- Email: [email protected]
Rapid detection of cymbidium mosaic virus by the polymerase chain reaction (PCR)
Journal of Virological Methods, 41 (1993) 3146 c 1993 Elsevier Science Publishers B.V. / All rights VIRMET
37 reserved
/ 0166-0934/93/$05.00
01425
Rapid detection of cymbidium mosaic virus by the polymerase chain reaction (PCR) S.T. Lim, S.M. Wong, C.Y. Yeong,
SC. Lee and C.J. Goh
Department of Botany, National Universit? of Singapore, Kmt Ridge, Singapore, (Singapore) (Accepted
28 July
1992)
Summary A direct, simple and sensitive method was developed for the detection of cymbidium mosaic virus (CyMV), based on the polymerase chain reaction (PCR). Two oligonucleotide primers were selected from regions that are homologous to potexviruses and CyMV, and used to hybridize with purified viral RNA and particles. This resulted in the amplitication of a 313 bp fragment after 30 cycles of PCR in all samples. A less prominent fragment of 227 bp was also obtained due to mispriming of the second primer. The amplified fragments were easily seen in an agarose gel when stained with ethidium bromide. As little as 1 fg of viral RNA (about 200 target copies) or 10 fg of purified virus (approximately 130 viral particles) were detectable. For CyMV infected orchid leaf tissues, 10 ~1 aliquots of 1 mm3 tissue homogenate in 1 ml could be detected routinely. All reverse transcription and amplification reactions were carried out in a single tube and results can be obtained within 5 h. Cymbidium
mosaic
virus; Polymerase
chain reaction
Introduction Cymbidium mosaic virus (CyMV) is the most prevalent, among the 25 viruses reported to infect orchids (Zettler et al., 1990). Infected flowers often show necrotic streaks and spots, rendering them of no commercial value as Correspondence to: Singapore
S.M. Wong, 05 11, Singapore.
Department
of Botany,
National
University
of Singapore,
Kent Ridge,
38
export cut-flowers. Moreover, the growth of the plant is much inhibited (Pearson and Cole, 1986) affecting the flower yield. In some cases, infected plants show no obvious symptoms. The use of top cuttings and large shoot tips from these CyMV-infected plants for rapid micropropagation of elite orchid cultivars often leads to mass production of virus-infected plants. Therefore, visual symptoms cannot be used reliably as a diagnostic method. Many reliable techniques have been developed over the years for the detection of viruses in orchids (Lawson and Brannigan, 1986). Bioassay techniques have been widely used for many years to index orchids for virus infection. With Cassia occidentalis L., a frequently used indicator plant, large necrotic local lesions can be seen within 3 days after mechanical inoculation of sap from CyMV-infected orchids. Transmission electron microscopy (TEM) has also been used to examine the presence of viruses from sap of infected plants. However, such a facility is not readily or commonly available. Serological techniques, such as the agar gel diffusion and the enzyme-linked immunosorbent assay method (ELISA), are currently used in routine diagnosis of plant virus infections. Polymerase chain reaction (PCR), which allows the amplification of very low amounts of target nucleic acids (Saiki et al., 1985, 1988), has been successfully used to detect very low amounts of viral nucleic acids (Jones et al., 1991; Wetzel et al., 1991). In this study, a CyMV detection method is described based on PCR. It is an easy technique to use, and yields results within 5 h.
Materials and Methods Templates CyMV particles were purified from infected Cattle_va ‘Bowbells’ according to the method of Frowd and Tremaine (1977). The viral RNA was phenolchloroform extracted (Steinhart and Oshiro, 1990). Plasmid pCYM46 (Neo et al., 1992), containing the CyMV PCR target sequences, was also used. Primers Two oligonucleotide primers were selected from the predicted homologous regions of the potexviruses and CyMV sequence (Neo et al., 1992). Both were custom-made by Promega Inc. Primer 1 was a 20-mer oligonucleotide, STTTGCCGCCTTTGACTTCTT-3’, located at position 1174 to 1193 of pCYM46. The amino acid sequence corresponding to this region was reported to be conserved in several potexviruses (Harbison et al., 1988, Jelkmann et al., 1990). Primer 2 was a 20-mer oligonucleotide, S-ATTTAAGCTGGCTAAGTATA-3’, located at position 1467 to 1486 of pCYM46 in the conserved CyMV non-coding region.
39
First strand cDNA synthesis The first strand cDNA synthesis was done according to the protocol supplied with Moloney Murine Leukaemia Virus RNase Hreverse transcriptase (M-MLV H- RT) (Gibco-BRL). Briefly, the desired amount of CyMV RNA and 16 pmol primer 2 were diluted to 7 ~1, heated at 70°C for 10 min and quick-chilled on ice. Ten microlitres of reverse transcription mixture, giving final concentrations of 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgC12, 10 mM DTT, 0.5 mM dNTPs (Perkin Elmer Cetus) and 1 unit of rRNasinK‘) ribonuclease inhibitor (Promega) were added. After 2 min incubation at 37°C 3 ~1 of M-MLV H RT at 1 U/$ was added into each reaction tube to give a final volume of 20 ~1. Reaction tubes were incubated at 37°C for 1 h. When CyMV particles were used, the preliminary heating at 70°C for 10 min was omitted. PCR assays Eighty microlitres of PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl& containing 50 pmol primer 1, 25 pmol primer 2 and 2.5 U of TaqDNA Polymerase (Perkin Elmer Cetus) were added to each 0.5 ml GeneAmp reaction tube, and covered with 1 drop of mineral oil. The cDNA was then amplified with a programmable DNA Thermal Cycler (Perkin Elmer Cetus). The PCR programme was defined as denaturation at 94°C for 1 min, annealing at 60°C for 1 min, DNA extension at 72°C for 1 min, for 30 cycles. In the 30th cycle, the time of extension at 72°C was 5 min. Plasmid pCYM46, purified CyMV RNA and purified CyMV particles were used to determine the sensitivity of the assay. The optimal plant extract dilution for maximum sensitivity of the assay was determined by adding 2 ng of CyMV RNA or 2 pg of CyMV particles to virus-free orchid (Dendrobium crumenatum SW.) leaf extract at lo’, IO’, 106, lo9 and lo’* times dilutions. This was tested on leaf extracts (1 mm3 in 1 ml aqueous leaf homogenate) from orchids grown from pots and from tissue culture flasks. Healthy orchid leaf extract and sterile diethylpyrocarbonate (DEPC)-treated water were used as negative controls. For plasmid, reverse transcription was not required and MgC12 concentration was fixed at 1.5 mM, annealing temperature at 50°C and dNTPs at 0.2 mM. Amplification reactions were analysed by electrophoresis of a 20-~1 aliquot from each reaction mixture on a 2.0% agarose gel in TAE buffer (Sambrook et al., 1982). Bands were visualised after soaking for 15 min in ethidium bromide (1 ng/,nl) and destaining in water for 15 min. The 1 kb DNA ladder (GibcoBRL) was used as molecular weight markers.
