, atzC, atzD, atzE and atzF genes. We suggest CX-T may be a good atrazine bioremediating tool with potential for future environmental applications, though certainly further studies analyzing its potential application under in situ contexts is certainly warranted. Acknowledgments This work was supported by Natural Science Foundation of China (No. 21377098) & MOST 863 Program of China (2012AA063608), and the National Water Special Project (No. 2014ZX07405-003). We would also like to thank the two anonymous reviewers and the associate editor for their comments which improved the manuscript. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biology 215 (3), 403e410.
ndez, M.I., García, M.V., Azenha, M.E.D.G., Burrows, H.D.M.,C.L., Coimbra, R., Ferna et al., 2003. Kinetic and mechanistic aspects of the direct photodegradation of atrazine, atraton, ametryn and 2-hydroxyatrazine by 254 nm light in aqueous solution. J. Phys. Org. Chem. 16 (8), 498e503. ~o
n, I.M.D., 2012. Fast atrazine photodegradation in Baranda, A.B., Barranco, A., Maran water by pulsed light technology. Water Res. 46 (3), 669e678. Bellini, M.I., Pinelli, L., Santos, M.E.D., Scavino, A.F., 2014. Bacterial consortia from raw water and sludges from water potabilization plants are able to degrade atrazine. Int. Biodeterior. Biodegrad. 90 (1), 131e139. Boundymills, K.L., de Souza, M.L., Mandelbaum, R.T., Wackett, L.P., Sadowsky, M.J., 1997. The atzb gene of pseudomonas sp. strain adp encodes the second enzyme of a novel atrazine degradation pathway. Appl. Environ. Microbiol. 63 (3), 916e923. Bouquard, C., Ouazzani, J., Prome, J., Michelbriand, Y., Plesiat, P., 1997. Dechlorination of atrazine by a rhizobium sp. isolate. Appl. Environ. Microbiol. 63 (3), 862e866.

