Rapid detection of aflatoxin B1 by a bifunctional protein crosslinker-based surface plasmon resonance biosensor

Food Control 36 (2014) 183e190

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Rapid detection of aflatoxin B1 by a bifunctional protein crosslinkerbased surface plasmon resonance biosensor Jae Hong Park a,1, Young-Pil Kim b,1, In-Ho Kim c, Sungho Ko d, * a

Division of Nano-Convergence Technology, Korea National NanoFab Center, Deajeon, 305-806, Republic of Korea Department of Life Science, Hanyang University, Seoul, 133-791, Republic of Korea c Korea Food Research Institute (KFRI), Seongnam, Gyeonggi-Do, 463-746, Republic of Korea d Department of Applied Bioscience, CHA University, Seongnam, Gyeonggi-Do, 463-836, Republic of Korea b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 April 2013 Received in revised form 21 August 2013 Accepted 23 August 2013

The aim of this study was the development of a bifunctional protein crosslinker-based surface plasmon resonance (SPR) biosensor for rapid detection of aflatoxin B1 (AFB1), a potent carcinogen. A fusion protein was obtained by genetically fusing gold binding protein (GBP) that binds strongly to gold surfaces to protein G (ProG) that interacts with the Fc portion of antibodies. It was used as a bifunctional crosslinker for rapid self-oriented immobilization of antibodies on gold substrates without any chemical treatment. SPR analyses demonstrated the binding of the GBP-ProG crosslinker to the gold surface was superior to that of an only ProG via currently used self-assembled monolayers of alkanethiol due to the GBP property. As a result, anti-AFB1 antibodies were 36% more immobilized on the GBP-ProG layer than the ProG layer. When the GBP-ProG crosslinker-based SPR chips were fabricated with the best density (100 mg/mL) of anti-AFB1 antibodies, they could detect AFB1 as low as 1 mg/mL in both buffer and corn extracts and selectively detect it with negligible SPR responses in control toxins (zearalenone and ochratoxin A). These results mean the GBP-ProG is more useful than the thiolated chemical linkers for development of gold substrate-based immunosensors, and this GBP-ProG crosslinker-based immunosensor could detect small molecules effectively. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Bifunctional protein crosslinker Gold substrate Immunosensor Aflatoxin B1 Self-assembled monolayer Thiolated chemical linker

1. Introduction Mycotoxins that are toxic secondary metabolites are threat to human and animal health. Aflatoxin B1 (AFB1) produced by Aspergillus flavus and Aspergillus parasiticus is a highly toxic and potent natural carcinogen (Mayer, Färber, & Geisen, 2003; Patel, 2004; Squire, 1981). Therefore, great efforts have been made to develop sensitive and cost-effective analytical methods for detecting AFB1. Although thin-layer chromatography (TLC) (Krska et al., 2007) and high performance liquid chromatography (HPLC) (Khayoon et al., 2010) are currently used and widely accepted methods of detection, these methods require skilled personnel, expensive equipments, and extensive sample preparation. Therefore, fast, simple, low-cost, sensitive, and portable devices are urgently required for the detection of mycotoxins in fields. Surface plasmon resonance (SPR)-based biosensors have been extensively used to measure biospecific interactions directly and simply with sensitivity in real-

* Corresponding author. Tel.: þ82 31 725 8369; fax: þ82 31 725 8350. E-mail address: [email protected] (S. Ko). 1 These authors contributed equally to this paper. 0956-7135/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.foodcont.2013.08.038

time without chemical labeling (Mizuta et al., 2008; Souto et al., 2013; Sun et al., 2007). Notably, SPR immunosensors monitoring antigeneantibody interactions are highly specific for small molecules such as mycotoxins that have low molecular weights, usually less than 1000 Da (Mizuta et al., 2008; Sun et al., 2007). Various methods such as physical adsorption and covalent linkage have been widely used to immobilize antibodies on sensing surfaces for development of immunosensors (Dutra & Kubota, 2007; Gobi, Iwasaka, & Miura, 2007; Pei, Yang, & Wang, 2001; Subramanian, Irudayaraj, & Ryan, 2006). However, these methods have led to primary problems during the immobilization of antibodies on the sensing surface, such as instability and loss of antigen-binding abilities of bound antibodies because of their random orientation and chemical treatments (Franco, Hofstetter, & Hofstetter, 2006; Zhu & Snyder, 2003). Therefore, an effective method of immobilizing antibodies on the sensing surface is required. Protein G (ProG) of microbial origin specifically binds the Fc region of antibodies and has been used in immunoassays for oriented antibody immobilization on sensing surfaces without antibody modifications. Properly oriented antibody immobilization significantly enhanced the binding efficiency of antigens to antibodies coupled with the protein A (ProA) or ProG-layered SPR gold