a2
3456
313 227 60
bP bP
bP
Fig. 1. Determination of optimal MgClz concentration for CyMV PCR assay by analysis of PCR-amplified fragments from 1 ng of purified CyMV RNA on a 2.0% agarose gel. Lane 1: 1 kb DNA ladder; Lane 2: 0.5 mM: Lane 3: 1.0 mM: Lane 4: 1.5 mM; Lane 5: 2.S mM; Lane 6: 4.0 mM MgQ.
Results
At low M&l2 concentration (1.0 mM or less), no visible PCR fragment was amplified. At 1.5 mM MgClz and above, both the 313 bp and 227 bp PCR fragments were amplified. The intensity of the bands was strongest at 2.5 mM MgQ, but at 4.0 mM MgQ, an additional ampli~ed fragment, estimated to be 60 bp, was observed (Fig. 1). Three bands were observed at annealing temperatures of 50°C and 55”C, whereas at 6O”C, only two bands were present, one at 3 13 bp and the other at 227 bp. At 65”C, no visible bands were observed. No additional dNTPs was required in the PCR reaction mixture to generate prominent PCR amplified bands.
41
1
2
3456
7
313 227
bP bP
Fig. 2. Analysis of the detection limit of PCR on purified CyMV particles on a 2.0% agarose gel. Lane 1: 1 kb DNA ladder; Lane 2: 1 pg; Lane 3: I ng: Lane 4: 1 pg; Lane 5: IO fg; Lane 6: I fg; Lane 7: sterile DEPCtreated water.
Sensitivity
oj’ the PCR assay
After 30 cycles of PCR, an expected 313 bp fragment was amplified, sometimes together with a shorter 227 bp fragment. When pCYM46 was used as template, only a 313 bp fragment was amplified. When CyMV RNA was used, there was a visibly less intense 3 13 bp fragment and a more intense 227 bp fragment. When CyMV particles were used, PCR yielded a visibly more intense 313 bp fragment and a less intense 227 bp fragment. Such bands were not detected in the negative controls using virus-free orchid extract and sterile DEPC-treated water. Using the PCR conditions described above, as little as 1 pg of purified pCYM46, corresponding to 2 x lo5 target DNA copies per assay, was detected. One femtogram (fg) of CyMV RNA, that is 200 target RNA copies, was detected after PCR amplification. Ten fg of CyMV particles, equivalent to 130 virus particles, was also detected (Fig. 2). For both CyMV
42
PBS 1 1174
MS 1193
1361
mm
TTTGCCGCClTTGACTTCTT
I
227bp
1467
WCCCC
I
I I 4 I
PBS 2 1400
I I +’ 313bD
1466
TATACTTAGCCAGCTTAAAT
ooat protdn
;
pCYM46
I I I I
Fig. 3. Nucleotide sequence on pCYM46, indicating the 2 primer binding sites (PBS 1 and PBS 2). and the misprimed site (MS). The boxed regions represent the sequences homologous to the primer 2 binding site sequences.
RNA and particles, 106- to 109-fold dilutions of virus-free orchid leaf extracts were found to be optimum for CyMV detection. A lo-p1 aliquot from a l-mm3 orchid leaf tissue homogenate in 1 ml water was sufficient to yield an intense PCR fragment in the PCR reaction. Analyses of the PCR products Southern blot hybridization, using the enhanced chemilluminescent (ECL)labelled pCYM46 probe, demonstrated that both the 3 13 bp and 227 bp fragments contained CyMV sequences. Treatment of CyMV RNA with 10 mM methyl mercury (II) hydroxide prior to PCR did not yield different results compared to CyMV RNA without the treatment. After Rsal restriction, the 313 bp PCR fragment yielded the expected 201 bp and 112 bp fragments, whereas the 227 bp PCR fragment yielded two approximately 110 bp fragments. For BsmI restriction, the 313 bp PCR fragment yielded a 249 bp fragment and a 64 bp fragment, while the 227 bp PCR fragment yielded a 163 bp fragment and a 64 bp fragment. For FspI restriction, the 313 bp PCR fragment gave a 218 bp and a 95 bp fragment, and the 227 bp PCR fragment gave a 135 bp and a 95 bp fragment. The PCR fragments were cloned into pBluescript II SK (+) plasmid (Stratagene) and sequenced with the sequencing systems (Promega) to confirm the sequences of the TaqTrack’” two amplified fragments. Sequencing results showed firstly, that the sequence of the 313 bp PCR fragment matched exactly the target sequence to be amplified; secondly, the nucleotide sequence of primer 2 partially matched an upstream nucleotide sequence, 5’-TATGCTCTGCCTGCACCCCC-3’, in the coat protein gene region (Fig. 3), resulting in a 227 bp PCR amplified fragment.
