- Email: [email protected]
Rapid detection and differentiation of Theileria annulata, T. orientalis and T. sinensis using high-resolution melting analysis
Ticks and Tick-borne Diseases 11 (2020) 101312
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Rapid detection and differentiation of Theileria annulata, T. orientalis and T. sinensis using high-resolution melting analysis
T
Jinming Wanga, Jifei Yanga, Shandian Gaoa, Aihong Liua, Muhammad Rashida, Youquan Lia, ⁎ ⁎ Zhijie Liua, Junlong Liua, Guangyuan Liua, Jianxun Luoa, Guiquan Guana, , Hong Yina,b, a
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu, 730046, PR China b Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Disease and Zoonosis, Yangzhou University, Yangzhou 225009, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: High-resolution melting Bovine theileriosis Diagnosis Discrimination
Bovine theileriosis, caused by protozoan parasites of the genus Theileria, presents with various clinical symptoms. In cattle, clinical presentations and outcomes of bovine theileriosis are closely correlated with the causative Theileria spp. Thus, accurate detection and discrimination of Theileria spp. are essential for epidemiological studies and for provision of clinical management strategies. High-resolution melting (HRM) analyses of two amplicons targeting the 18S rRNA indicated that T. annulata, T. orientalis, and T. sinensis isolated from China can be accurately detected and discriminated with the lowest detection limit of 1–10 copy numbers of plasmid bearing the 18S rRNA sequence. The approach was verified with DNA samples from experimentally infected cattle and field samples. Thus, this assay is useful for diagnosis of bovine theileriosis in field samples and experimentally infected animals, and could also be applicable for the survey of parasite dynamics, epidemiological studies.
1. Introduction Bovine theileriosis is caused by protozoan parasites of the genus Theileria, order Piroplasmorida, phylum Apicomplexa, and is characterized by a spectrum of clinical manifestations. It has economically important outcomes for both health and production in domesticated bovines worldwide (Santos et al., 2013). Three Theileria spp. (Theileria annulata, Theileria orientalis, and Theileria sinensis) have been documented as economically predominant pathogens for bovine theileriosis in China (Bai et al., 1997; Luo and Lu, 1997; Yin et al., 2002a; JX et al., 2006). The severity of the disease and outcomes of infections vary depending on the immune status of host and causative Theileria spp. Generally, T. annulata is known as tropical theileriosis and is highly pathogenic, whereas T. orientalis and T. sinensis are believed to induce a mild or asymptomatic disease (Aktas et al., 2006; Ota et al., 2009; McFadden et al., 2011). T. annulata is transmitted by Hyalomma spp., which are widely distributed in semiarid and desert land in Northern China (Luo and Lu, 1997). The infections of this parasite can cause a high morbidity and mortality in cattle, ranged from 7.1% to 61% and 4–46.4%, respectively (Luo and Lu, 1997; Yin et al., 2008; Hainimuguli et al., 2017). T. orientalis, transmitted by Haemaphysalis concinna and Haemaphysalis longicornis, is a benign Theileria spp. group that includes ⁎
Theileria sergenti, Theileria buffeli, and T. orientalis (Stewart et al., 1996; Gubbels et al., 2000, 2002; Wang et al., 2018). Theileria sinensis was initially isolated from cattle in Gansu Province in 1995; and Haemaphysalis qinghaiensis and Haemaphysalis japonica are considered to be possible vectors for this microorganism (Bai et al., 2002; Yin et al., 2002b). Thus, the developments of rapid detection and reliability discrimination of Theileria spp. are essential for providing appropriate prevention and for performing clinical management strategy. High-resolution melting (HRM) analysis is characterized by an automated analytical molecular method that monitors fluorescence changes during double-stranded DNA dissociation into single-stranded DNA (Erali et al., 2008; Hrncirova et al., 2010). When a PCR reaction is performed, a double-stranded DNA dye is intercalated homogenously into DNA. The HRM analysis is then conducted to determine the melting behavior of particular DNA product dissociations (Edwards et al., 2018). HRM was initially employed to detect single nucleotide polymorphisms in genetic diseases. Subsequently, it has also been employed to detect internal tandem duplicators, for mutation scanning, genotyping bacteria, and in cancer research (Wolff et al., 2008; TalmiFrank et al., 2010a). Developed assays have also been applied to identify Babesia caballi and Theileria equi, to discriminate four Babesia spp. infective to humans and dogs, and to diagnose five Plasmodium spp.
Corresponding authors at: Lanzhou Veterinary Rsearch Institue, Chinese Academy of Agricultural Sciences. E-mail addresses: [email protected] (G. Guan), [email protected] (H. Yin).
https://doi.org/10.1016/j.ttbdis.2019.101312 Received 30 May 2019; Received in revised form 24 September 2019; Accepted 9 October 2019 Available online 16 October 2019 1877-959X/ © 2019 Elsevier GmbH. All rights reserved.
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
Table 1 Primer sequences for the identification of Theileria spp. and plasmid DNA preparations. Primer name
Sequence (5'-3')
Orientation
Amplicon size (bp)
BovisTB-2R BovisTB-2F BovisT-5F BovisT-5R Piro1-S Piro3-AS
GCTGGCACCAGACTTGCCCTCC GCCGACTAGAGATTGGAGGTCGTC CGAGACCTTAACCTGCTAAATAGG CCCTCTAAGAAGCGATAACGGG CTTGACGGTAGGGTATTGGC CCTTCCTTTAAGTGATAAGGTTCAC
Forward Reverse Forward Reverse Forward Reverse
72 80 Approximately 1400
Fig. 1. Alignments of nucleotide sequences of 18S rRNA gene regions and primer locations. Sequence alignment of the nucleotide sequences of piroplasm amplicons used in the HRM analysis. The underlined sequences indicate the position of the primer pair used for the assays.
2.3. Experimentally infected and naturally infected blood samples
(Salim et al., 2013; Chua et al., 2015; Rozej-Bielicka et al., 2017). In the present study, we describe the application of a RT-PCR-HRM assay targeting the 18S rRNA gene to discriminate three Theileria spp. infective to cattle.
Twenty-four cattle were purchased from a bovine theileriosis-free area and confirmed to be piroplasm free by the thin blood smear microscopy, nested PCRs and ELISA assays (Olmeda et al., 1997; Li et al., 2014; Yang et al., 2014; Yuan et al., 2014). Hyalomma anatolicum experimentally infected with T. annulata were confirmed by PCR assays. Infected ticks were ground to make supernatant according to a previously described protocol (Forsyth et al., 1999; Junlong et al., 2015; Yin et al., 2018). Supernatants of 50 ground ticks were inoculated subcutaneously into each cattle. After inoculation, thin blood smears were examined to monitor the infection status every two days, and the blood samples were collected into EDTA-coated tubes to isolate the genomic DNA. From August 2007 to July 2015, 334 blood samples were collected into EDTA-coated tubes from cattle distributed across China, where bovine theileriosis is an issue. All blood samples were transported to the laboratory at VVBD in iceboxes. DNA was extracted using QIAamp DNA Blood Mini Kit according to the manufacturer’s instructions. The DNA concentration was determined by NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). All samples were previously screened using nested PCR assays targeting the 18S rRNA combined with gene sequencings (Olmeda et al., 1997; Yang et al., 2014). The results of sequence blast analysis, using the BLASTn program, showed that these samples composed 106 cases of Theileria spp. infections, including 98 cases of T. orientalis, seven of T. annulata and one case of T. sinensis infection, although no mixed infections were found.
2. Materials and methods 2.1. Primer design The accession numbers of available 18S rRNA genes in the GenBank database were used to design primers for Babesia bovis, Babesia bigemina, Babesia major, Babesia ovata, Babesia orientalis, T. annulata, T. orientalis, and T. sinensis. After sequence alignment carried out using DNAMAN 2.0 software, the conserved and variable regions were identified for each Theileria species. Two pairs of oligonucleotides were designed in these conserved regions using Primer 5.0 software to amplify the variable gene fragments intraspecies. 2.2. Reference strains Cryopreserved blood samples infected with B. bovis, B. bigemina, B. major, B. ovata, B. orientalis, T. annulata, T. orientalis, and T. sinensis, provided by the Vectors and Vector-Borne Diseases (VVBD) Laboratory, Lanzhou Veterinary Research Institute (LVRI), Chinese Academy of Agricultural Sciences (CAAS), were used as reference strains. Total DNA was extracted from 200 μl of blood using a commercially available DNA extraction kit (QIAamp DNA Blood Mini Kit, Qiagen, Germany), according to the manufacturer’s instructions. Negative control DNA was isolated from the whole blood of piroplasm-free cattle, confirmed by blood smear microscopy and nested PCR (Yang et al., 2014). The extracted DNA was stored at −20 °C until for further use.