184

J.H. Park et al. / Food Control 36 (2014) 183e190

surface chip via a thiolated linker with suitable reactive groups at one end of the molecule and a gold binding thiol at the other end (Oh, Kim, Park, Lee, & Choi, 2004; Schmid, Stanca, Thakur, Thampi, & Suri, 2006). Furthermore, an SPR sensor chip was fabricated by immobilizing antibodies on a gold surface using a gold binding protein (GBP) and ProG. However, not only the binding of ProG or ProA via thiolated linkers to gold sensing surfaces but also the binding between GBP and ProG remains complicated and laborious. Thus, a simple, rapid, and cost effective antibody immobilization method is required for the effective fabrication of immunosensors. The GBP composed of triple repeats of a sequence of 14 amino acid (MHGKTQATSGTIOS) serves as the anchoring component due to its strong binding properties with gold (Braun, Sarikaya, & Schulten, 2002; Brown, Sarikaya, & Johnson, 2000). The binding of GBP to gold surface is considered to be independent of thiol linkage, offering a new way of protein binding to gold surface. To overcome these problems, our previous research developed a fusion protein comprising a GBP and ProA as a crosslinker for simple and rapid antibody immobilization on gold substrates (Ko, Park, Kim, Kim, & Cho, 2009). However, the interaction between the ProA portion of the fusion protein and antibodies is not equivalent for all species because ProA poorly binds to antibodies from rat, sheep, goat, and horse (Hoffman et al., 1998). We also developed a fusion protein of GBP and SARS coronaviral surface antigen (SCVme) for a simple immobilization of anti-SCVme on SPR chip surface in our previous research (Park, Hyun, Lee, Lee, & Ko, 2009), but this fusion protein is limited to an anti-SCVme immobilization. Therefore, we here report the development of a novel SPR biosensor based on GBP-ProG bifunctional crosslinkers for detection of AFB1. ProG binds strongly to the Fc portion of antibodies from rat, sheep, goat, and horse. The genetically engineered GBPProG fusion protein enabled simple and rapid self-oriented immobilization of antibody on gold surface without chemical treatments. The crosslinking properties of the GBP-ProG were evaluated by comparing it with an alkanethiol compound interacted strongly with gold through a conventional self-assembled monolayer (SAM) method by SPR analysis. The feasibility of the GBP-ProG crosslinker-based SPR immunosensor for sensitive and selective detection of AFB1 is also demonstrated herein. Fig. 1 shows a schematic of a properly oriented antibody-based SPR gold surface via the directly self-assembled GBP-ProG crosslinker for detection of AFB1.

2. Materials and methods 2.1. Materials Affinity purified rabbit anti-AFB1-KLH polyclonal antibodies were obtained from SigmaeAldrich (St. Louis, MO) and suspended in 0.01 M phosphate buffered saline (PBS, pH 7.4) containing 15 mM sodium azide. AFB1, zearalenone (ZEA), and ochratoxin A (OTA) were also purchased from Sigma. Purified recombinant protein G, N-ethyl-N’-(dimethylamino dimethylaminoprolyl) carbodiimide hydrochloride (EDC), and N-hydroxysuccinimide (NHS) were obtained from Pierece Biotechnology Inc. (Rockford, IL). 2.2. Production of bifunctional GBP-ProG crosslinker To produce the bifunctional GBP-ProG crosslinker for simply oriented immobilization of antibodies on a gold surface, the GBP which has strong binding properties with gold surfaces was genetically fused to the N-terminus of ProG that interacts with the Fc portion of antibodies (Fig. 2). A six-histidine (6His) tag was fused to the N-terminus of GBP to facilitate easy purification of the fusion protein. The DNA fragments encoding GBP-ProG were amplified by polymerase chain reaction (PCR) using the plasmid pET-22b and genomic DNA of Streptococcus G148 as the template. The DNA fragment encoding incomplete 6His-GBP was first obtained by PCR amplification using the primers (P1 and P2) and the plasmid pET22b(þ) as the template. The sequences of primers used in this study are shown in Table 1. The gene fragment encoding ProG was amplified by primers P3 and P4 using the genomic DNA of Streptococcus G148 as the template. Then, the gene fragment encoding 6His-GBP-ProG was amplified by P1 and P4. The PCR product of 6His-GBP-ProG was digested with two restriction enzymes of NdeI and XhoI, and ligated into the NdeI and XhoI sites of pET-22b (Novagen, San Diego, CA) to construct pET-6HisGBP-ProG. Recombinant Escherichia coli BL21(DE3) harboring pET6HisGBP-ProG was cultivated in 100 mL LuriaeBertani (LB) medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L) supplemented with ampicillin (50 mg/mL). Cultivation was carried out in a shaking incubator at 37  C and 270 rpm and was monitored by measuring the absorbance at 600 nm (OD600; DU Series 600 spectrophotometer, Beckman, Fullerton, CA). The transformant cells were further cultivated for 3 h after the addition of isopropyl-b-D-thiogalactopyranoside (IPTG, Sigma) at a concentration of 1 mM for the induction of gene expression from the lacUV5 promoter. The cells were then harvested by centrifugation at 4500 rpm for 40 min at 4  C and disrupted by sonication (Braun Ultrasonics Co, Danbury, CT) at 25% output power for 10 min. The supernatant containing soluble proteins was obtained after centrifugation at 13,000 rpm for 30 min at 4  C. The recombinant 6His-GBP-ProG was purified using the Ni-NTA His BindÒ Resins (Qiagen, Valencia, CA) in accordance with the manufacturer’s standard protocol. 2.3. The binding properties of the GBP-ProG crosslinker