43
Discussion Polymerase chain reaction is a simple, fast and highly sensitive method for the detection of CyMV. To adapt the PCR protocol for the detection of CyMV, reverse transcription of the viral RNA was necessary. As this requires different conditions from the amplification, it was performed in a small volume of 20 ~1. The subsequent PCR assay was modified to enhance its sensitivity in detecting CyMV, by optimizing the M&l2 concentration, annealing temperature and dNTPs concentration. The optimum MgC12 concentration for this PCR assay is 2.5 mM. At lower concentrations, the PCR fragments were not generated. This could be due to the lack of free magnesium ions which are required for the Taq DNA polymerase activity (Innis and Gelfand, 1990). At higher concentrations an additional amplified fragment, estimated to be a trimer, was observed (Fig. 1). This may be due to accumulation of primer-dimer and primer-trimer artefacts, or non-specific amplified products, due to excess magnesium in PCR assays (Saiki, 1989; Innis and Gelfand, 1990). Based on the calculations (Thein and Wallace, 1986) of the number of purines and pyrimidines in the 2 primers we used, the optimum annealing temperature for the primers and templates is 50°C. However, at both 50°C and 55°C 3 PCR fragments were amplified. At 60°C two bands, the 313 bp and 227 bp fragments, were amplified. This is probably due to the higher annealing temperature which enhances discrimination against incorrectly annealed primers and reduces mis-extension of incorrect nucleotides at the 3’-end of the primers (Innis and Gelfand, 1990). The absence of amplified bands at 65°C is probably due to the unfavourable condition for primer-template annealing. We found that the dNTPs remaining in the assay after reverse transcription was sufficient for subsequent PCR amplification. Low dNTP concentration minimizes mispriming at non-target sites and reduces the likelihood of extending mis-incorporated nucleotides, which is one of the often encountered problems of PCR (Innis et al., 1988; Ehlen and Dubeau, 1989). As such, it is advisable to use as little dNTPs as possible for the assays. Southern blot hybridisation result showed that the 3 13 bp and 227 bp PCR fragments were of CyMV origin. The presence of either one of the fragments can be used to indicate the presence of CyMV. Based on the sequencing data of pCYM46 (Neo et al., 1992) the expected amplified fragment is 3 13 bp in length. However, due to high C + G content within the 3 13 bp region, it was suspected that the 227 bp fragment was identical to the 3 13 bp fragment with a deleted 86 bp loop. Hence, prior to reverse transcription of CyMV RNA, we attempted to denature any RNA secondary structures by using methyl mercury (II) hydroxide (Wade-Evans et al., 1990; Wetzel et al., 1991). However, the extra 227 bp fragment was still present. Restriction mapping with FspI, BsmI and RsaI demonstrated no loop formation in both the 3 13 bp and 227 bp PCR fragments. Direct sequencing of the amplified 313 bp and 227 bp fragments with their respective primers did not result in specific sequence patterns.
44
Therefore, we cloned the two PCR fragments into pBluescript’R to facilitate nucleotide sequencing. When the DNA sequence of the cloned 313 bp CyMV fragment was aligned with the PCR sequence designed to be amplified, they matched exactly. The cloned 227 bp fragment possessed the same nucleotide sequence at the 5’ end, but with a deletion of 86 bp in the 3’ nucleotide sequence, due to mispriming of the primer 2 to a partially homologous site in the coat protein region of CyMV (Fig. 3). This region has 12 complimentary CG and A-T pairs that can bind with the primer 2. Mispriming phenomena have been frequently reported (Petruska et al., 1988; Keohavong and Thilly, 1989; Ennis et al., 1990; Kwok et al., 1990; Jones et al., 1991). The efficiency with which the polymerase extends from a mismatched primer-template duplex affects the yield of the wanted PCR product. Once extension from a mismatched primer occurs, the resultant product and the complement synthesized in subsequent cycles will fully match with both primers. Based on the sequence analysis program for VAX (Devereux et al., 1984) PBS 2 is likely to be involved in hairpin loop formations. Therefore, prior to denaturation of CyMV RNA at 70°C primer 2 readily binds to MS, which has no secondary hairpin loop, to form more 227 bp PCR fragments. Some primer 2 also binds to PBS 2, as primer 2 was custom-made to match PBS 2, yielding the 313 bp PCR fragment. For CyMV particles, the existing coat protein subunits possibly bind tightly to MS. Hence, primer 2 probably has to bind to PBS 2 and results in the amplification of more 313 bp than the 227 bp fragment. Since the mispriming occurs at the reverse transcription step, pCYM46 was not affected. In conclusion, the ability of this PCR test to detect down to fg of CyMV RNA and particles makes it currently the most sensitive CyMV diagnostic test. The dilution end point for detection of CyMV in crude sap from infected orchids by ELISA, immunosorbent electron microscopy (ISEM), dot blot immunoassay (DBIA) and tissue blot immunoassay (TBIA) ranged from 1:400 to 1:3200 (Hsu et al., 1992) as compared to at least 1:lOOOOOin the PCR test. Boulvain et al. (1986) reported the sensitivity of ELISA detection for CyMV was 3.5 ng. The detection sensitivity of plant viruses using cDNA probe was reported to be in the range of 0.6 to 3.0 ng for potato virus X (Rouhiainen et al., 1991). The threshold of detection of PCR for plum pox potyvirus was 2000 viral particles per assay in healthy peach extracts. This is 25 times lower when compared to molecular hybridization using cDNA probes and 5000 times lower compared to ELISA test (Wetzel et al., 1991). PCR makes an ideal test for screening CyMV infection in tissue culture protocorms and plantlets at an early stage, prior to mass propagation in commercial applications. CyMV infection in orchids can be routinely detected at a much lower concentration and at an earlier stage than was previously possible. PCR is relatively environmentally safe, as no radioactive chemical is used. The programmable amplification procedure is fully automated, and as many as 48 to 96 samples can be tested at any one time. It is straightforward as all the reactions were carried out in the same tube and results can be obtained within 5 h.