2.4. Plasmid DNA preparations The 18S rRNA genes of these parasites were amplified with a set of primer pair (Piro1-S and Piro3-AS) (Table 1) (Yang et al., 2014). The 2
Ticks and Tick-borne Diseases 11 (2020) 101312 Range of GCP
69.78 – 93.72 61.43 – 97.16 88.7 - 100
GCP (Average ± SD)
84.43 ± 9.90 81.31 ± 12.18 94.35 ± 7.99
J. Wang, et al.
method for PCR amplification was performed as previously described (Yang et al., 2014). The PCR products were electrophoresed on a 1.5% agarose gel containing Gold View dye (SolarBio, Beijing, China) in Trisacetate-EDTA (TAE) buffer at 120 V for 30 min and visualized under UV light. PCR amplicons were purified and cloned into a pGEM-T vector using the Easy Vector System (Promega, Madison, USA). Briefly, the PCR amplicons were purified with a Zymoclean™ Gel DNA Recovery Kit (Zymo, USA), cloned into a PGEM-T Easy vector (Promega, USA) and then transformed into Escherichia coli DH5α competent cells. Three clones from each sample were selected and sequenced using BigDye Terminator Mix (GenScript, Nanjing, China). Sequences were subjected to blast analysis on NCBI database using the BLASTn program.
86.98 ± 10.92
RT-PCR-HRM was performed using a Rotor-Gene Q6000 Real-Time PCR system. Each reaction was performed in a total volume of 10 μl comprising 5 μl Forget-Me-Not™ qPCR Master Mix (Biotium, USA), 5 pmol of each primer, 20 ng genomic DNA or 10 ng plasmid DNA bearing 18S rRNA gene sequence. The reaction profiles were as follow: initial denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing temperature at 60 °C for 10 s. For HRM analysis, fluorescent signals were monitored from 75 °C to 85 °C increasing by increments of 0.2 °C. Finally, the melting curves were normalized using the High Resolution Melt software v2.3.1 (Qiagen, Germany). 2.6. Evaluation of sensitivity and specificity of RT-PCR-HRM assays
GCP: genotype confidence percentage. The Tm and GCP values of amplicons 1and 2 were calculated from reference species with variable amounts of genomic DNA.
No test No test 75.64-76.0 76.2-77.0 77.44-78.10 No test No test 75.85 ± 0.12 76.60 ± 0.28 77.80 ± 0.29 B. B. T. T. T.
bigemina + B. orientalis major + B. ovata annulata orientalis sinensis
78.39 ± 0.22 79.58 ± 0.30 76.49 ± 0.17
77.89-78.81 79.10-79.84 76.2-76.76
62.07 – 99.06
Range Tm (Average ± SD) Range of GCP GCP (Average ± SD) Range of Tm Tm (Average ± SD)
Amplicon 1 Species
Table 2 Tm values and GCP values obtained in the HRM analysis targeting the 18S rRNA gene of different Theileria spp.
Amplicon 2
2.5. Real time PCR-high resolution melting analysis
To determine the sensitivity and detection limit of the RT-PCR-HRM assay, tenfold serial dilutions of positive control plasmid DNA of B. bovis, B. bigemina, B. major, B. ovata, T. annulata, T. orientalis, and T. sinensis were used as template, ranging from 107 to 1 copies per microliter. Three reaction mixtures from each plasmid were used in independent experiments to ensure the reproducibility of the threshold cycle number (Ct). Standard curves were plotted using High Resolution Melt software v2.3.1 (Qiagen, Germany) to evaluate the amplified efficiency percentage and linear correlations of each species. Serial dilutions of genomic DNA (10 ng to 50 fp) were used as template to evaluate the melting temperature shift, melting profiles and genotype confidence percentage (GCP) of amplicon 1 and amplicon 2. RT-PCR-HRM was evaluated using DNA from 66 experimentally infected and 334 field samples. Duplicated tests for each sample were performed. 3. Results 3.1. Specificity analyses Two amplicons were designed after analysis of all available 18S rRNA sequences submitted to GenBank. To identify the conserved regions of intraspecies and polymorphic regions among species, theoretical melting temperatures were predicted in silico using the OligoCalac to guide primer design (Kibbe, 2007). The 72-bp amplicon 1 was produced using the primer pair BovisTB-2 F and BovisTB-2R to distinguish Theileria from Babesia spp. The 80-bp amplicon 2 was produced using the primer Bovis-T-5 F and Bovis-T-5R for detection and discrimination of Theileria spp., including T. annulata, T. orientalis, and T. sinensis (Fig. 1 and Table 1). The average melting temperatures and standard deviations of two amplicons for each species are listed in Table 2. According to the melting profiles and Tm values, amplicon 1 was able to distinguish Theileria spp. (T. annulata, T. orientalis, and T. sinensis) from other piroplasms, such as B. bovis, B. bigemina, B. orientalis, B. major, and B. ovata. This amplicon was specific for the differentiation of piroplasms into three groups, comprising Theileria spp. with Tm = 76.49 ± 3
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
Fig. 2. HRM plots for detection and discrimination of Theileria spp. (A) Normalized HRM plots for 18S rRNA amplicon 1; (B) normalized difference curves of amplicon 1; (C) derivative melting curve peaks for amplicon 1; (D) normalized HRM plots for 18S rRNA amplicon 2; (E) normalized difference curves of amplicon 2; and (F) derivative melting curve peaks for amplicon 2.
Fig. 3. Melting temperatures obtained with HRM assays. The Tm values were determined in duplicated independent experiments with variable initial amounts of genomic DNA from each species.
T. orientalis, and Tm = 78.80 ± 0.29 °C of T. sinensis (Fig. 2, Table 2). The average and standard deviation of the melting temperature (Tm) for each amplicon were determined in duplicated independent experiments using variable amounts of DNA from each species (Fig. 3).
0.16 °C, B. bigemina and B. orientalis with Tm = 78.39 ± 0.22 °C, and B. major and B. ovata with Tm = 79.58 ± 0.30 °C. There was no amplification signal or melting curve in genomic DNA isolated from B. bovis and piroplasm-free cattle. Given that overlapping Tm values of amplicon 1 were observed in three Theileria spp., the discrimination of Theileria spp. can be performed by RT-PCR-HRM analyses of amplicon 2, which was able to distinguish three Theileria spp. from each other with Tm = 75.95 ± 0.12 °C of T. annulata, Tm = 76.60 ± 0.28 °C of
3.2. Sensitivity To evaluate the detection limit of the RT-PCR-HRM assay, tenfold 4
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
efficiencies, varying from 0.989 to 1.000 and 89.9% to 102.6%, respectively, for all Theileria spp. (Table 3).
Table 3 Efficiency and correlation of 18S rRNA RT- PCR for amplicons 1 and 2. Species
Amplicon 1 2
T. T. T. B. B. B. B.
orientalis sinensis annulata bovis bigemina major ovata
Amplicon 2
R value
Assay efficiency percentage
R2 value
Assay efficiency percentage
0.999 0.992 0.998 0.999 1.000 0.999 0.999
96.80% 89.90% 92.70% 100.5 98.00% 102.60% 99.50%
1 0.999 0.989 NA NA NA NA
97.20% 98.90% 93.60% NA NA NA NA
3.3. Evaluation of the HRM assay with experimentally infected and naturally infected blood samples The RT-PCR-HRM assay of 18S rRNA gene amplicon 1 was evaluated using 66 genomic DNA samples from cattle experimentally infected with T. annulata and 334 field samples. Amplicon 2 was evaluated for the detection and discrimination of Theileria spp. with the 66 DNA from experimentally infected cattle and 106 clinical samples infected with Theileria spp. Reference species of T. annulata, T. orientalis, and T. sinensis were set as ‘genotype’ and the HRM genotype confidence percentage (GCP) was determined by comparing each sample with the defined genotypes using the High Resolution Melt software v2.3.1 (Qiagen, Germany). On the basis of GCP analyses, a cut off value was generated and used to assess the infection and diagnosis of field samples. A cut-off value was determined by subtracting two-fold SD value from average GCP. The mean GCP and SD of amplicon 1 were 86.98 and 10.92, respectively; and a cut-off value of 65.14 was determined for Theileria spp. Similarly, The cut-off value of 59.96 was determined for amplicon 2. Theileria spp. identified herein using the HRM analysis
serial dilutions, from 107 to 1 plasmid copies per microliter, containing the target sequence of each species, were tested. The detection limit of amplicon 1 was one copy per reaction for each species except T. orientalis, which had a detection limit of ten copies. For amplicon 2, the detection limit was ten copies for the three Theileria spp. To confirm the reproducibility of this approach, these data were determined by duplicated tests. The standard curves for quantification assays, confirmed by duplicated experiments, showed satisfactory correlations and
Fig. 4. Detection and discrimination of field samples. (A) Normalized HRM plots of amplicon 1 for the identification of the genus Theileria; (B) normalized HRM plots of amplicon 2 for identification of the three Theileria spp.; and (C) normalized difference curves of amplicon 2 for field samples. 5
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
concentration of DNA for tested clinical samples can minimize the influence of those factors and improve the consistency and repeatability of HRM analyses (Toi and Dwyer, 2008; Banowary et al., 2015;). High resolution melt software v2.3.1 can automatically match samples with melting curves and normalized fluorescence profiles with reference species; therefore, the GCP values were determined. Clinical samples that produce GCP ≥ cut-off values were considered similar to reference species, while those generated GCP < cut-off value were considered to be distinct with the reference species. In this study, we developed an rapid and sensitivity approach to determine the relationship between the isolates from clinical sample and reference species in an automated technique. This outstanding characteristic can facilitate the application of HRM analysis in diagnosis of diseases caused by bacteria and virus in research laboratories (Ghorashi et al., 2011, 2015). It does not require probes, labeled primers, or manipulation with PCR products, such as gel fractionation, PRLP analysis, and gene sequencing, that avoid cross contamination of PCR products in the laboratory.