Fig. 1. Schematic of a properly oriented antibody-based SPR gold surface via the directly self-assembled GBP-ProG crosslinker for detection of AFB1.

SPR measurement was performed using a BIAcore 3000Ô instrument (Biacore AB, Uppsala, Sweden) with four flow channels. The binding properties of the GBP-ProG crosslinker to the surface of the SPR gold chip were compared with that of a commercial recombinant ProG (cProG) without the GBP portion as a control. All SPR processes in this study were performed using a phosphate buffered saline (PBS, pH 7.4) solution as running buffer at a flow rate of 5 mL/min at 25  C. Purified GBP-ProG (1.0 mg/mL) was injected into a flow channel for 15 min to form a functional linker layer on the chip surface, followed by washing with PBS to remove unbound proteins. BSA (1.0 mg/mL) was applied to the flow channel

J.H. Park et al. / Food Control 36 (2014) 183e190

185

Fig. 2. Schematic of the production of GBP-ProG bifunctional crosslinker.

for 7 min to block any available free chip surface in order to prevent non-specific binding. Then, 50 mg/mL anti-AFB1 antibody was injected into the flow channel for 15 min, and the channel was rinsed with PBS. Meanwhile, another fresh SPR gold chip was cleaned with piranha solution, a 3:1 mixture of sulfuric acid (H2SO4) and 30% hydrogen peroxide (H2O2), for 30 min. After several times rinses with deionized (DI) water, the chip was dried under a pure N2 gas stream. Then, the chip was immersed for 18 h into 11-MUA solution (5 mM) prepared in absolute ethanol. Next, the chip was rinsed several times with ethanol and DI water in order to construct a self-assembled monolayer (SAM) of alkanethiol. The SAM layer was activated by passing a mixture (1:1) of freshly prepared EDC (0.2 M) and NHS (0.1 M) as crosslinking agents for 20 min. The cProG (1.0 mg/mL) was passed over the SAMactivated gold surface for 15 min. After rinsing with PBS, unbound NHS esters were blocked by flowing BSA (1.0 mg/mL) for 7 min to

Table 1 Oligonucleotides used for PCR amplification. No. Primer P1 P2 P3 P4 a b

b

Sequencesa (50 / 30 ) GAAACAGCATATGCACCATCACCATCACCACCACGGCAAAACCCAG GCGACCAG GGAATTCAGACTGAATGGTACCGCTCGTCGCTTGGGTTTTACCGT GCATAGATT GGAATTCGCGCAACACGATGAAGCTCAA AGGGATCCTTATAGTTCGCGACGACGTCC

The restriction enzyme sites are indicated by underlines. The sequence for six histidine is shown in italic.

prevent non-specific binding. Then, anti-AFB1 antibody (50 mg/mL) was loaded to the cProG layer for 15 min and rinsed with PBS. The SPR responses are denoted in resonance units (RUs), where 1 RU represents the binding of approximately 1 pg biomolecule/mm2 (Schmid et al, 2006). All sensorgrams were fitted globally using BIA evaluation software. 2.4. SPR imaging (SPRi) analysis Gold was patterned onto glass slides washed with piranha solution (75% H2SO4/25% H2O2, v/v). Briefly, an AZ9260-positive photoresist (PR) (SU-8, Microchem, Newton, MA) master was made on the slide by even pouring and spin-coating at 2000 rpm for 60 s, and then the slide was cured in a convection oven at 110  C for 3 min to remove volatile organics. After slow cooling, the slide was exposed to ultraviolet (UV) light for 75 s at a temperature below 30  C. The UV-exposed slides were treated with an AZ9260 developer for approximately 5 min, resulting in removal of UVexposed PR; SU-8 negative PR was retained. Chromium and gold were sequentially deposited on the slide glass using a thermal evaporation unit, and their heights were controlled so that they were 5 nm and 40 nm, respectively. The slides were then soaked in acetone for 4 h to remove the AZ9260 PR. Finally, gold patterns (circles with diameters of 50 mm) were formed only on the developed region. All SPR imaging experiments were performed with an SPR imager apparatus (SPRi, K-MAC, Daejeon, Korea) with an incoherent light source (a 150 W quartz tungsten-halogen lamp, Schott, Mainz, Germany) that was used for excitation, as previously