45
Acknowledgements We thank the National under Grant RP 3910399.
University
of Singapore
for funding
this research
References Boulvain, A., Hainaut, P., Francois, C. and Calberg-Bacq, CM. (1987) Cymbidium infections with tobacco mosaic virus and Cymbidium mosaic virus: quantitative methods of detection, Arch. Int. Physiol. Biochim. 95, B61. Devereux, J., Haeberh, P. and Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387-395. Ehlen, T. and Dubeau, L. (1989) Detection of ras point mutations by polymerase chain reaction using mutation-specific, inosine-containing oligonucleotide primers. Biochem. Biophys. Res. Commun. 160, 441447. Ennis, P.D., Zemmour, J., Salter, R.D. and Pdrham, P. (1990) Rapid cloning of HLA-A,B cDNA by using the polymerase chain reaction: frequency and nature of errors produced in amplification. Proc. Natl. Acad. Sci. USA 87, 2833-2837. Frowd, J.A. and Tremaine, J.H. (1977) Physical, chemical and serological properties of cymbidium mosaic virus. Phytopathology 67, 4349. Harbison, S.A., Forster, R.L.S., Guildford, P.J. and Gardner, R.C. (1988) Organization and interviral homologies of the coat protein region of white clover mosaic virus. Virology 162, 4599 465. Hsu, H.T., Vongsasitorn, D. and Lawson, R.H. (1992) An improved method for serological detection of cymbidium mosaic potexvirus infection in orchids. Phytopathology 82, 491495. Innis, M.A. and Gelfand, D.H. (1990) Optimization of PCRs. In: M.A. lnnis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR protocols: a guide to methods and applications. Academic Press, Inc., San Diego, CA. pp. 3312. Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.D. (1988) DNA sequencing with Thermus uquuticus DNA polymerase and direct sequencing of polymerase chain reactionamplified DNA. Proc. Natl. Acad. Sci. USA 85, 94369440. Jelkmann, W., Martin, R.R., Lesemann, D.E., Vetten, H.J. and Frank, S. (1990) A new potexvirus associated with strawberry mild yellow edge disease. J. Gen. Virol. 71, 1251-1258. Jones, T.D., Buck, K.W. and Plumb, R.T. (1991) The detection of beet western yellow virus and beet mild yellowing virus in crop plants using the polymerase chain reaction. J. Virol. Methods 35, 287-296. Keohavong, P. and Thilly, W.G. (1989) Fidelity of DNA polymerases in DNA amplification. Proc. Natl. Acad. Sci. USA 86, 9253-9257. Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Coda, L., Levenson, C. and Sninsky, J.J. (1990) Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type I model studies. Nucleic Acids Res. 18, 999.-1005. Lawson, R.H. and Brannigan, M. (1986) Virus diseases of orchids. In: Handbook on orchid pests and diseases. Revised edition. American Orchid Society, USA. pp. 2-49. Neo, K.K., Wong, S.M. and Wu, M. (1992) Nucleotide sequence and in vitro translation of the coat protein gene of cymbidium mosaic virus. Virus Genes, in press. Pearson, M.N. and Cole, J.S. (1986) The effects of cymbidium mosaic virus and odontoglossum ringspot virus on the growth of cymbidium orchids. J. Phytopathol. 117, 1933197. Petruska, J., Goodman, M.F., Boosalis, MS., Sowers, L.C., Chaejoon, C. and Tinoco, I., Jr. (1988) Comparison between DNA melting thermodynamics and DNA polymerase fidelity. Proc. Natl. Acad. Sci. USA 85, 6252-6256. Rouhiainen, L., Laaksonen, M., Karjalainen, R. and Soderlund, H. (1991) Rapid detection of a
46 plant virus by solution hybridisation using ohgonucleotide probes. J. Viral. Methods 34, 81-90. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B.. Horn, G.T., Ehrlich, H.A. and Arnheim, N. (1985) Enzymatic amplification of fi-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia. Science 230, 1350-l 354. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Ehrlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239. 48749 I Saiki, R.K. (1989) The design and optimization of the PCR. In: H.A. Erlich (Ed). PCR technology: principles and applications for DNA amplification. Stockton Press, USA, pp. 7- 16. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Gel electrophoresis of DNA. In: Molecular Cloning. A laboratory Manual, second edition. Cold Spring Harbor Lab. Press, USA, pp. 6.2-6.62. Steinhart, W.L. and Oshiro, M.A. (1990) Gene products encoded by cymbidium mosaic virus RNA: proteins translated in vitro. Plant Science 72, 141 ~147. Thein, S.L. and Wallace, R.B. (1986) The use of synthetic oligonucleotides as specific hybridization probes in the diagnosis of genetic disorders. In: K.E. Davis (Ed). Human genetic diseases: a practical approach. IRL Press. Herndon, Virginia, pp. 33350. Wade-Evans, A.M., Mertens, P.P.C. and Bostock, C.J. (1990) Development of the polymerase chain reaction for the detection of bluetongue virus in tissue samples. J. Virol. Methods 30, 15524. Wetzel, T., Candresse, T., Ravelonandro, M. and Dunez, J. (1991) A polymerase chain reaction assay adapted to plum pox potyvirus detection. J. Virol. Methods 33. 355-365. Zettler, F.W., Ko, N.J., Wisler, G.C., Elliott. M.S. and Wong. S.M. (1990) Viruses of orchids and their control. Plant Disease 74. 621-626.
