Rapid detection of pfmdr1 mutations in chloroquine-resistant Plasmodium falciparum malaria by polymerase chain reaction analysis of blood spots

TRANSACTION

OF THE ROYAL

SOCIETY

OP TROPICAL

MEDICI~

AND

HYGIENE

Rapid detection od pfmdti mutations in chloroquine-resistant Plasmodium falciparum malaria by polymerase chain reaction analysis of blood spots J. A. Frean’, F. M. Awad El Kariem’, D. C. Warhurst’ and M. A. Miles’ ‘Department of Medical Parasitology and ‘Malaria Reference Laboratory (Public Health Laboratory Service), London School of Hygiene and Tropical Medicine, Keppel Street, London, WCIE 7HT, UK

The rapid spreadof resistanceto antimalarialdrugsis complicatingtreatment and preventing effective disease control. This is particularly true for resistanceof Plknodium falciparum to chloroquine, which hasbeen the cheap, relatively non-toxic drug of choice for prophylaxis and therapy. Two genetic explanationsof chloroquine resistancehave been proposed, each of which may involve singlebasemutations. FOOTEet al. (1990)have suggestedthat singlebasechangesin the P. falciparum multiple drug resistancegene (pfmdrl) on chromosome5 are associated with enhancedefflux of the drug from resistant parasites.WELLEMSet al. (1990, 1991) have evidence, however, that rapid efflux 1s governedprimarily by a singlelocuson chromosome7. Here we describea rapid, simplemethod of detecting mutationsusingpolymerasechain reaction(PCR) analysisof blood spotscollectedon glassfibre membranes.We

PCR754

(1992)

86, 29-30

29

have appliedthe procedureto two mutationsthat FOOTE et al. (1990) have putatively linked to resistance. One of the singlebasechangeslinked by FOOTEet al. (1990) to a chloroquine-resistantphenotype is at the pfmdrl nucleotide 754 (A to T), which results in an alteration from Asn86to Tyr86 (associatedwith resistance). In scanningpolymorphic pfmdrl sequencesfor restriction siteswe observedthat the putative resistant mutant is defined by the appearanceof an Nspl restriction site. Similarly24tchangeat nucleoti$f44234(G (resisto T), converting Asp (sensitive)to Tyr tant)! is defined by the appearanceof an EcoRV restriction site. The unique PCR primers ATGGGTAAAGAGCAGAAAGAG and TTACATCCATACAATAACTTG were selectedto flank nucleotide754 (aminoacid 86) and sDana DredictedPCR Droduct of 355 nucleotides(‘PCR f54’: pig. 1, upper- panel). Similarly the primers GTGGAAAATCAACTTTTATGA and TTAGGTTCTCTTAATAATGCT flank nucleotide4234iamino acid 1246) and span a predicted PCR product bf 499 nucleotides(‘PCR 4234’: Fig. 1, lower panel). Deoxyribonucleicacid (DNA) waspreparedfrom a chloroquineresistant strain of P. falciparum (Kl from south-east Asia) by saponinlysisof infectederythrocytes, proteinase K digestionand phenol/chloroformextraction (ROBSON & JENNINGS,1991). PCR reactions were run with 0.01-0.1 pg of template DNA, concentrationsof 24 FM for eachprimer and 1.5-2.5 mM Mp2+!at 94°Cfor 45 set (cycle 1,2 min 30 set), 47°Cfor 1 mm, and72°C for 3 min (cycle 37, 10 min) for 37 cyclesin a Hybaid@ thermal reactor. Nspl digestion of product PCR 754 prepurified by Centricon 30@(Amicon) ultrafiltration (SAMBROOKet al., 1989) revealed predicted digest products of approximately 255 and 100basepairs(bp), with someundigestedPCR product (Fig. 2, A). Control

(STRAIN

Kl)

ATGGGTAAAGAGCAGAAAGTGGTAACCTCAGTATCAAAGAAGAGGTTGAAAAAG AGTTGAAC AAAAAGAGTACCGCTGAATTATTTAGAAAAATAAAGAATGAGAAAATATCATTTTT TTTACCGTTTAAATGTTTACCTGCACAACATAGAAAATTATTATTTATATCATTTGTATGTGCT