186

J.H. Park et al. / Food Control 36 (2014) 183e190

reported (Tamerler, Oren, Duman, Venkatasubramanian, & Sarikaya, 2006). The gold-micropatterned slide chip was cleaned for 5 min in piranha solution and washed with distilled water. After drying with N2 gas, the chip was dipped in GBP-ProG solution (100 mg/mL) for 30 min at 25  C, followed by washing with distilled water and drying with N2 gas. The treated chip was then dipped in a solution of anti-AFB1 antibody (100 mg/mL) for 30 min at 25  C. Following the washing and drying of the chip, it was loaded onto the SPRi apparatus. A r-polarized collimated white incident light was impinged onto the chip at a specific angle. Reflected light from this chip was passed via a band-pass filter centered at a wavelength of 830 nm and collected using a CCD camera (Sony, Japan). The data images were collected digitally via a B/W frame grabber. Scion Image release Beta 4.0.3 software (Scion, Frederick, MD) was used to analyze the images. 2.5. Effects of antibody amounts on SPR responses The optimal amount (i.e., packing density) of antibody immobilized onto the SPR chip surface was determined to enhance the sensitivity of the SPR biosensor. The GBP-ProG (1.0 mg/mL) was injected into the four flow channels for 15 min, and the channels were then rinsed with PBS. BSA (500 mg/mL) was loaded onto the unused immobilization sites on the surface for 7 min in order to prevent non-specific binding. After rinsing with PBS, various concentrations (50, 100, 150, and 200 mg/mL) of anti-AFB1 antibodies were applied to each of the self-assembled GBP-ProG layers for 15 min in order to examine the effects of antibody amounts on the SPR response, followed by washing out with PBS. Finally, after AFB1 (100 mg/mL) was allowed to flow over SPR chips coated with various concentrations of anti-AFB1 antibodies for 10 min, the chip was rinsed with PBS buffer. The binding signal was monitored in real-time as an SPR sensorgram. 2.6. Sensitivity and selectivity of the GBP-ProG crosslinker-based SPR sensor for AFB1 detection Anti-AFB1 antibodies (100 mg/mL) were loaded onto the GBPProG (1.0 mg/mL) layered SPR chip for 15 min to examine the sensitivity of the GBP-ProG crosslinker-based immunosensor. Then the sensor chip was rinsed with PBS and treated with BSA for 7 min for blocking non-specific binding. AFB1 at various concentrations (0.5, 1, 5, 10, 50, and 100 mg/mL) and ZEA (control, 100 mg/mL) in PBS were applied to the chip surface and then unbound AFB1 and ZEA were then washed away with PBS. The selectivity of the GBP-ProG crosslinker-based SPR immunosensor for the detection of AFB1 was demonstrated by introducing AFB1 (target analyte) and ZEA and OTA as control toxins. In brief, each (100 mg/mL) of AFB1, ZEA, OTA, and a mixture (AFB1, ZEA, and OTA) was applied to the surface of the GBP-ProG/anti-AFB1layered SPR gold chip prepared in advance by the same method described above, followed by rinsing with PBS. Then, each sensorgram was obtained in real-time. 2.7. Food sample preparation Corn kernels without AFB1 were purchased from local markets and ground in a commercial blender at high speed for 2 min. A 5 g ground corn sample was spiked with 100 mL of AFB1 solution at concentration ranging from 0 to 20 mg/mL. The spiked corn samples were fully mixed using a vortex mixer for 2 min and extracted with 25 mL of methanol/water (70:30, v/v) by shaking on a horizontal shaker for 50 min at room temperature. Then, the samples were centrifuged for 10 min at 6000 rpm and the resulting supernatants were collected. A 2 mL of the extract was diluted five times with