37 reserved
/ 0166-0934/93/$05.00
01425
Rapid detection of cymbidium mosaic virus by the polymerase chain reaction (PCR) S.T. Lim, S.M. Wong, C.Y. Yeong,
SC. Lee and C.J. Goh
Department of Botany, National Universit? of Singapore, Kmt Ridge, Singapore, (Singapore) (Accepted
28 July
1992)
Summary A direct, simple and sensitive method was developed for the detection of cymbidium mosaic virus (CyMV), based on the polymerase chain reaction (PCR). Two oligonucleotide primers were selected from regions that are homologous to potexviruses and CyMV, and used to hybridize with purified viral RNA and particles. This resulted in the amplitication of a 313 bp fragment after 30 cycles of PCR in all samples. A less prominent fragment of 227 bp was also obtained due to mispriming of the second primer. The amplified fragments were easily seen in an agarose gel when stained with ethidium bromide. As little as 1 fg of viral RNA (about 200 target copies) or 10 fg of purified virus (approximately 130 viral particles) were detectable. For CyMV infected orchid leaf tissues, 10 ~1 aliquots of 1 mm3 tissue homogenate in 1 ml could be detected routinely. All reverse transcription and amplification reactions were carried out in a single tube and results can be obtained within 5 h. Cymbidium
mosaic
virus; Polymerase
chain reaction
Introduction Cymbidium mosaic virus (CyMV) is the most prevalent, among the 25 viruses reported to infect orchids (Zettler et al., 1990). Infected flowers often show necrotic streaks and spots, rendering them of no commercial value as Correspondence to: Singapore
S.M. Wong, 05 11, Singapore.
Department
of Botany,
National
University
of Singapore,
Kent Ridge,
38
export cut-flowers. Moreover, the growth of the plant is much inhibited (Pearson and Cole, 1986) affecting the flower yield. In some cases, infected plants show no obvious symptoms. The use of top cuttings and large shoot tips from these CyMV-infected plants for rapid micropropagation of elite orchid cultivars often leads to mass production of virus-infected plants. Therefore, visual symptoms cannot be used reliably as a diagnostic method. Many reliable techniques have been developed over the years for the detection of viruses in orchids (Lawson and Brannigan, 1986). Bioassay techniques have been widely used for many years to index orchids for virus infection. With Cassia occidentalis L., a frequently used indicator plant, large necrotic local lesions can be seen within 3 days after mechanical inoculation of sap from CyMV-infected orchids. Transmission electron microscopy (TEM) has also been used to examine the presence of viruses from sap of infected plants. However, such a facility is not readily or commonly available. Serological techniques, such as the agar gel diffusion and the enzyme-linked immunosorbent assay method (ELISA), are currently used in routine diagnosis of plant virus infections. Polymerase chain reaction (PCR), which allows the amplification of very low amounts of target nucleic acids (Saiki et al., 1985, 1988), has been successfully used to detect very low amounts of viral nucleic acids (Jones et al., 1991; Wetzel et al., 1991). In this study, a CyMV detection method is described based on PCR. It is an easy technique to use, and yields results within 5 h.
Materials and Methods Templates CyMV particles were purified from infected Cattle_va ‘Bowbells’ according to the method of Frowd and Tremaine (1977). The viral RNA was phenolchloroform extracted (Steinhart and Oshiro, 1990). Plasmid pCYM46 (Neo et al., 1992), containing the CyMV PCR target sequences, was also used. Primers Two oligonucleotide primers were selected from the predicted homologous regions of the potexviruses and CyMV sequence (Neo et al., 1992). Both were custom-made by Promega Inc. Primer 1 was a 20-mer oligonucleotide, STTTGCCGCCTTTGACTTCTT-3’, located at position 1174 to 1193 of pCYM46. The amino acid sequence corresponding to this region was reported to be conserved in several potexviruses (Harbison et al., 1988, Jelkmann et al., 1990). Primer 2 was a 20-mer oligonucleotide, S-ATTTAAGCTGGCTAAGTATA-3’, located at position 1467 to 1486 of pCYM46 in the conserved CyMV non-coding region.
39
First strand cDNA synthesis The first strand cDNA synthesis was done according to the protocol supplied with Moloney Murine Leukaemia Virus RNase Hreverse transcriptase (M-MLV H- RT) (Gibco-BRL). Briefly, the desired amount of CyMV RNA and 16 pmol primer 2 were diluted to 7 ~1, heated at 70°C for 10 min and quick-chilled on ice. Ten microlitres of reverse transcription mixture, giving final concentrations of 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgC12, 10 mM DTT, 0.5 mM dNTPs (Perkin Elmer Cetus) and 1 unit of rRNasinK‘) ribonuclease inhibitor (Promega) were added. After 2 min incubation at 37°C 3 ~1 of M-MLV H RT at 1 U/$ was added into each reaction tube to give a final volume of 20 ~1. Reaction tubes were incubated at 37°C for 1 h. When CyMV particles were used, the preliminary heating at 70°C for 10 min was omitted. PCR assays Eighty microlitres of PCR buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl& containing 50 pmol primer 1, 25 pmol primer 2 and 2.5 U of TaqDNA Polymerase (Perkin Elmer Cetus) were added to each 0.5 ml GeneAmp reaction tube, and covered with 1 drop of mineral oil. The cDNA was then amplified with a programmable DNA Thermal Cycler (Perkin Elmer Cetus). The PCR programme was defined as denaturation at 94°C for 1 min, annealing at 60°C for 1 min, DNA extension at 72°C for 1 min, for 30 cycles. In the 30th cycle, the time of extension at 72°C was 5 min. Plasmid pCYM46, purified CyMV RNA and purified CyMV particles were used to determine the sensitivity of the assay. The optimal plant extract dilution for maximum sensitivity of the assay was determined by adding 2 ng of CyMV RNA or 2 pg of CyMV particles to virus-free orchid (Dendrobium crumenatum SW.) leaf extract at lo’, IO’, 106, lo9 and lo’* times dilutions. This was tested on leaf extracts (1 mm3 in 1 ml aqueous leaf homogenate) from orchids grown from pots and from tissue culture flasks. Healthy orchid leaf extract and sterile diethylpyrocarbonate (DEPC)-treated water were used as negative controls. For plasmid, reverse transcription was not required and MgC12 concentration was fixed at 1.5 mM, annealing temperature at 50°C and dNTPs at 0.2 mM. Amplification reactions were analysed by electrophoresis of a 20-~1 aliquot from each reaction mixture on a 2.0% agarose gel in TAE buffer (Sambrook et al., 1982). Bands were visualised after soaking for 15 min in ethidium bromide (1 ng/,nl) and destaining in water for 15 min. The 1 kb DNA ladder (GibcoBRL) was used as molecular weight markers.