Table 4 Identification of Theileria spp. in experimentally infected cattle and field samples. Sample source
Experimentally infected samples Field sample
Diagnostic methods HRM assays
nPCR assay and 18S rRNA gene sequencing
T. annulata (66)
T. annulata (66)
T. orientalis (98) T. annulata (7) T. sinensis (1)
T. orientalis (98) T. annulata (7) T. sinensis (1)
were in 100% agreement with those using nested PCR and gene sequencing (Fig. 4 and Table 4).
4. Discussion 5. Conclusion Molecular approaches are extensively used for epidemiological investigations and for the detection of bovine theileriosis to distinguish and confirm Theileria infection at the species level. These approaches include nested PCR combined with gene sequencing, PCR followed by reverse line blot hybridization (RLB) or restriction fragment length polymorphism (RFLP), loop-mediated isothermal amplification (LAMP), and RT-PCR (Adjou Moumouni et al., 2015; Gubbels et al., 1999; Tian et al., 2013). Several of these methods, such as RLB and RFLP, require the manipulation of the PCR products, which can cause a risk of contamination with amplicons. The RT-PCR-HRM technique has been used to detect and identify T. equi and B. caballi, targeting the 18S rRNA gene. Previously, it has also been used to differentiate Babesia spp. infecting humans and dogs (Salim et al., 2013; Rozej-Bielicka et al., 2017). Recently, Chua et al. (Chua et al., 2015) explored HRM analysis for the simultaneous detection of all five human Plasmodium spp. Their results indicated that the 18S rRNA gene, as an attractive target gene, presents many advantages; for example, highly conserved regions enable the detection of almost all piroplasm species, whereas variable sequences can be employed for species differentiation. In the present study, we described a new assay for the rapid detection and discrimination of Theileria spp. widely distributed across China. The HRM assay is rapid, sensitive, and can detect as few as 1–10 copies of plasmids bearing the 18S rRNA gene in a single reaction; in other words, less than one parasite per reaction. This assay is performed in a closed-tube and requires automated analysis. The distinct shape of melting curve and Tm values are characteristic of particular DNA products, as determined based on sequence length, GC content, and nearest neighbor thermodynamics (TalmiFrank et al., 2010b). HRM analysis provides a repeatable melting curve and Tm values for specific species isolated from different hosts and locations. HRM curves of amplicon 1 from three Theileria spp., which were distinguished from Babesia spp. infective for cattle, were similar. However, the DNA sequences of amplicon 1 were identical among T. annulata, T. orientalis and T. sinensis. Four Babesia spp. infective to cattle, B. bigemina, B. ovata, B. major, and B. orientalis, were amplified by the reaction and generated distinctly different melting curves. Thus, although assay amplifications were observed from DNA of these Babesia spp., they could not be confused with Theileria spp. Amplicon 2 was specifically designed to distinguish among T. annulata, T. orientalis, and T. sinensis. The RT-PCR-HRM method could be impacted by various factors, such as the quality and quantity of the genomic DNA template (Hernandez et al., 2014; Kuang et al., 2018). To evaluate the influences of these factors on HRM analysis curve profiles and melting temperatures, a variable concentration of DNA from experimentally and naturally infected (field samples) animals, which have a slight influence on melting profiles and Tm values, were used for HRM analyses. An equal
The RT-PCR-HRM analysis developed herein was shown to be a powerful and cost-effective technique for the detection and discrimination of Theileria spp. that are responsible for the majority of cases of bovine theileriosis across China. Funding This study was financially supported by the National Key R&D Program of China (2017YFD0501200, 2018YFD0501804, 2018YFD0502305); ASTIP (CAAS-ASTIP-2016-LVRI); NBCITS (CARS37); 973 Program (2015CB150300); Jiangsu Co-innovation Center program for Prevention and Control of Important Animal Infectious Disease and Zoonosis. Authors’ contributions Designed the study: Hong Yin, Jianxun Luo, Guiquan Guan, Guangyuan Liu. Performed the experiments, analyzed the results, and wrote manuscript: Jinming Wang. Contributed reagents/materials/ equipment: Jifei Yang, Shandian Gao, Zhijie Liu, Muhammad Rashid, Aihong Liu, Youquan Li, Junlong Liu. All authors have read and approved the final version of the manuscript. Ethics approval The protocol used in this study and all animal handling were approved by the Animal Ethics Committee of the Lanzhou Veterinary Research Institute, CAAS (Permit No. LVRIAEC-2018-001). Competing interests The authors declare that they have no competing interests. Acknowledgements Not applicable. References Adjou Moumouni, P.F., Aboge, G.O., Terkawi, M.A., Masatani, T., Cao, S., Kamyingkird, K., Jirapattharasate, C., Zhou, M., Wang, G., Liu, M., Iguchi, A., Vudriko, P., Ybanez, A.P., Inokuma, H., Shirafuji-Umemiya, R., Suzuki, H., Xuan, X., 2015. Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya. Parasit. Vectors 8, 496. Aktas, M., Altay, K., Dumanli, N., 2006. A molecular survey of bovine Theileria parasites among apparently healthy cattle and with a note on the distribution of ticks in eastern Turkey. Vet. Parasitol. 138, 179–185.