PBS and then the suspension was defatted with 5 mL n-hexane by hand shaking for 10 min. The defatted solution was used for AFB1 detection by the SPR assay. The concentration of AFB1 in diluted sample extracts was determined from the ELISA calibration curve. The extracts were applied to the GBP-ProG crosslinker-based SPR immunosensor for detection of AFB1. 3. Results and discussion 3.1. Comparison of the crosslinking abilities of the GBP-ProG and alkanethiol for antibody immobilization A fusion protein comprising GBP and ProG was produced in E. coli BL21(DE3) as a bifunctional crosslinker, with the T7 promoter, for simple and oriented immobilization of antibodies on gold surfaces. The expressed GBP-ProG crosslinker was soluble. The soluble GBP-ProG could be simply purified by using a Ni-chelating resin (Novagen, USA) without further purification steps since it contains a 6-His tag. The utility of the resulting GBP-ProG crosslinker for antibody immobilization onto gold surfaces was demonstrated by comparing its crosslinking properties with those of an alkanethiol compound (11-MUA) that is interacted strongly with gold via a conventional self-assembled monolayer (SAM) method (Schmid et al, 2006). Successive binding of the GBP-ProG and anti-AFB1 antibody to the SPR gold chip surface was performed in order to demonstrate the bifunctional properties of the GBP-ProG. Meanwhile, an SAM of alkanethiol (11-MUA) was constructed on another SPR chip surface by allowing the thiol group to interact with the gold surface. After cProG as a control was coated on the resulting SAM layer, anti-AFB1 antibodies were immobilized onto the cProG layer. As shown in Fig. 3a, when the cProG was covalently immobilized onto the SAM layer formed with alkanethiol (11-MUA), the SPR signal increased sharply to 1720 RU because of rapid adsorption of cProG onto the surface, and no desorption was observed after washing with buffer. In addition, the GBP-ProG readily and gradually self-immobilized on the gold chip surface without any chemical treatment and approximately 99% of the GBP-ProG remained on the chip surface even after washing with PBS, resulting in an SPR signal of 1888 RU. This signal was slightly higher than the SPR signal (1720 RU) obtained for the cProG immobilized on the SAM layer. This result implies that the GBP-ProG binds strongly to the gold chip surface through its GBP portion that has high affinity for gold substrates, and the binding of GBP is superior to that of the established thiol-based molecule. The standard Gibbs free energy of GBP monolayer onto the gold surfaces is lower than that of the SAM of thiol compounds, which demonstrates GBP binds more strongly to the gold surface than thiol-based molecules (Tamerler et al., 2006). It is speculated that the polar groups exposed via the M, K, T, Q, and S residues in the GBP sequence and the GBP physical structure may play an important roles in its cumulative binding to the gold surface although the exact mechanism of binding remains unknown. Fig. 3b shows the SPR signals when anti-AFB1 antibodies were immobilized onto both the GBP-ProG-layered surface and cProG layer fabricated over the alkanethiol SAM. The SPR signal increased to 284 RU after the binding of anti-AFB1 antibodies onto the GBPProG layer; this signal was 36% higher than that (209 RU) observed when the antibodies bound to the cProG layer. This means the Fc portion of anti-AFB1 antibodies interacted successfully with the ProG domain of the GBP-ProG-layered chip. In this study, it was found that the GBP-ProG fusion protein could be used as an effective crosslinker for Y-shape-oriented antibody immobilization on gold substrates, a requirement in immunosensor fabrication. Thus, the GBP-ProG could be a useful

J.H. Park et al. / Food Control 36 (2014) 183e190

187

Fig. 3. Comparison between the crosslinking abilities of the GBP-ProG crosslinker and alkanethiol (11-MUA) for antibody immobilization. (a) SPR signals of a directly self-assembled GBP-ProG (1.0 mg/ml, bold line) on a gold surface and commercial recombinant ProG as a control (1.0 mg/ml, light line) covalently immobilized over the alkanethiol self-assembled monolayer on a gold surface for 15 min (b) SPR signals of anti-AFB1 antibodies (50 mg/mL) immobilized onto both of the GBP-ProG (bold line)-layered and control ProG-coated surfaces for 15 min.

alternative to the currently used chemical crosslinkers, namely, thiol-based synthetic molecules. In addition, antibody immobilization by the GBP-ProG would be more simple, rapid, and convenient method than other chemical immobilization methods. 3.2. SPRi analysis of the GBP-ProG as a crosslinker The successive bindings of the GBP-ProG and anti-AFB1 antibodies onto the gold-micropatterned chip were visually confirmed by SPRi analysis. The SPRi difference images produced by subtracting a reference image from post-binding images contributed to the visual confirmation of binding (Li, Wark, Lee, & Corn, 2006; Peelen et al., 2006). The brighter spots indicated the binding of the target proteins on the gold substrates since reflectivity increases when binding occurs. As shown in Fig. 4a, the spots obtained for samples 2 were brighter than those obtained for sample 1, indicating successful binding of the GBP-ProG to the micropatterned bare gold