a2
3456
313 227 60
bP bP
bP
Fig. 1. Determination of optimal MgClz concentration for CyMV PCR assay by analysis of PCR-amplified fragments from 1 ng of purified CyMV RNA on a 2.0% agarose gel. Lane 1: 1 kb DNA ladder; Lane 2: 0.5 mM: Lane 3: 1.0 mM: Lane 4: 1.5 mM; Lane 5: 2.S mM; Lane 6: 4.0 mM MgQ.
Results
At low M&l2 concentration (1.0 mM or less), no visible PCR fragment was amplified. At 1.5 mM MgClz and above, both the 313 bp and 227 bp PCR fragments were amplified. The intensity of the bands was strongest at 2.5 mM MgQ, but at 4.0 mM MgQ, an additional ampli~ed fragment, estimated to be 60 bp, was observed (Fig. 1). Three bands were observed at annealing temperatures of 50°C and 55”C, whereas at 6O”C, only two bands were present, one at 3 13 bp and the other at 227 bp. At 65”C, no visible bands were observed. No additional dNTPs was required in the PCR reaction mixture to generate prominent PCR amplified bands.
41
1
2
3456
7
313 227
bP bP
Fig. 2. Analysis of the detection limit of PCR on purified CyMV particles on a 2.0% agarose gel. Lane 1: 1 kb DNA ladder; Lane 2: 1 pg; Lane 3: I ng: Lane 4: 1 pg; Lane 5: IO fg; Lane 6: I fg; Lane 7: sterile DEPCtreated water.
Sensitivity
oj’ the PCR assay
After 30 cycles of PCR, an expected 313 bp fragment was amplified, sometimes together with a shorter 227 bp fragment. When pCYM46 was used as template, only a 313 bp fragment was amplified. When CyMV RNA was used, there was a visibly less intense 3 13 bp fragment and a more intense 227 bp fragment. When CyMV particles were used, PCR yielded a visibly more intense 313 bp fragment and a less intense 227 bp fragment. Such bands were not detected in the negative controls using virus-free orchid extract and sterile DEPC-treated water. Using the PCR conditions described above, as little as 1 pg of purified pCYM46, corresponding to 2 x lo5 target DNA copies per assay, was detected. One femtogram (fg) of CyMV RNA, that is 200 target RNA copies, was detected after PCR amplification. Ten fg of CyMV particles, equivalent to 130 virus particles, was also detected (Fig. 2). For both CyMV
42
PBS 1 1174
MS 1193
1361
mm
TTTGCCGCClTTGACTTCTT
I
227bp
1467
WCCCC
I
I I 4 I
PBS 2 1400
I I +’ 313bD
1466
TATACTTAGCCAGCTTAAAT
ooat protdn
;
pCYM46
I I I I
Fig. 3. Nucleotide sequence on pCYM46, indicating the 2 primer binding sites (PBS 1 and PBS 2). and the misprimed site (MS). The boxed regions represent the sequences homologous to the primer 2 binding site sequences.
RNA and particles, 106- to 109-fold dilutions of virus-free orchid leaf extracts were found to be optimum for CyMV detection. A lo-p1 aliquot from a l-mm3 orchid leaf tissue homogenate in 1 ml water was sufficient to yield an intense PCR fragment in the PCR reaction. Analyses of the PCR products Southern blot hybridization, using the enhanced chemilluminescent (ECL)labelled pCYM46 probe, demonstrated that both the 3 13 bp and 227 bp fragments contained CyMV sequences. Treatment of CyMV RNA with 10 mM methyl mercury (II) hydroxide prior to PCR did not yield different results compared to CyMV RNA without the treatment. After Rsal restriction, the 313 bp PCR fragment yielded the expected 201 bp and 112 bp fragments, whereas the 227 bp PCR fragment yielded two approximately 110 bp fragments. For BsmI restriction, the 313 bp PCR fragment yielded a 249 bp fragment and a 64 bp fragment, while the 227 bp PCR fragment yielded a 163 bp fragment and a 64 bp fragment. For FspI restriction, the 313 bp PCR fragment gave a 218 bp and a 95 bp fragment, and the 227 bp PCR fragment gave a 135 bp and a 95 bp fragment. The PCR fragments were cloned into pBluescript II SK (+) plasmid (Stratagene) and sequenced with the sequencing systems (Promega) to confirm the sequences of the TaqTrack’” two amplified fragments. Sequencing results showed firstly, that the sequence of the 313 bp PCR fragment matched exactly the target sequence to be amplified; secondly, the nucleotide sequence of primer 2 partially matched an upstream nucleotide sequence, 5’-TATGCTCTGCCTGCACCCCC-3’, in the coat protein gene region (Fig. 3), resulting in a 227 bp PCR amplified fragment.