6
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
McFadden, A.M.J., Rawdon, T.G., Meyer, J., Makin, J., Morley, C.M., Clough, R.R., Tham, K., Mullner, P., Geysen, D., 2011. An outbreak of haemolytic anaemia associated with infection of Theileria orientalis in naive cattle. N. Z. Vet. J. 59, 79–85. Olmeda, A.S., Armstrong, P.M., Rosenthal, B.M., Valladares, B., delCastillo, A., deArmas, F., Miguelez, M., Gonzalez, A., Rodriguez, J.A.R., Spielman, A., Telford, S.R., 1997. A subtropical case of human babesiosis. Acta Trop. 67, 229–234. Ota, N., Mizuno, D., Kuboki, N., Igarashi, I., Nakamura, Y., Yamashina, H., Hanzaike, T., Fujii, K., Onoe, S., Hata, H., Kondo, S., Matsui, S., Koga, M., Matsumoto, K., Inokuma, H., Yokoyama, N., 2009. Epidemiological survey of Theileria orientalis infection in grazing cattle in the eastern part of Hokkaido, Japan. J. Vet. Med. Sci. 71, 937–944. Rozej-Bielicka, W., Masny, A., Golab, E., 2017. High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals. Parasitol. Res. 116, 2671–2681. Salim, B., Bakheit, M.A., Sugimoto, C., 2013. Rapid detection and identification of Theileria equi and Babesia caballi by high-resolution melting (HRM) analysis. Parasitol. Res. 112, 3883–3886. Santos, M., Soares, R., Costa, P., Amaro, A., Inacio, J., Gomes, J., 2013. Revisiting the Tams1-encoding gene as a species-specific target for the molecular detection of Theileria annulata in bovine blood samples. Ticks Tick. Dis. 4, 72–77. Stewart, N.P., Uilenberg, G., deVos, A.J., 1996. Review of Australian species of the Theileria, with special reference to Theileria buffeli of cattle. Trop. Anim. Health Prod. 28, 81–90. Talmi-Frank, D., Nasereddin, A., Schnur, L.F., Schonian, G., Toz, S.O., Jaffe, C.L., Baneth, G., 2010a. Detection and identification of old world leishmania by high resolution melt analysis. PLoS Negl. Trop. Dis. 4. Talmi-Frank, D., Nasereddin, A., Schnur, L.F., Schonian, G., Toz, S.O., Jaffe, C.L., Baneth, G., 2010b. Detection and identification of old world Leishmania by high resolution melt analysis. PLoS Negl. Trop. Dis. 4, e581. Tian, Z.C., Liu, G.Y., Yin, H., Luo, J.X., Guan, G.Q., Luo, J., Xie, J.R., Shen, H., Tian, M.Y., Zheng, J.F., Yuan, X.S., Wang, F.F., 2013. RPS8–a new informative DNA marker for phylogeny of Babesia and Theileria parasites in China. PLoS One 8, e79860. Toi, C.S., Dwyer, D.E., 2008. Differentiation between vaccine and wild-type varicellazoster virus genotypes by high-resolution melt analysis of single nucleotide polymorphisms. J. Clin. Virol. 43, 18–24. Wang, J.M., Yang, J.F., Liu, J.L., Wang, X.X., Xu, J.L., Liu, A.H., Li, Y.Q., Liu, Z.J., Ren, Q.Y., Luo, J.X., Guan, G.Q., Yin, H., 2018. Molecular detection and genetic diversity of Theileria orientalis in cattle in China. Parasitol. Res. 117, 3689–3694. Wolff, B.J., Thacker, W.L., Schwartz, S.B., Winchell, J.M., 2008. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis. Antimicrob. Agents Chemother. 52, 3542–3549. Yang, J.F., Li, Y.Q., Liu, Z.J., Liu, J.L., Guan, G.Q., Chen, Z., Luo, J.X., Wang, X.L., Yin, H., 2014. Molecular evidence for piroplasms in wild Reeves’ muntjac (Muntiacus reevesi) in China. Parasitol. Int. 63, 713–716. Yin, F., Liu, J., Gao, S., Liu, A., Zhao, S., Li, S., Wang, J., Li, Y., Luo, J., Guan, G., Yin, H., 2018. Exploring the TLR and NLR signaling pathway relevant molecules induced by the Theileria annulata infection in calves. Parasitol. Res. 117, 3269–3276. Yin, H., Guan, G.Q., Ma, M.L., Luo, J.X., Lu, B.Y., Yuan, G.L., Bai, Q., Lu, C.P., Yuan, Z.P., Preston, P., 2002a. Haemaphysalis qinghaiensis ticks transmit at least two different Theileria species: one is infective to yaks, one is infective to sheep. Vet. Parasitol. 107, 29–35. Yin, H., Luo, J., Guan, G., Gao, Y., Lu, B., Zhang, Q., Ma, M., Lu, W., Lu, C., Yuan, Z., Guo, S., Wang, B., Du, H., Schnittger, L., Ahmed, J., Jongejan, F., 2002b. Transmission of an unidentified Theileria species to small ruminants by Haemaphysalis qinghaiensis ticks collected in the field. Parasitol. Res. 88, S25–27. Yin, H., Luo, J., Lu, W., 2008. Control of tropical theileriosis with attenuated schizont vaccine in China. Vaccine 26 (Suppl. 6), G11–13. Yuan, L., Guan, G., Liu, J., Zhao, S., Yang, C., Lu, H., Yin, H., Meng, Q., Luo, J., 2014. Cloning and expression of RAP-1C gene from Babesia bigemina and reactivity of the expressed recombinant protein. Parasit. Vectors 44, 823–828.
Bai, Q., Liu, G., Yin, H., Zhao, Q., Liu, D., Ren, J., Li, X., 2002. Theileria sinensis sp nov: a new species of bovine theileria-classical taxonomic studies. Acta Veterinaria et Zootechnica Sinica 33, 365–369. Bai, Q., Liu, Q.Y., Hen, G.F., 1997. An unidentified species of Theileria infective for cattle discovered in China. Trop. Anim. Health Prod. 29, 43s–47s. Banowary, B., Dang, V.T., Sarker, S., Connolly, J.H., Chenu, J., Groves, P., Ayton, M., Raidal, S., Devi, A., Vanniasinkam, T., Ghorashi, S.A., 2015. Differentiation of Campylobacter jejuni and Campylobacter coli using multiplex-PCR and high resolution melt curve analysis. PLoS One 10, e0138808. Chua, K.H., Lim, S.C., Ng, C.C., Lee, P.C., Lim, Y.A.L., Lau, T.P., Chai, H.C., 2015. Development of high resolution melting analysis for the diagnosis of human malaria. Sci. Rep. 5. Edwards, T., Sasaki, S., Williams, C., Hobbs, G., Feasey, N.A., Evans, K., Adams, E.R., 2018. Speciation of common Gram-negative pathogens using a highly multiplexed high resolution melt curve assay. Sci. Rep. 8. Erali, M., Voelkerding, K.V., Wittwer, C.T., 2008. High resolution melting applications for clinical laboratory medicine. Exp. Mol. Pathol. 85, 50–58. Forsyth, L.M., Minns, F.C., Kirvar, E., Adamson, R.E., Hall, F.R., McOrist, S., Brown, C.G., Preston, P.M., 1999. Tissue damage in cattle infected with Theileria annulata accompanied by metastasis of cytokine-producing, schizont-infected mononuclear phagocytes. J. Comp. Pathol. 120, 39–57. Ghorashi, S.A., Kanci, A., Noormohammadi, A.H., 2015. Evaluation of the capacity of PCR and high-resolution melt curve analysis for identification of mixed infection with Mycoplasma gallisepticum strains. PLoS One 10, e0126824. Ghorashi, S.A., O’Rourke, D., Ignjatovic, J., Noormohammadi, A.H., 2011. Differentiation of infectious bursal disease virus strains using real-time RT-PCR and high resolution melt curve analysis. J. Virol. Methods 171, 264–271. Gubbels, J.M., de Vos, A.P., van der Weide, M., Viseras, J., Schouls, L.M., de Vries, E., Jongejan, F., 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 37, 1782–1789. Gubbels, M.J., Hong, Y., van der Weide, M., Qi, B., Nijman, I.J., Guangyuan, L., Jongejan, F., 2000. Molecular characterisation of the Theileria buffeli/orientalis group. Int. J. Parasitol. 30, 943–952. Gubbels, M.J., Yin, H., Bai, Q., Liu, G.Y., Nijman, I.J., Jongejan, F., 2002. The phylogenetic position of the Theileria buffeli group in relation to other Theileria species. Parasitol. Res. 88, S28–S32. Hainimuguli, A., Xiaowan, X., Mireguli, T., Qingyong, G., 2017. Investigation on Theileria annulata infection in partial areas of Toksun, Xinjiang. Anim. Husband. Vet. Med. 49, 117–119. Hernandez, C., Alvarez, C., Gonzalez, C., Ayala, M.S., Leon, C.M., Ramirez, J.D., 2014. Identification of six new world Leishmania species through the implementation of a high-resolution melting (HRM) genotyping assay. Parasit. Vectors 7. Hrncirova, K., Lengerova, M., Kocmanova, I., Racil, Z., Volfova, P., Palousova, D., Moulis, M., Weinbergerova, B., Winterova, J., Toskova, M., Pospisilova, S., Mayer, J., 2010. Rapid detection and identification of mucormycetes from culture and tissue samples by use of high-resolution melt analysis. J. Clin. Microbiol. 48, 3392–3394. Junlong, L., Li, Y., Liu, A., Guan, G., Xie, J., Yin, H., Luo, J., 2015. Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle. Parasitol. Res. 114, 2715–2721. JX, L., H, Y., GY, L., GQ, G., ZJ, L., AH, L., 2006. Collection and identification of piroplasma infected to cattle and sheep in China. Chin. J. Parasitol. Parasit Dis. 24, 48–53. Kibbe, W.A., 2007. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35, W43–46. Kuang, Z.W., Zhang, C.Y., Pang, H.S., Ma, Y., 2018. A rapid high-resolution melting method for differentiation of Leishmania species targeting lack gene. Acta Trop. 178, 103–106. Li, A., Liu, A., Wang, J., Zhu, H., Ma, M., Ren, Q., Guan, G., Luo, J., 2014. Development of an ELISA for diagnosis of babesiosis in cattle. Chin. Vet. Sci. 44, 62–67. Luo, J.X., Lu, W.S., 1997. Cattle theileriosis in China. Trop. Anim. Health Prod. 29, 4s–7s.