surface. Subsequently, sample 3 yielded brighter spots than sample 2 after the binding of anti-AFB1 to the GBP-ProG layer. Furthermore, spot brightness is expressed as spot intensities in Fig. 4b. When the GBP-ProG specifically bound to the bare gold surface, spot intensities increased from 13.3 RU (background intensity from the bare gold) to 31.5 RU. After subsequent binding of anti-AFB1 to the resulting GBP-ProG layer, spot intensities increased further to 45.5 RU. These results also confirm that the GBP-ProG could be a useful and convenient bifunctional crosslinker for oriented selfimmobilization of antibodies on micro-sized gold surfaces via specific binding between its GBP portion and gold and ProG and the Fc domain of anti-AFB1. 3.3. Optimal density of anti-AFB1 antibody on the chip surface It is critical to optimize the amount of antibodies immobilized on a sensing surface so that immunosensors can yield the highest

Fig. 4. SPRi analysis of the successive bindings of the GBP-ProG crosslinker and anti-AFB1 antibodies onto a gold circle-micropatterned chip. (a) Three- and two-dimensional (inset) images for bare gold micropatterns (sample 1, control), binding of GBP-ProG to the gold patterns (sample 2), and successive binding of anti-AFB1 to the GBP-ProG layer (sample 3). (b) Spot intensities of the three samples.

188

J.H. Park et al. / Food Control 36 (2014) 183e190

Fig. 5. Determination of the optimal density of anti-AFB1 antibodies immobilized onto the GBP-ProG-layered SPR chip for the detection of AFB1. Various concentrations (50, 100, 150, and 200 mg/mL) of anti-AFB1 antibodies were applied to each of the selfassembled GBP-ProG layers for 15 min, and then AFB1 (100 mg/mL) was applied to the SPR chips coated with various concentrations of anti-AFB1 antibodies for 10 min.

detection signal. To obtain the optimal amount of antibodies, various concentrations (50, 100, 150, and 200 mg/mL) of anti-AFB1 were immobilized onto a GBP-ProG-layered SPR chip surface, and then AFB1 (100 mg/mL) was applied to the surface to monitor the SPR signals generated by the specific interaction between the antiAFB1 antibodies and AFB1. Fig. 5 shows the specific interaction between the anti-AFB1 layers formed with various concentrations of antibodies and subsequently loaded AFB1. A low SPR signal of 46 RU was obtained at the concentrations of anti-AFB1 of 50 mg/mL. This means that the SPR chip surfaces were immobilized with the comparatively low concentration (50 mg/mL) of the anti-AFB1, which could have resulted in insufficient interaction between the anti-AFB1 and AFB1. Furthermore, low SPR signals of 57 and 48 RU were produced at 150 and 200 mg/mL of anti-AFB1, respectively, compared to that (69 RU) obtained at the anti-AFB1 concentration of 100 mg/mL. This is because the anti-AFB1 antibodies were densely packed onto the chip surface and thus some of the antigen binding sites may have been compromised due to steric hindrance between closely neighbored anti-AFB1 (Ko, Kim, Jo, Oh, & Park, 2007). Accordingly, it was determined that the best density of anti-AFB1 immobilized onto the chip surface was 100 mg/mL. This best concentration of anti-AFB1 was also used in subsequent experiments in this study. These results demonstrate that although recognition elements such as antibodies are required to be immobilized on a sensing surface

Fig. 6. Detection of AFB1 in buffer and corn extracts by the GBP-ProG-based SPR immunosensor. (a) AFB1 at various concentrations (0.5, 1, 5, 10, 50, and 100 mg/mL) and ZEA (100 mg/ mL) in buffer were interacted with the GBP-ProG/anti-AFB1-layered gold chip surface for 15 min. (b) Each (100 mg/mL) of AFB1, ZEA, OTA, and a mixture (AFB1, ZEA, and OTA) was applied to another surface of the GBP-ProG/anti-AFB1-layered SPR gold chip for 15 min. (c) AFB1 at various concentrations (0.5, 1, 5, 10, 50, and 100 mg/mL) in corn extracts were interacted with the GBP-ProG/anti-AFB1-layered gold chip surface for 15 min.