43
Discussion Polymerase chain reaction is a simple, fast and highly sensitive method for the detection of CyMV. To adapt the PCR protocol for the detection of CyMV, reverse transcription of the viral RNA was necessary. As this requires different conditions from the amplification, it was performed in a small volume of 20 ~1. The subsequent PCR assay was modified to enhance its sensitivity in detecting CyMV, by optimizing the M&l2 concentration, annealing temperature and dNTPs concentration. The optimum MgC12 concentration for this PCR assay is 2.5 mM. At lower concentrations, the PCR fragments were not generated. This could be due to the lack of free magnesium ions which are required for the Taq DNA polymerase activity (Innis and Gelfand, 1990). At higher concentrations an additional amplified fragment, estimated to be a trimer, was observed (Fig. 1). This may be due to accumulation of primer-dimer and primer-trimer artefacts, or non-specific amplified products, due to excess magnesium in PCR assays (Saiki, 1989; Innis and Gelfand, 1990). Based on the calculations (Thein and Wallace, 1986) of the number of purines and pyrimidines in the 2 primers we used, the optimum annealing temperature for the primers and templates is 50°C. However, at both 50°C and 55°C 3 PCR fragments were amplified. At 60°C two bands, the 313 bp and 227 bp fragments, were amplified. This is probably due to the higher annealing temperature which enhances discrimination against incorrectly annealed primers and reduces mis-extension of incorrect nucleotides at the 3’-end of the primers (Innis and Gelfand, 1990). The absence of amplified bands at 65°C is probably due to the unfavourable condition for primer-template annealing. We found that the dNTPs remaining in the assay after reverse transcription was sufficient for subsequent PCR amplification. Low dNTP concentration minimizes mispriming at non-target sites and reduces the likelihood of extending mis-incorporated nucleotides, which is one of the often encountered problems of PCR (Innis et al., 1988; Ehlen and Dubeau, 1989). As such, it is advisable to use as little dNTPs as possible for the assays. Southern blot hybridisation result showed that the 3 13 bp and 227 bp PCR fragments were of CyMV origin. The presence of either one of the fragments can be used to indicate the presence of CyMV. Based on the sequencing data of pCYM46 (Neo et al., 1992) the expected amplified fragment is 3 13 bp in length. However, due to high C + G content within the 3 13 bp region, it was suspected that the 227 bp fragment was identical to the 3 13 bp fragment with a deleted 86 bp loop. Hence, prior to reverse transcription of CyMV RNA, we attempted to denature any RNA secondary structures by using methyl mercury (II) hydroxide (Wade-Evans et al., 1990; Wetzel et al., 1991). However, the extra 227 bp fragment was still present. Restriction mapping with FspI, BsmI and RsaI demonstrated no loop formation in both the 3 13 bp and 227 bp PCR fragments. Direct sequencing of the amplified 313 bp and 227 bp fragments with their respective primers did not result in specific sequence patterns.
44
Therefore, we cloned the two PCR fragments into pBluescript’R to facilitate nucleotide sequencing. When the DNA sequence of the cloned 313 bp CyMV fragment was aligned with the PCR sequence designed to be amplified, they matched exactly. The cloned 227 bp fragment possessed the same nucleotide sequence at the 5’ end, but with a deletion of 86 bp in the 3’ nucleotide sequence, due to mispriming of the primer 2 to a partially homologous site in the coat protein region of CyMV (Fig. 3). This region has 12 complimentary CG and A-T pairs that can bind with the primer 2. Mispriming phenomena have been frequently reported (Petruska et al., 1988; Keohavong and Thilly, 1989; Ennis et al., 1990; Kwok et al., 1990; Jones et al., 1991). The efficiency with which the polymerase extends from a mismatched primer-template duplex affects the yield of the wanted PCR product. Once extension from a mismatched primer occurs, the resultant product and the complement synthesized in subsequent cycles will fully match with both primers. Based on the sequence analysis program for VAX (Devereux et al., 1984) PBS 2 is likely to be involved in hairpin loop formations. Therefore, prior to denaturation of CyMV RNA at 70°C primer 2 readily binds to MS, which has no secondary hairpin loop, to form more 227 bp PCR fragments. Some primer 2 also binds to PBS 2, as primer 2 was custom-made to match PBS 2, yielding the 313 bp PCR fragment. For CyMV particles, the existing coat protein subunits possibly bind tightly to MS. Hence, primer 2 probably has to bind to PBS 2 and results in the amplification of more 313 bp than the 227 bp fragment. Since the mispriming occurs at the reverse transcription step, pCYM46 was not affected. In conclusion, the ability of this PCR test to detect down to fg of CyMV RNA and particles makes it currently the most sensitive CyMV diagnostic test. The dilution end point for detection of CyMV in crude sap from infected orchids by ELISA, immunosorbent electron microscopy (ISEM), dot blot immunoassay (DBIA) and tissue blot immunoassay (TBIA) ranged from 1:400 to 1:3200 (Hsu et al., 1992) as compared to at least 1:lOOOOOin the PCR test. Boulvain et al. (1986) reported the sensitivity of ELISA detection for CyMV was 3.5 ng. The detection sensitivity of plant viruses using cDNA probe was reported to be in the range of 0.6 to 3.0 ng for potato virus X (Rouhiainen et al., 1991). The threshold of detection of PCR for plum pox potyvirus was 2000 viral particles per assay in healthy peach extracts. This is 25 times lower when compared to molecular hybridization using cDNA probes and 5000 times lower compared to ELISA test (Wetzel et al., 1991). PCR makes an ideal test for screening CyMV infection in tissue culture protocorms and plantlets at an early stage, prior to mass propagation in commercial applications. CyMV infection in orchids can be routinely detected at a much lower concentration and at an earlier stage than was previously possible. PCR is relatively environmentally safe, as no radioactive chemical is used. The programmable amplification procedure is fully automated, and as many as 48 to 96 samples can be tested at any one time. It is straightforward as all the reactions were carried out in the same tube and results can be obtained within 5 h.