7
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Rapid detection and differentiation of Theileria annulata, T. orientalis and T. sinensis using high-resolution melting analysis
T
Jinming Wanga, Jifei Yanga, Shandian Gaoa, Aihong Liua, Muhammad Rashida, Youquan Lia, ⁎ ⁎ Zhijie Liua, Junlong Liua, Guangyuan Liua, Jianxun Luoa, Guiquan Guana, , Hong Yina,b, a
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Xujiaping 1, Lanzhou, Gansu, 730046, PR China b Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Disease and Zoonosis, Yangzhou University, Yangzhou 225009, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: High-resolution melting Bovine theileriosis Diagnosis Discrimination
Bovine theileriosis, caused by protozoan parasites of the genus Theileria, presents with various clinical symptoms. In cattle, clinical presentations and outcomes of bovine theileriosis are closely correlated with the causative Theileria spp. Thus, accurate detection and discrimination of Theileria spp. are essential for epidemiological studies and for provision of clinical management strategies. High-resolution melting (HRM) analyses of two amplicons targeting the 18S rRNA indicated that T. annulata, T. orientalis, and T. sinensis isolated from China can be accurately detected and discriminated with the lowest detection limit of 1–10 copy numbers of plasmid bearing the 18S rRNA sequence. The approach was verified with DNA samples from experimentally infected cattle and field samples. Thus, this assay is useful for diagnosis of bovine theileriosis in field samples and experimentally infected animals, and could also be applicable for the survey of parasite dynamics, epidemiological studies.
1. Introduction Bovine theileriosis is caused by protozoan parasites of the genus Theileria, order Piroplasmorida, phylum Apicomplexa, and is characterized by a spectrum of clinical manifestations. It has economically important outcomes for both health and production in domesticated bovines worldwide (Santos et al., 2013). Three Theileria spp. (Theileria annulata, Theileria orientalis, and Theileria sinensis) have been documented as economically predominant pathogens for bovine theileriosis in China (Bai et al., 1997; Luo and Lu, 1997; Yin et al., 2002a; JX et al., 2006). The severity of the disease and outcomes of infections vary depending on the immune status of host and causative Theileria spp. Generally, T. annulata is known as tropical theileriosis and is highly pathogenic, whereas T. orientalis and T. sinensis are believed to induce a mild or asymptomatic disease (Aktas et al., 2006; Ota et al., 2009; McFadden et al., 2011). T. annulata is transmitted by Hyalomma spp., which are widely distributed in semiarid and desert land in Northern China (Luo and Lu, 1997). The infections of this parasite can cause a high morbidity and mortality in cattle, ranged from 7.1% to 61% and 4–46.4%, respectively (Luo and Lu, 1997; Yin et al., 2008; Hainimuguli et al., 2017). T. orientalis, transmitted by Haemaphysalis concinna and Haemaphysalis longicornis, is a benign Theileria spp. group that includes ⁎
Theileria sergenti, Theileria buffeli, and T. orientalis (Stewart et al., 1996; Gubbels et al., 2000, 2002; Wang et al., 2018). Theileria sinensis was initially isolated from cattle in Gansu Province in 1995; and Haemaphysalis qinghaiensis and Haemaphysalis japonica are considered to be possible vectors for this microorganism (Bai et al., 2002; Yin et al., 2002b). Thus, the developments of rapid detection and reliability discrimination of Theileria spp. are essential for providing appropriate prevention and for performing clinical management strategy. High-resolution melting (HRM) analysis is characterized by an automated analytical molecular method that monitors fluorescence changes during double-stranded DNA dissociation into single-stranded DNA (Erali et al., 2008; Hrncirova et al., 2010). When a PCR reaction is performed, a double-stranded DNA dye is intercalated homogenously into DNA. The HRM analysis is then conducted to determine the melting behavior of particular DNA product dissociations (Edwards et al., 2018). HRM was initially employed to detect single nucleotide polymorphisms in genetic diseases. Subsequently, it has also been employed to detect internal tandem duplicators, for mutation scanning, genotyping bacteria, and in cancer research (Wolff et al., 2008; TalmiFrank et al., 2010a). Developed assays have also been applied to identify Babesia caballi and Theileria equi, to discriminate four Babesia spp. infective to humans and dogs, and to diagnose five Plasmodium spp.
Corresponding authors at: Lanzhou Veterinary Rsearch Institue, Chinese Academy of Agricultural Sciences. E-mail addresses: [email protected] (G. Guan), [email protected] (H. Yin).
https://doi.org/10.1016/j.ttbdis.2019.101312 Received 30 May 2019; Received in revised form 24 September 2019; Accepted 9 October 2019 Available online 16 October 2019 1877-959X/ © 2019 Elsevier GmbH. All rights reserved.
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
Table 1 Primer sequences for the identification of Theileria spp. and plasmid DNA preparations. Primer name
Sequence (5'-3')
Orientation
Amplicon size (bp)
BovisTB-2R BovisTB-2F BovisT-5F BovisT-5R Piro1-S Piro3-AS
GCTGGCACCAGACTTGCCCTCC GCCGACTAGAGATTGGAGGTCGTC CGAGACCTTAACCTGCTAAATAGG CCCTCTAAGAAGCGATAACGGG CTTGACGGTAGGGTATTGGC CCTTCCTTTAAGTGATAAGGTTCAC
Forward Reverse Forward Reverse Forward Reverse
72 80 Approximately 1400
Fig. 1. Alignments of nucleotide sequences of 18S rRNA gene regions and primer locations. Sequence alignment of the nucleotide sequences of piroplasm amplicons used in the HRM analysis. The underlined sequences indicate the position of the primer pair used for the assays.
2.3. Experimentally infected and naturally infected blood samples
(Salim et al., 2013; Chua et al., 2015; Rozej-Bielicka et al., 2017). In the present study, we describe the application of a RT-PCR-HRM assay targeting the 18S rRNA gene to discriminate three Theileria spp. infective to cattle.
Twenty-four cattle were purchased from a bovine theileriosis-free area and confirmed to be piroplasm free by the thin blood smear microscopy, nested PCRs and ELISA assays (Olmeda et al., 1997; Li et al., 2014; Yang et al., 2014; Yuan et al., 2014). Hyalomma anatolicum experimentally infected with T. annulata were confirmed by PCR assays. Infected ticks were ground to make supernatant according to a previously described protocol (Forsyth et al., 1999; Junlong et al., 2015; Yin et al., 2018). Supernatants of 50 ground ticks were inoculated subcutaneously into each cattle. After inoculation, thin blood smears were examined to monitor the infection status every two days, and the blood samples were collected into EDTA-coated tubes to isolate the genomic DNA. From August 2007 to July 2015, 334 blood samples were collected into EDTA-coated tubes from cattle distributed across China, where bovine theileriosis is an issue. All blood samples were transported to the laboratory at VVBD in iceboxes. DNA was extracted using QIAamp DNA Blood Mini Kit according to the manufacturer’s instructions. The DNA concentration was determined by NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). All samples were previously screened using nested PCR assays targeting the 18S rRNA combined with gene sequencings (Olmeda et al., 1997; Yang et al., 2014). The results of sequence blast analysis, using the BLASTn program, showed that these samples composed 106 cases of Theileria spp. infections, including 98 cases of T. orientalis, seven of T. annulata and one case of T. sinensis infection, although no mixed infections were found.
2. Materials and methods 2.1. Primer design The accession numbers of available 18S rRNA genes in the GenBank database were used to design primers for Babesia bovis, Babesia bigemina, Babesia major, Babesia ovata, Babesia orientalis, T. annulata, T. orientalis, and T. sinensis. After sequence alignment carried out using DNAMAN 2.0 software, the conserved and variable regions were identified for each Theileria species. Two pairs of oligonucleotides were designed in these conserved regions using Primer 5.0 software to amplify the variable gene fragments intraspecies. 2.2. Reference strains Cryopreserved blood samples infected with B. bovis, B. bigemina, B. major, B. ovata, B. orientalis, T. annulata, T. orientalis, and T. sinensis, provided by the Vectors and Vector-Borne Diseases (VVBD) Laboratory, Lanzhou Veterinary Research Institute (LVRI), Chinese Academy of Agricultural Sciences (CAAS), were used as reference strains. Total DNA was extracted from 200 μl of blood using a commercially available DNA extraction kit (QIAamp DNA Blood Mini Kit, Qiagen, Germany), according to the manufacturer’s instructions. Negative control DNA was isolated from the whole blood of piroplasm-free cattle, confirmed by blood smear microscopy and nested PCR (Yang et al., 2014). The extracted DNA was stored at −20 °C until for further use.