J.H. Park et al. / Food Control 36 (2014) 183e190

with a high density, steric hindrance should be minimized for sensitive detection of target molecules. 3.4. Sensitivity and selectivity of the GBP-ProG crosslinker-based SPR immunosensor The sensitivity of the GBP-ProG crosslinker-based SPR immunosensor for detection of AFB1 was determined with the application of the best density of anti-AFB1 (100 mg/mL) obtained above. As shown in Fig. 6a, AFB1 at various concentrations (0.5, 1, 5, 10, 50, and 100 mg/mL) in buffer was interacted with the GBP-ProG/anti-AFB1layered gold chip surface. The binding SPR signal was 75 RU at the highest concentration (100 mg/mL) of AFB1 and decreased progressively until 6 RU at 1 mg/mL AFB1, whereas no SPR signal was observed with 0.5 mg/mL of AFB1 and 100 mg/mL of ZEA (a control toxin for non specific binding). These results mean that the SPR signal obtained with less than 1 mg/mL of AFB1 could not be differentiable from the control signal. Thus, the detection limit for AFB1 was determined to be 1 mg/mL. It is considered that the best density of anti-AFB1 contributes to achieving this low detection limit (Ko et al., 2007) and the GBP-ProG is a valuable crosslinker for simple and rapid immobilization of antibodies on gold surfaces. Moreover, the selectivity of the GBP-ProG crosslinker-based SPR immunosensor for detection of AFB1 was demonstrated by introducing AFB1, ZEA, and OTA alone and their mixture on the GBPProG/anti-AFB1 layered chip (Fig. 6b). The AFB1 and mixture of AFB1, ZEA, and OTA yielded SPR signals of 73 RU and 71 RU, respectively, while no signal was detected with ZEA or OTA. These findings show that AFB1 could elicit a measurable and significant response even in the aflatoxin mixture while the controls (ZEA and OTA) did not affect the response of the SPR sensor. Therefore, these results imply that the anti-AFB1-coated SPR gold chip that uses the GBP-ProG as a crosslinker for antibody immobilization permits highly sensitive and selective detection of AFB1. The GBP-ProG crosslinker-based SPR immunosensor was then applied to the detection of AFB1 in corn to test its performance in a real food matrix. Corn samples were spiked with different concentrations of AFB1 and extracted with 70% methanol in water. AFB1 at various concentrations (0.5, 1, 3, 5, 10, and 15 mg/mL) in the extracts was independently treated to the anti-AFB1 antibodies on the GBP-ProG crosslinker-based SPR sensor chip. As expected, the resulting SPR signal decreased as the concentration of AFB1 in the extracts decreased (Fig. 6c). The highest SPR signal (50 RU) was obtained at 15 mg/mL AFB1 whereas the lowest one was 4 RU at 1 mg/mL. However, there was no SPR signal at the AFB1 concentration of 0.5 mg/mL. The detection limit for AFB1 was found to be 1 mg/mL in the extracts and in accordance with that obtained in buffer. These results showed this novel SPR sensor developed here is also useful for detection of small molecules like mycotoxins in real food matrixes. 4. Conclusions In this study, the genetically engineered GBP-ProG fusion protein was used as a novel bifunctional crosslinker for effective immobilization of antibody on gold surfaces of SPR immunosensors and the GBP- for detection of AFB1. SPR analyses showed that the GBP-ProG could bind not only strongly to gold surfaces but also specifically with the Fc region of antibodies. This binding was simple, rapid, and cost effective in the absence of any chemical treatment. It is thus expected that this study can contribute to solving the longstanding problem of commercialization of biosensors since it describes an easy fabrication method of immunosensor chips and offers a useful strategy for controlling antibody immobilization in various immunoassay systems. The GBP-ProG