139

de Souza, M.L., Seffernick, J., Martinez, B., Sadowsky, M.J., Wackett, L.P., 1998. The atrazine catabolism genes atzabc are widespread and highly conserved. J. Bacteriol. 180 (7), 1951e1954. Delmonte, A.A., Bedmar, F., 1997. Residual phytotoxicity and chemical persistence of atrazine in soils of the southeast of buenos aires province, argentina. J. Environ. Biol. 3, 201e208. Devers, M., Azhari, N.E., Kolic, N.U., Martin-Laurent, F., 2007. Detection and organization of atrazine-degrading genetic potential of seventeen bacterial isolates belonging to divergent taxa indicate a recent common origin of their catabolic functions. Fems Microbiol. Lett. 273 (1), 78e86. Draher, J., Ehling, S., Cellar, N., Reddy, T., Henion, J., Sousou, N., 2016. Determination of emerging nitrogenous economic adulterants in milk proteins by highperformance liquid chromatography/compact mass spectrometry: determination of emerging nitrogenous economic adulterants. Rapid Commun. Mass Spectrom. 30 (11), 1265e1272. , M.L., Gibello, A., Martinez-In ~ igo, M.J., Nande, M., Lobo, C., et al., Fajardo, C., Sacca 2012. Assessment of s-triazine catabolic potential in soil bacterial isolates applying atz genes as functional biomarkers. Water Air & Soil Pollut. 223 (6), 3385e3392.
ndez, L.A., Valverde, C., Go
mez, M.A., 2012. Isolation and characterization of Ferna atrazine-degrading arthrobacter sp. strains from argentine agricultural soils. Ann. Microbiol. 63 (1), 207e214. Fenner, K., Canonica, S., Wackett, L.P., Elsner, M., 2013. Evaluating pesticide degradation in the environment: blind spots and emerging opportunities. Science 341 (6147), 752e758. Fruchey, I., Shapir, N., Sadowsky, M.J., Wackett, L.P., 2003. On the origins of cyanuric acid hydrolase: purification, substrates, and prevalence of atzd from pseudomonas sp. strain adp. Appl. Environ. Microbiol. 69 (6), 96e106. Houot, S., Topp, E., Yassir, A., Soulas, G., 2000. Dependence of accelerated degradation of atrazine on soil ph in french and canadian soils. Soil Biol. Biochem. 32 (5), 615e625. Karns, J.S., 1999. Gene sequence and properties of an s-triazine ring-cleavage enzyme from pseudomonas sp. strain nrrlb-12227. Appl. Environ. Microbiol. 65 (8), 3512e3517. Liang, S., Dong, X., Su, M., Sun, H., 2016. Analysis of herbicide atrazine and its degradation products in cereals by ultra-performance liquid chromatographymass spectrometry. Anal. Methods 8 (17), 3599e3604. Mandelbaum, R.T., Allan, D.L., Wackett, L.P., 1995. Isolation and characterization of a pseudomonas sp. that mineralizes the s-triazine herbicide atrazine. Appl. Environ. Microbiol. 61 (4), 1451e1457. Mandelbaum, R.T., Wackett, L.P., Allan, D.L., 1993. Mineralization of the s-triazine ring of atrazine by stable bacterial mixed cultures. Appl. Environ. Microbiol. 59 (6), 1695e1701. Martinez, B., Tomkins, J., Wackett, L.P., Wing, R., Sadowsky, M.J., 2001. Complete nucleotide sequence and organization of the atrazine catabolic plasmid padp-1 from pseudomonassp. strain adp. J. Bacteriol. 183 (19), 5684e5697. Martin-Laurent, F., Cornet, L.L., Lopez-Gutierrez, J., Philippot, L., Schwartz, C., Chaussod, R., et al., 2004. Estimation of atrazine-degrading genetic potential and activity in three french agricultural soils. Fems Microbiol. Ecol. 48 (3), 425e435. Meyer, Armin H., Penning, H., Elsner, M., 2009. C and N isotope fractionation suggests similar mechanisms of microbial atrazine transformation despite involvement of different enzymes (AtzA and TrzN). Environ. Sci. Technol. 43 (21), 8079e8085. Meyer, A.H., Dybala-Defratyka, A., Alaimo, P.J., Geronimo, I., Sanchez, A.D., Cramer, C.J., et al., 2014. Cytochrome p450-catalyzed dealkylation of atrazine by rhodococcus sp. strain ni86/21 involves hydrogen atom transfer rather than single electron transfer. Dalton Trans. 43 (32), 12175e12186. Mizota, K., Ueda, H., 2006. Endocrine disrupting chemical atrazine causes degranulation through gq/11 protein-coupled neurosteroid receptor in mast cells. Toxicol. Sci. 90 (2), 362e368. Mollstam, B., Connolly, E., 2013. Selection and Use of Lactic Acid Bacteria for Reducing Dental Caries and Bacteria Causing Dental Caries. US, US 8343483 B2. Mulbry, W.W., Zhu, H., Nour, S.M., Topp, E., 2002. The triazine hydrolase gene trz n from nocardioides, sp. strain c190: cloning and construction of gene-specific primers. Fems Microbiol. Lett. 206 (1), 75e79. Omotayo, Ayodele E., Ilori, Matthew O., Radosevich, Mark, Amund, Olukayode O., 2013. Metabolism of atrazine in liquid cultures and soil microcosms by nocardioides strains isolated from a contaminated nigerian agricultural soil. Soil & Sediment Contam. Int. J. 22 (4), 365e375. Popov, V.H., Cornish, P.S., Sultana, K., Morris, E.C., 2005. Atrazine degradation in soils: the role of microbial communities, atrazine application history, and soil carbon. Aust. J. Soil Res. 43 (7), 861e871. Prapaipong, P., Enssle, C.W., Morris, J.D., Shock, E.L., Lindvall, R.E., 2008. Rapid transport of anthropogenic lead through soils in southeast missouri. Appl. Geochem. 23 (8), 2156e2170. Ralebitso, T.K., Senior, E., Verseveld, H.W.V., 2002. Microbial aspects of atrazine degradation in natural environments. Biodegradation 13 (1), 11e19.
s, J., Carbonell, E., Creus, A., Xamena, N., Marcos, R., 1998. Lack of Ribas, G., Surralle genotoxicity of the herbicide atrazine in cultured human lymphocytes. Mutat. Research/genetic Toxicol. Environ. Mutagen. 416 (1e2), 93e99. Rousseaux, S., Hartmann, A., Soulas, G., 2001. Isolation and characterisation of new gram-negative and gram-positive atrazine degrading bacteria from different french soils. Appl. Environ. Microbiol. 36 (2e3), 211e222. Sadowsky, M.J., Tong, Z., De, S.M., Wackett, L.P., 1998. Atzc is a new member of the