2.4. Plasmid DNA preparations The 18S rRNA genes of these parasites were amplified with a set of primer pair (Piro1-S and Piro3-AS) (Table 1) (Yang et al., 2014). The 2
Ticks and Tick-borne Diseases 11 (2020) 101312 Range of GCP
69.78 – 93.72 61.43 – 97.16 88.7 - 100
GCP (Average ± SD)
84.43 ± 9.90 81.31 ± 12.18 94.35 ± 7.99
J. Wang, et al.
method for PCR amplification was performed as previously described (Yang et al., 2014). The PCR products were electrophoresed on a 1.5% agarose gel containing Gold View dye (SolarBio, Beijing, China) in Trisacetate-EDTA (TAE) buffer at 120 V for 30 min and visualized under UV light. PCR amplicons were purified and cloned into a pGEM-T vector using the Easy Vector System (Promega, Madison, USA). Briefly, the PCR amplicons were purified with a Zymoclean™ Gel DNA Recovery Kit (Zymo, USA), cloned into a PGEM-T Easy vector (Promega, USA) and then transformed into Escherichia coli DH5α competent cells. Three clones from each sample were selected and sequenced using BigDye Terminator Mix (GenScript, Nanjing, China). Sequences were subjected to blast analysis on NCBI database using the BLASTn program.
86.98 ± 10.92
RT-PCR-HRM was performed using a Rotor-Gene Q6000 Real-Time PCR system. Each reaction was performed in a total volume of 10 μl comprising 5 μl Forget-Me-Not™ qPCR Master Mix (Biotium, USA), 5 pmol of each primer, 20 ng genomic DNA or 10 ng plasmid DNA bearing 18S rRNA gene sequence. The reaction profiles were as follow: initial denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing temperature at 60 °C for 10 s. For HRM analysis, fluorescent signals were monitored from 75 °C to 85 °C increasing by increments of 0.2 °C. Finally, the melting curves were normalized using the High Resolution Melt software v2.3.1 (Qiagen, Germany). 2.6. Evaluation of sensitivity and specificity of RT-PCR-HRM assays
GCP: genotype confidence percentage. The Tm and GCP values of amplicons 1and 2 were calculated from reference species with variable amounts of genomic DNA.
No test No test 75.64-76.0 76.2-77.0 77.44-78.10 No test No test 75.85 ± 0.12 76.60 ± 0.28 77.80 ± 0.29 B. B. T. T. T.
bigemina + B. orientalis major + B. ovata annulata orientalis sinensis
78.39 ± 0.22 79.58 ± 0.30 76.49 ± 0.17
77.89-78.81 79.10-79.84 76.2-76.76
62.07 – 99.06
Range Tm (Average ± SD) Range of GCP GCP (Average ± SD) Range of Tm Tm (Average ± SD)
Amplicon 1 Species
Table 2 Tm values and GCP values obtained in the HRM analysis targeting the 18S rRNA gene of different Theileria spp.
Amplicon 2
2.5. Real time PCR-high resolution melting analysis
To determine the sensitivity and detection limit of the RT-PCR-HRM assay, tenfold serial dilutions of positive control plasmid DNA of B. bovis, B. bigemina, B. major, B. ovata, T. annulata, T. orientalis, and T. sinensis were used as template, ranging from 107 to 1 copies per microliter. Three reaction mixtures from each plasmid were used in independent experiments to ensure the reproducibility of the threshold cycle number (Ct). Standard curves were plotted using High Resolution Melt software v2.3.1 (Qiagen, Germany) to evaluate the amplified efficiency percentage and linear correlations of each species. Serial dilutions of genomic DNA (10 ng to 50 fp) were used as template to evaluate the melting temperature shift, melting profiles and genotype confidence percentage (GCP) of amplicon 1 and amplicon 2. RT-PCR-HRM was evaluated using DNA from 66 experimentally infected and 334 field samples. Duplicated tests for each sample were performed. 3. Results 3.1. Specificity analyses Two amplicons were designed after analysis of all available 18S rRNA sequences submitted to GenBank. To identify the conserved regions of intraspecies and polymorphic regions among species, theoretical melting temperatures were predicted in silico using the OligoCalac to guide primer design (Kibbe, 2007). The 72-bp amplicon 1 was produced using the primer pair BovisTB-2 F and BovisTB-2R to distinguish Theileria from Babesia spp. The 80-bp amplicon 2 was produced using the primer Bovis-T-5 F and Bovis-T-5R for detection and discrimination of Theileria spp., including T. annulata, T. orientalis, and T. sinensis (Fig. 1 and Table 1). The average melting temperatures and standard deviations of two amplicons for each species are listed in Table 2. According to the melting profiles and Tm values, amplicon 1 was able to distinguish Theileria spp. (T. annulata, T. orientalis, and T. sinensis) from other piroplasms, such as B. bovis, B. bigemina, B. orientalis, B. major, and B. ovata. This amplicon was specific for the differentiation of piroplasms into three groups, comprising Theileria spp. with Tm = 76.49 ± 3
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
Fig. 2. HRM plots for detection and discrimination of Theileria spp. (A) Normalized HRM plots for 18S rRNA amplicon 1; (B) normalized difference curves of amplicon 1; (C) derivative melting curve peaks for amplicon 1; (D) normalized HRM plots for 18S rRNA amplicon 2; (E) normalized difference curves of amplicon 2; and (F) derivative melting curve peaks for amplicon 2.
Fig. 3. Melting temperatures obtained with HRM assays. The Tm values were determined in duplicated independent experiments with variable initial amounts of genomic DNA from each species.
T. orientalis, and Tm = 78.80 ± 0.29 °C of T. sinensis (Fig. 2, Table 2). The average and standard deviation of the melting temperature (Tm) for each amplicon were determined in duplicated independent experiments using variable amounts of DNA from each species (Fig. 3).
0.16 °C, B. bigemina and B. orientalis with Tm = 78.39 ± 0.22 °C, and B. major and B. ovata with Tm = 79.58 ± 0.30 °C. There was no amplification signal or melting curve in genomic DNA isolated from B. bovis and piroplasm-free cattle. Given that overlapping Tm values of amplicon 1 were observed in three Theileria spp., the discrimination of Theileria spp. can be performed by RT-PCR-HRM analyses of amplicon 2, which was able to distinguish three Theileria spp. from each other with Tm = 75.95 ± 0.12 °C of T. annulata, Tm = 76.60 ± 0.28 °C of
3.2. Sensitivity To evaluate the detection limit of the RT-PCR-HRM assay, tenfold 4
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
efficiencies, varying from 0.989 to 1.000 and 89.9% to 102.6%, respectively, for all Theileria spp. (Table 3).
Table 3 Efficiency and correlation of 18S rRNA RT- PCR for amplicons 1 and 2. Species
Amplicon 1 2
T. T. T. B. B. B. B.
orientalis sinensis annulata bovis bigemina major ovata
Amplicon 2
R value
Assay efficiency percentage
R2 value
Assay efficiency percentage
0.999 0.992 0.998 0.999 1.000 0.999 0.999
96.80% 89.90% 92.70% 100.5 98.00% 102.60% 99.50%
1 0.999 0.989 NA NA NA NA
97.20% 98.90% 93.60% NA NA NA NA
3.3. Evaluation of the HRM assay with experimentally infected and naturally infected blood samples The RT-PCR-HRM assay of 18S rRNA gene amplicon 1 was evaluated using 66 genomic DNA samples from cattle experimentally infected with T. annulata and 334 field samples. Amplicon 2 was evaluated for the detection and discrimination of Theileria spp. with the 66 DNA from experimentally infected cattle and 106 clinical samples infected with Theileria spp. Reference species of T. annulata, T. orientalis, and T. sinensis were set as ‘genotype’ and the HRM genotype confidence percentage (GCP) was determined by comparing each sample with the defined genotypes using the High Resolution Melt software v2.3.1 (Qiagen, Germany). On the basis of GCP analyses, a cut off value was generated and used to assess the infection and diagnosis of field samples. A cut-off value was determined by subtracting two-fold SD value from average GCP. The mean GCP and SD of amplicon 1 were 86.98 and 10.92, respectively; and a cut-off value of 65.14 was determined for Theileria spp. Similarly, The cut-off value of 59.96 was determined for amplicon 2. Theileria spp. identified herein using the HRM analysis
serial dilutions, from 107 to 1 plasmid copies per microliter, containing the target sequence of each species, were tested. The detection limit of amplicon 1 was one copy per reaction for each species except T. orientalis, which had a detection limit of ten copies. For amplicon 2, the detection limit was ten copies for the three Theileria spp. To confirm the reproducibility of this approach, these data were determined by duplicated tests. The standard curves for quantification assays, confirmed by duplicated experiments, showed satisfactory correlations and
Fig. 4. Detection and discrimination of field samples. (A) Normalized HRM plots of amplicon 1 for the identification of the genus Theileria; (B) normalized HRM plots of amplicon 2 for identification of the three Theileria spp.; and (C) normalized difference curves of amplicon 2 for field samples. 5
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
concentration of DNA for tested clinical samples can minimize the influence of those factors and improve the consistency and repeatability of HRM analyses (Toi and Dwyer, 2008; Banowary et al., 2015;). High resolution melt software v2.3.1 can automatically match samples with melting curves and normalized fluorescence profiles with reference species; therefore, the GCP values were determined. Clinical samples that produce GCP ≥ cut-off values were considered similar to reference species, while those generated GCP < cut-off value were considered to be distinct with the reference species. In this study, we developed an rapid and sensitivity approach to determine the relationship between the isolates from clinical sample and reference species in an automated technique. This outstanding characteristic can facilitate the application of HRM analysis in diagnosis of diseases caused by bacteria and virus in research laboratories (Ghorashi et al., 2011, 2015). It does not require probes, labeled primers, or manipulation with PCR products, such as gel fractionation, PRLP analysis, and gene sequencing, that avoid cross contamination of PCR products in the laboratory.