189

crosslinker-based SPR immunosensor with the best density of anti-AFB1 antibodies led to the highly sensitive detection of AFB1 in both buffer and real food matrix. This system will be useful for monitoring other small molecules such as antibiotics and pesticides. Acknowledgements This research was supported by the Technology Development Program for Food funded by the Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea and by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) funded by the Ministry of Science, ICT & Future Planning (MSIP), Republic of Korea (NRF-2012M3A9C7050150). This research was also supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (NRF2012R1A1A2008957). References Braun, R., Sarikaya, M., & Schulten, K. (2002). Genetically engineered gold-binding polypeptides: structure prediction and molecular dynamics. Journal of Bomaterials Science, Polymer Edition, 13, 747e757. Brown, S., Sarikaya, M., & Johnson, E. (2000). A genetic analysis of crystal growth. Journal of Molecular Biology, 299, 725e735. Dutra, R. F., & Kubota, L. T. (2007). An SPR immunosensor for human cardiac troponin T using specific binding avidin to biotin at carboxymethyldextranmodified gold chip. Clinica Chimica Acta, 376, 114e120. Franco, E. J., Hofstetter, H., & Hofstetter, O. A. (2006). A Comparative evaluation of random and site-specific immobilization techniques for the preparation of antibody-based chiral stationary phases. Journal of Separation Science, 29, 1458e1469. Gobi, K. V., Iwasaka, H., & Miura, N. (2007). Self-assembled PEG monolayer based SPR immunosensor for label-free detection of insulin. Biosensors and Bioelectronics, 22, 1382e1389. Hoffman, W. L., & O’Shannessy, D. J. (1998). Site-specific immobilization of antibodies by their oligo-saccharide moieties to new hydrazide derivatized solid supports. Journal of Immunological Methods, 112, 113e120. Khayoon, W. S., Saad, B., Yan, C. B., Hashim, N. H., Ali, A. S. M., & Salleh, M. I. (2010). Determination of aflatoxins in animal feeds by HPLC with multifunctional column clean-up. Food Chemistry, 118, 882e886. Ko, S., Kim, B., Jo, S.-S., Oh, S. Y., & Park, J.-K. (2007). Electrochemical detection of cardiac troponin I using a microchip with the surface-functionalized poly(dimethylsiloxane) channel. Biosensors and Bioelectronics, 23, 51e59. Ko, S., Park, T. J., Kim, H. S., Kim, J. H., & Cho, Y. J. (2009). Directed self-assembly of gold binding polypeptide-protein A fusion proteins for development of gold nanoparticle-based SPR immunosensors. Biosensors and Bioelectronics, 24, 2592e2597. Krska, R., & Molinelli, A. (2007). Mycotoxin analysis: state-of-the-art and future trends. Analytical and Bioanalytical Chemistry, 387, 145e148. Li, Y., Wark, A. W., Lee, H. J., & Corn, R. M. (2006). Single nucleotide polymorphism genotyping by nanoparticle-enhanced surface plasmon resonance imaging measurements of surface ligation reactions. Analytical Chemistry, 78, 3158e3164. Mayer, Z., Färber, P., & Geisen, R. (2003). Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Applied and Environmental Microbiology, 69, 1154e1158. Mizuta, Y., Onodera, T., Singh, P., Matsumoto, K., Miura, N., & Toko, K. (2008). Development of an oligo(ethylene glycol)-based SPR immunosensor for TNT detection. Biosensors and Bioelectronics, 24, 191e197. Oh, B. K., Kim, Y. K., Park, K. W., Lee, W. H., & Choi, J. W. (2004). Surface plasmon resonance immunosensor for the detection of Salmonella Typhimurium. Biosensors and Bioelectronics, 19, 1497e1504. Park, T. J., Hyun, M. S., Lee, H. J., Lee, S. Y., & Ko, S. (2009). A self-assembled fusion protein-based surface plasmon resonance biosensor for rapid diagnosis of severe acute respiratory syndrome. Talanta, 79, 295e301. Patel, P. (2004). Mycotoxin analysis: current and emerging technologies. In N. Magan, & M. Olsen (Eds.), Mycotoxins in food: Detection and control (pp. 105e 127). Cambridge: Woodhead. Peelen, D., Kodoyianni, V., Lee, J., Zheng, T., Shortreed, M. R., & Smith, L. M. (2006). Specific capture of mammalian cells by cell surface receptor binding to ligand immobilized on gold thin films. Journal of Proteome Research, 5, 1580e1585. Pei, R., Yang, X., & Wang, E. (2001). Enhanced surface plasmon resonance immunosensing using a streptavidin-biotinylated protein complex. Analyst, 126, 4e6. Schmid, A. H., Stanca, S. E., Thakur, M. S., Thampi, R. K., & Suri, C. R. (2006). Sitedirected antibody immobilization on gold substrate for surface plasmon resonance sensors. Sensors and Actuators B, 113, 297e303.

190

J.H. Park et al. / Food Control 36 (2014) 183e190

Souto, D. E., Sliva, J. V., Martins, H. R., Reis, A. B., Luz, R. C., Kubota, L. T., et al. (2013). Development of a label-free immunosensor based on surface plasmon resonance technique for the detection of anti-Leishmania infantum antibodies in canine serum. Biosensors and Bioelectronics, 15, 22e29. Squire, R. A. (1981). Ranking animal carcinogens: a proposed regulatory approach. Science, 214, 877e880. Subramanian, A., Irudayaraj, J., & Ryan, T. (2006). A mixed self-assembled monolayer-based surface plasmon immunosensor for detection of E. coli O157:H7. Biosensors and Bioelectronics, 21, 998e1006.

Sun, Y., Bai, Y., Song, D., Li, X., Wang, L., & Zhang, H. (2007). Design and performances of immunoassay based on SPR biosensor with magnetic microbeads. Biosensors and Bioelectronics, 23, 473e478. Tamerler, C., Oren, E. E., Duman, M., Venkatasubramanian, E., & Sarikaya, M. (2006). Adsorption kinetics of an engineered gold binding peptide by surface plasmon resonance spectroscopy and a quartz crystal microbalance. Langmuir, 22, 7712e7718. Zhu, H., & Snyder, M. (2003). Protein chip technology. Current Opinion in Chemical Biology, 7, 55e63.