140

L. Ma et al. / International Biodeterioration & Biodegradation 116 (2017) 133e140

amidohydrolase protein superfamily and is homologous to other atrazinemetabolizing enzymes. J. Bacteriol. 180 (1), 152e158. Sajjaphan, K., Shapir, N., Wackett, L.P., Palmer, M., Blackmon, B., Tomkins, J., et al., 2004. Arthrobacter aurescens tc1 atrazine catabolism genes trzn, atzb, and atzc are linked on a 160-kilobase region and are functional in escherichia coli. J. Cell Biol. 70 (7), 4402e4407. Sanderson, J.T., Seinen, W., Giesy, J.P., Berg, M.V.D., 2000. 2-chloro-s-triazine herbicides induce aromatase (cyp19) activity in h295r human adrenocortical carcinoma cells: a novel mechanism for estrogenicity? Toxicol. Sci. 54 (1), 121e127. Satsuma, K., 2010. Mineralization of s-triazine herbicides by a newly isolated nocardioides, species strain dn36. Appl. Microbiol. Biotechnol. 86 (5), 1585e1592. Schürner, H.K., Seffernick, J.L., Grzybkowska, A., Dybaladefratyka, A., Wackett, L.P., Elsner, M., 2015. Characteristic isotope fractionation patterns in s-triazine degradation have their origin in multiple protonation options in the s-triazine hydrolase trzn. Environ. Sci. Technol. 49 (6), 3490e3498. Singh, P., Suri, C.R., Cameotra, S.S., 2004. Isolation of a member of acinetobacter species involved in atrazine degradation. Biochem. Biophysical Res. Commun. 317 (3), 697e702. Souza, M.L.D., Wackett, L.P., Boundymills, K.L., Mandelbaum, R.T., Sadowsky, M.J., 1995. Cloning, characterization, and expression of a gene region frompseudomonassp. strain adp involved in the dechlorination of atrazine. Appl. Environ. Microbiol. 61 (9), 3373e3378.

Stelting, S.A., Burns, R.G., Bunt, A.S.C.R., 2014. Survival in sterile soil and atrazine degradation of pseudomonas sp. strain adp immobilized on zeolite. Bioremediation J. 18 (4), 309e316. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. Mega5: molecular, evolutionary, genetics, analysis, using maximum, likelihood, evolutionary, distance, and maximum, parsimony, methods. Mol. Biol. Evol. 28 (10), 2731e2739. Topp, E., Mulbry, W.M., Hong, Z., Nour, S.M., Cuppels, D., 2000. Characterization of striazine herbicide metabolism by a nocardioides sp. isolated from agricultural soils. Appl. Environ. Microbiol. 66 (8), 3134e3141. Udikovi
c-Koli
c, N., Devers-Lamrani, M., Petri
c, I., Hrsak, D., Martin-Laurent, F., 2011. Evidence for taxonomic and functional drift of an atrazine-degrading culture in response to high atrazine input. Appl. Microbiol. Biotechnol. 90 (4), 1547e1554. Wang, Q., Xie, S., 2012. Isolation and characterization of a high-efficiency soil atrazine-degrading arthrobacter sp. strain. Int. Biodeterior. Biodegrad. 71 (4), 61e66.
mez, M.A., 2005. Diversity of rhizobia isolated from an agricultural Zabaloy, M.C., Go soil in argentina based on carbon utilization and effects of herbicides on growth. Biol. Fertil. Soils 42 (2), 83e88. Zhang, Y., Jiang, Z., Li, J., Peng, X., Ma, Y., Wang, R., 2009. Study on the growth and degradation characteristics of atrazine degradation strain named J_2. In: International Conference on Environmental Science and Information Application Technology, 90A. IEEE Computer Society, pp. 506e513.