45
Acknowledgements We thank the National under Grant RP 3910399.
University
of Singapore
for funding
this research
References Boulvain, A., Hainaut, P., Francois, C. and Calberg-Bacq, CM. (1987) Cymbidium infections with tobacco mosaic virus and Cymbidium mosaic virus: quantitative methods of detection, Arch. Int. Physiol. Biochim. 95, B61. Devereux, J., Haeberh, P. and Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387-395. Ehlen, T. and Dubeau, L. (1989) Detection of ras point mutations by polymerase chain reaction using mutation-specific, inosine-containing oligonucleotide primers. Biochem. Biophys. Res. Commun. 160, 441447. Ennis, P.D., Zemmour, J., Salter, R.D. and Pdrham, P. (1990) Rapid cloning of HLA-A,B cDNA by using the polymerase chain reaction: frequency and nature of errors produced in amplification. Proc. Natl. Acad. Sci. USA 87, 2833-2837. Frowd, J.A. and Tremaine, J.H. (1977) Physical, chemical and serological properties of cymbidium mosaic virus. Phytopathology 67, 4349. Harbison, S.A., Forster, R.L.S., Guildford, P.J. and Gardner, R.C. (1988) Organization and interviral homologies of the coat protein region of white clover mosaic virus. Virology 162, 4599 465. Hsu, H.T., Vongsasitorn, D. and Lawson, R.H. (1992) An improved method for serological detection of cymbidium mosaic potexvirus infection in orchids. Phytopathology 82, 491495. Innis, M.A. and Gelfand, D.H. (1990) Optimization of PCRs. In: M.A. lnnis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds), PCR protocols: a guide to methods and applications. Academic Press, Inc., San Diego, CA. pp. 3312. Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.D. (1988) DNA sequencing with Thermus uquuticus DNA polymerase and direct sequencing of polymerase chain reactionamplified DNA. Proc. Natl. Acad. Sci. USA 85, 94369440. Jelkmann, W., Martin, R.R., Lesemann, D.E., Vetten, H.J. and Frank, S. (1990) A new potexvirus associated with strawberry mild yellow edge disease. J. Gen. Virol. 71, 1251-1258. Jones, T.D., Buck, K.W. and Plumb, R.T. (1991) The detection of beet western yellow virus and beet mild yellowing virus in crop plants using the polymerase chain reaction. J. Virol. Methods 35, 287-296. Keohavong, P. and Thilly, W.G. (1989) Fidelity of DNA polymerases in DNA amplification. Proc. Natl. Acad. Sci. USA 86, 9253-9257. Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Coda, L., Levenson, C. and Sninsky, J.J. (1990) Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type I model studies. Nucleic Acids Res. 18, 999.-1005. Lawson, R.H. and Brannigan, M. (1986) Virus diseases of orchids. In: Handbook on orchid pests and diseases. Revised edition. American Orchid Society, USA. pp. 2-49. Neo, K.K., Wong, S.M. and Wu, M. (1992) Nucleotide sequence and in vitro translation of the coat protein gene of cymbidium mosaic virus. Virus Genes, in press. Pearson, M.N. and Cole, J.S. (1986) The effects of cymbidium mosaic virus and odontoglossum ringspot virus on the growth of cymbidium orchids. J. Phytopathol. 117, 1933197. Petruska, J., Goodman, M.F., Boosalis, MS., Sowers, L.C., Chaejoon, C. and Tinoco, I., Jr. (1988) Comparison between DNA melting thermodynamics and DNA polymerase fidelity. Proc. Natl. Acad. Sci. USA 85, 6252-6256. Rouhiainen, L., Laaksonen, M., Karjalainen, R. and Soderlund, H. (1991) Rapid detection of a
46 plant virus by solution hybridisation using ohgonucleotide probes. J. Viral. Methods 34, 81-90. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B.. Horn, G.T., Ehrlich, H.A. and Arnheim, N. (1985) Enzymatic amplification of fi-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia. Science 230, 1350-l 354. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Ehrlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239. 48749 I Saiki, R.K. (1989) The design and optimization of the PCR. In: H.A. Erlich (Ed). PCR technology: principles and applications for DNA amplification. Stockton Press, USA, pp. 7- 16. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Gel electrophoresis of DNA. In: Molecular Cloning. A laboratory Manual, second edition. Cold Spring Harbor Lab. Press, USA, pp. 6.2-6.62. Steinhart, W.L. and Oshiro, M.A. (1990) Gene products encoded by cymbidium mosaic virus RNA: proteins translated in vitro. Plant Science 72, 141 ~147. Thein, S.L. and Wallace, R.B. (1986) The use of synthetic oligonucleotides as specific hybridization probes in the diagnosis of genetic disorders. In: K.E. Davis (Ed). Human genetic diseases: a practical approach. IRL Press. Herndon, Virginia, pp. 33350. Wade-Evans, A.M., Mertens, P.P.C. and Bostock, C.J. (1990) Development of the polymerase chain reaction for the detection of bluetongue virus in tissue samples. J. Virol. Methods 30, 15524. Wetzel, T., Candresse, T., Ravelonandro, M. and Dunez, J. (1991) A polymerase chain reaction assay adapted to plum pox potyvirus detection. J. Virol. Methods 33. 355-365. Zettler, F.W., Ko, N.J., Wisler, G.C., Elliott. M.S. and Wong. S.M. (1990) Viruses of orchids and their control. Plant Disease 74. 621-626.