Table 4 Identification of Theileria spp. in experimentally infected cattle and field samples. Sample source
Experimentally infected samples Field sample
Diagnostic methods HRM assays
nPCR assay and 18S rRNA gene sequencing
T. annulata (66)
T. annulata (66)
T. orientalis (98) T. annulata (7) T. sinensis (1)
T. orientalis (98) T. annulata (7) T. sinensis (1)
were in 100% agreement with those using nested PCR and gene sequencing (Fig. 4 and Table 4).
4. Discussion 5. Conclusion Molecular approaches are extensively used for epidemiological investigations and for the detection of bovine theileriosis to distinguish and confirm Theileria infection at the species level. These approaches include nested PCR combined with gene sequencing, PCR followed by reverse line blot hybridization (RLB) or restriction fragment length polymorphism (RFLP), loop-mediated isothermal amplification (LAMP), and RT-PCR (Adjou Moumouni et al., 2015; Gubbels et al., 1999; Tian et al., 2013). Several of these methods, such as RLB and RFLP, require the manipulation of the PCR products, which can cause a risk of contamination with amplicons. The RT-PCR-HRM technique has been used to detect and identify T. equi and B. caballi, targeting the 18S rRNA gene. Previously, it has also been used to differentiate Babesia spp. infecting humans and dogs (Salim et al., 2013; Rozej-Bielicka et al., 2017). Recently, Chua et al. (Chua et al., 2015) explored HRM analysis for the simultaneous detection of all five human Plasmodium spp. Their results indicated that the 18S rRNA gene, as an attractive target gene, presents many advantages; for example, highly conserved regions enable the detection of almost all piroplasm species, whereas variable sequences can be employed for species differentiation. In the present study, we described a new assay for the rapid detection and discrimination of Theileria spp. widely distributed across China. The HRM assay is rapid, sensitive, and can detect as few as 1–10 copies of plasmids bearing the 18S rRNA gene in a single reaction; in other words, less than one parasite per reaction. This assay is performed in a closed-tube and requires automated analysis. The distinct shape of melting curve and Tm values are characteristic of particular DNA products, as determined based on sequence length, GC content, and nearest neighbor thermodynamics (TalmiFrank et al., 2010b). HRM analysis provides a repeatable melting curve and Tm values for specific species isolated from different hosts and locations. HRM curves of amplicon 1 from three Theileria spp., which were distinguished from Babesia spp. infective for cattle, were similar. However, the DNA sequences of amplicon 1 were identical among T. annulata, T. orientalis and T. sinensis. Four Babesia spp. infective to cattle, B. bigemina, B. ovata, B. major, and B. orientalis, were amplified by the reaction and generated distinctly different melting curves. Thus, although assay amplifications were observed from DNA of these Babesia spp., they could not be confused with Theileria spp. Amplicon 2 was specifically designed to distinguish among T. annulata, T. orientalis, and T. sinensis. The RT-PCR-HRM method could be impacted by various factors, such as the quality and quantity of the genomic DNA template (Hernandez et al., 2014; Kuang et al., 2018). To evaluate the influences of these factors on HRM analysis curve profiles and melting temperatures, a variable concentration of DNA from experimentally and naturally infected (field samples) animals, which have a slight influence on melting profiles and Tm values, were used for HRM analyses. An equal
The RT-PCR-HRM analysis developed herein was shown to be a powerful and cost-effective technique for the detection and discrimination of Theileria spp. that are responsible for the majority of cases of bovine theileriosis across China. Funding This study was financially supported by the National Key R&D Program of China (2017YFD0501200, 2018YFD0501804, 2018YFD0502305); ASTIP (CAAS-ASTIP-2016-LVRI); NBCITS (CARS37); 973 Program (2015CB150300); Jiangsu Co-innovation Center program for Prevention and Control of Important Animal Infectious Disease and Zoonosis. Authors’ contributions Designed the study: Hong Yin, Jianxun Luo, Guiquan Guan, Guangyuan Liu. Performed the experiments, analyzed the results, and wrote manuscript: Jinming Wang. Contributed reagents/materials/ equipment: Jifei Yang, Shandian Gao, Zhijie Liu, Muhammad Rashid, Aihong Liu, Youquan Li, Junlong Liu. All authors have read and approved the final version of the manuscript. Ethics approval The protocol used in this study and all animal handling were approved by the Animal Ethics Committee of the Lanzhou Veterinary Research Institute, CAAS (Permit No. LVRIAEC-2018-001). Competing interests The authors declare that they have no competing interests. Acknowledgements Not applicable. References Adjou Moumouni, P.F., Aboge, G.O., Terkawi, M.A., Masatani, T., Cao, S., Kamyingkird, K., Jirapattharasate, C., Zhou, M., Wang, G., Liu, M., Iguchi, A., Vudriko, P., Ybanez, A.P., Inokuma, H., Shirafuji-Umemiya, R., Suzuki, H., Xuan, X., 2015. Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya. Parasit. Vectors 8, 496. Aktas, M., Altay, K., Dumanli, N., 2006. A molecular survey of bovine Theileria parasites among apparently healthy cattle and with a note on the distribution of ticks in eastern Turkey. Vet. Parasitol. 138, 179–185.
6
Ticks and Tick-borne Diseases 11 (2020) 101312
J. Wang, et al.
McFadden, A.M.J., Rawdon, T.G., Meyer, J., Makin, J., Morley, C.M., Clough, R.R., Tham, K., Mullner, P., Geysen, D., 2011. An outbreak of haemolytic anaemia associated with infection of Theileria orientalis in naive cattle. N. Z. Vet. J. 59, 79–85. Olmeda, A.S., Armstrong, P.M., Rosenthal, B.M., Valladares, B., delCastillo, A., deArmas, F., Miguelez, M., Gonzalez, A., Rodriguez, J.A.R., Spielman, A., Telford, S.R., 1997. A subtropical case of human babesiosis. Acta Trop. 67, 229–234. Ota, N., Mizuno, D., Kuboki, N., Igarashi, I., Nakamura, Y., Yamashina, H., Hanzaike, T., Fujii, K., Onoe, S., Hata, H., Kondo, S., Matsui, S., Koga, M., Matsumoto, K., Inokuma, H., Yokoyama, N., 2009. Epidemiological survey of Theileria orientalis infection in grazing cattle in the eastern part of Hokkaido, Japan. J. Vet. Med. Sci. 71, 937–944. Rozej-Bielicka, W., Masny, A., Golab, E., 2017. High-resolution melting PCR assay, applicable for diagnostics and screening studies, allowing detection and differentiation of several Babesia spp. infecting humans and animals. Parasitol. Res. 116, 2671–2681. Salim, B., Bakheit, M.A., Sugimoto, C., 2013. Rapid detection and identification of Theileria equi and Babesia caballi by high-resolution melting (HRM) analysis. Parasitol. Res. 112, 3883–3886. Santos, M., Soares, R., Costa, P., Amaro, A., Inacio, J., Gomes, J., 2013. Revisiting the Tams1-encoding gene as a species-specific target for the molecular detection of Theileria annulata in bovine blood samples. Ticks Tick. Dis. 4, 72–77. Stewart, N.P., Uilenberg, G., deVos, A.J., 1996. Review of Australian species of the Theileria, with special reference to Theileria buffeli of cattle. Trop. Anim. Health Prod. 28, 81–90. Talmi-Frank, D., Nasereddin, A., Schnur, L.F., Schonian, G., Toz, S.O., Jaffe, C.L., Baneth, G., 2010a. Detection and identification of old world leishmania by high resolution melt analysis. PLoS Negl. Trop. Dis. 4. Talmi-Frank, D., Nasereddin, A., Schnur, L.F., Schonian, G., Toz, S.O., Jaffe, C.L., Baneth, G., 2010b. Detection and identification of old world Leishmania by high resolution melt analysis. PLoS Negl. Trop. Dis. 4, e581. Tian, Z.C., Liu, G.Y., Yin, H., Luo, J.X., Guan, G.Q., Luo, J., Xie, J.R., Shen, H., Tian, M.Y., Zheng, J.F., Yuan, X.S., Wang, F.F., 2013. RPS8–a new informative DNA marker for phylogeny of Babesia and Theileria parasites in China. PLoS One 8, e79860. Toi, C.S., Dwyer, D.E., 2008. Differentiation between vaccine and wild-type varicellazoster virus genotypes by high-resolution melt analysis of single nucleotide polymorphisms. J. Clin. Virol. 43, 18–24. Wang, J.M., Yang, J.F., Liu, J.L., Wang, X.X., Xu, J.L., Liu, A.H., Li, Y.Q., Liu, Z.J., Ren, Q.Y., Luo, J.X., Guan, G.Q., Yin, H., 2018. Molecular detection and genetic diversity of Theileria orientalis in cattle in China. Parasitol. Res. 117, 3689–3694. Wolff, B.J., Thacker, W.L., Schwartz, S.B., Winchell, J.M., 2008. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis. Antimicrob. Agents Chemother. 52, 3542–3549. Yang, J.F., Li, Y.Q., Liu, Z.J., Liu, J.L., Guan, G.Q., Chen, Z., Luo, J.X., Wang, X.L., Yin, H., 2014. Molecular evidence for piroplasms in wild Reeves’ muntjac (Muntiacus reevesi) in China. Parasitol. Int. 63, 713–716. Yin, F., Liu, J., Gao, S., Liu, A., Zhao, S., Li, S., Wang, J., Li, Y., Luo, J., Guan, G., Yin, H., 2018. Exploring the TLR and NLR signaling pathway relevant molecules induced by the Theileria annulata infection in calves. Parasitol. Res. 117, 3269–3276. Yin, H., Guan, G.Q., Ma, M.L., Luo, J.X., Lu, B.Y., Yuan, G.L., Bai, Q., Lu, C.P., Yuan, Z.P., Preston, P., 2002a. Haemaphysalis qinghaiensis ticks transmit at least two different Theileria species: one is infective to yaks, one is infective to sheep. Vet. Parasitol. 107, 29–35. Yin, H., Luo, J., Guan, G., Gao, Y., Lu, B., Zhang, Q., Ma, M., Lu, W., Lu, C., Yuan, Z., Guo, S., Wang, B., Du, H., Schnittger, L., Ahmed, J., Jongejan, F., 2002b. Transmission of an unidentified Theileria species to small ruminants by Haemaphysalis qinghaiensis ticks collected in the field. Parasitol. Res. 88, S25–27. Yin, H., Luo, J., Lu, W., 2008. Control of tropical theileriosis with attenuated schizont vaccine in China. Vaccine 26 (Suppl. 6), G11–13. Yuan, L., Guan, G., Liu, J., Zhao, S., Yang, C., Lu, H., Yin, H., Meng, Q., Luo, J., 2014. Cloning and expression of RAP-1C gene from Babesia bigemina and reactivity of the expressed recombinant protein. Parasit. Vectors 44, 823–828.
Bai, Q., Liu, G., Yin, H., Zhao, Q., Liu, D., Ren, J., Li, X., 2002. Theileria sinensis sp nov: a new species of bovine theileria-classical taxonomic studies. Acta Veterinaria et Zootechnica Sinica 33, 365–369. Bai, Q., Liu, Q.Y., Hen, G.F., 1997. An unidentified species of Theileria infective for cattle discovered in China. Trop. Anim. Health Prod. 29, 43s–47s. Banowary, B., Dang, V.T., Sarker, S., Connolly, J.H., Chenu, J., Groves, P., Ayton, M., Raidal, S., Devi, A., Vanniasinkam, T., Ghorashi, S.A., 2015. Differentiation of Campylobacter jejuni and Campylobacter coli using multiplex-PCR and high resolution melt curve analysis. PLoS One 10, e0138808. Chua, K.H., Lim, S.C., Ng, C.C., Lee, P.C., Lim, Y.A.L., Lau, T.P., Chai, H.C., 2015. Development of high resolution melting analysis for the diagnosis of human malaria. Sci. Rep. 5. Edwards, T., Sasaki, S., Williams, C., Hobbs, G., Feasey, N.A., Evans, K., Adams, E.R., 2018. Speciation of common Gram-negative pathogens using a highly multiplexed high resolution melt curve assay. Sci. Rep. 8. Erali, M., Voelkerding, K.V., Wittwer, C.T., 2008. High resolution melting applications for clinical laboratory medicine. Exp. Mol. Pathol. 85, 50–58. Forsyth, L.M., Minns, F.C., Kirvar, E., Adamson, R.E., Hall, F.R., McOrist, S., Brown, C.G., Preston, P.M., 1999. Tissue damage in cattle infected with Theileria annulata accompanied by metastasis of cytokine-producing, schizont-infected mononuclear phagocytes. J. Comp. Pathol. 120, 39–57. Ghorashi, S.A., Kanci, A., Noormohammadi, A.H., 2015. Evaluation of the capacity of PCR and high-resolution melt curve analysis for identification of mixed infection with Mycoplasma gallisepticum strains. PLoS One 10, e0126824. Ghorashi, S.A., O’Rourke, D., Ignjatovic, J., Noormohammadi, A.H., 2011. Differentiation of infectious bursal disease virus strains using real-time RT-PCR and high resolution melt curve analysis. J. Virol. Methods 171, 264–271. Gubbels, J.M., de Vos, A.P., van der Weide, M., Viseras, J., Schouls, L.M., de Vries, E., Jongejan, F., 1999. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 37, 1782–1789. Gubbels, M.J., Hong, Y., van der Weide, M., Qi, B., Nijman, I.J., Guangyuan, L., Jongejan, F., 2000. Molecular characterisation of the Theileria buffeli/orientalis group. Int. J. Parasitol. 30, 943–952. Gubbels, M.J., Yin, H., Bai, Q., Liu, G.Y., Nijman, I.J., Jongejan, F., 2002. The phylogenetic position of the Theileria buffeli group in relation to other Theileria species. Parasitol. Res. 88, S28–S32. Hainimuguli, A., Xiaowan, X., Mireguli, T., Qingyong, G., 2017. Investigation on Theileria annulata infection in partial areas of Toksun, Xinjiang. Anim. Husband. Vet. Med. 49, 117–119. Hernandez, C., Alvarez, C., Gonzalez, C., Ayala, M.S., Leon, C.M., Ramirez, J.D., 2014. Identification of six new world Leishmania species through the implementation of a high-resolution melting (HRM) genotyping assay. Parasit. Vectors 7. Hrncirova, K., Lengerova, M., Kocmanova, I., Racil, Z., Volfova, P., Palousova, D., Moulis, M., Weinbergerova, B., Winterova, J., Toskova, M., Pospisilova, S., Mayer, J., 2010. Rapid detection and identification of mucormycetes from culture and tissue samples by use of high-resolution melt analysis. J. Clin. Microbiol. 48, 3392–3394. Junlong, L., Li, Y., Liu, A., Guan, G., Xie, J., Yin, H., Luo, J., 2015. Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle. Parasitol. Res. 114, 2715–2721. JX, L., H, Y., GY, L., GQ, G., ZJ, L., AH, L., 2006. Collection and identification of piroplasma infected to cattle and sheep in China. Chin. J. Parasitol. Parasit Dis. 24, 48–53. Kibbe, W.A., 2007. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35, W43–46. Kuang, Z.W., Zhang, C.Y., Pang, H.S., Ma, Y., 2018. A rapid high-resolution melting method for differentiation of Leishmania species targeting lack gene. Acta Trop. 178, 103–106. Li, A., Liu, A., Wang, J., Zhu, H., Ma, M., Ren, Q., Guan, G., Luo, J., 2014. Development of an ELISA for diagnosis of babesiosis in cattle. Chin. Vet. Sci. 44, 62–67. Luo, J.X., Lu, W.S., 1997. Cattle theileriosis in China. Trop. Anim. Health Prod. 29, 4s–7s.
7