ATTATCAATGATATCAAGTTATTGTATGGATGTA.& PCR 4234

ATTATATTW

(STRAIN

7G8)

TGATATGACAAATTTTCAAGATTATCAAAATAATAATAATAATTTGGTTTT

AAAAAATGTAAATGAATTTTCAAACCAATCTGGATCTGCAGAAGATTATACTGTATTTAATAATA

TTTTCAATAGTTAGTCAAGACCCATGTTATTTAATATTTTGG

CAAAAACAGAGAATAGCTATAGCTAGAGCATTATTAAGAGAACCTAA Fig. 1. Upper panel, sequence of PCR 754 from strain Kl, showing the stretches of sequence on which the primers were based (underlined) and the Nspl restriction site (in the middle of the sequence, underlined and with the mutant nucleotide 754 (A to T) in bold type). Lower panel, sequence of PCR 4234 from strain 7G8, as above but EcoRV restriction site underlined in the middle of the sequence with the mutant nucleotide 4234 (G to T) in bold type.

This method of sequentialprocessingof whole blood spots,performanceof the PCR, and detectionof mutant restriction sites is a valuable and simple procedure. Samplescollected from patients using a minimally invasive technique(blood spots)can be usedfor extensive hospitalor field surveysof the relationshipbetween mutationsin pfmdrl, or indeedbetweenother mutations, and chloroquineresistance,or other drug-resistantphenotypes. Acknowledgements

We thank the WHOiUNDPWorld Bank Special Programme for Research and Training in Tropical Diseases, the Overseas Development Administration, the British Council, and the Sir Halley Stewart Trust for financial support. J.A.F. was funded by an LSHTM Tropical Medicine Scholarship, the S. African Institute for Medical Research, and Witwatersrand University. F.M.A.E.K. is in receipt of an ORS Award. We thank Dr K. J. Robson for advice on DNA extraction and Professor D. Wirth for supplying probes. References

Fig. 2. A. Track 1: Nspl digestion products of PCR 754, strain Kl; undigested material visible. (Numbers indicate base pairs.) Track 2: blank. Track 3: Lambda size standards(BRL). B. Track 1: Lambda size standards.Track 2: EcoRV digestion products of PCR 4234, strain 7G8. Track 3: PCR 4234, strain Kl, not cleaved by EcoRV. (Numbers indicate base pairs.) Rsal digestionof PCR product showedpredicted bands

at approximately 81 and 230 bp (not shown). The identity of the amplified fragment was confirmed b g direct DNA sequencingusing both the Sequenase (CASANOVA et al., 1990) and dimethylsulphoxide methods(WINSHIP,1989) (not shown). Iron porphyrin compoundsderived from haemoglobin are extremely potent inhibitors of the PCR (MERCIER et al., 1990).We have found that wholehumanblood spots collectedon glassfibre membranes(Flow Laboratories) retainmalarialDNA after lvsisandwashineon a sintered vacuumfilter to removeblood proteins.Theseprovide a highly sensitivesolid substratefor PCR amplification (WARHURST etal., 1991).To test whetherthe analysisfor mutations could be performed on blood spots we subjectedglassfibre preparationsof anotherchloroquineresistantstrain, 7G8 from South America, and strain Kl to PCR asdescribedaboveusingprimersfor PCR 4234. EcoRV digestionof purified PCR 4234from strain 7G8 revealed a digest product of approximately 250 bp (predicted243and256 bp) whilst, asexpected(FOOTE et al., 1990), the product from Kl showedno digestion (Fig. 2, B). The identity of theseproductswasconfirmed by transfer to a Southern blot and hybridization with a specificprobe (not shown).

Casanova, J.-L,., Pannetier, C., Jaulin, C. & Kourilsky, P. (1990). Optimal conditions for directly sequencing double stranded PCR products with Sequenase. Nucleic Acids Research,

18, 4028.

Foote, S. J., Kyle, D. E., Martin, R. K., Oduola, A. M. J., Forsyth, K., Kemp, D. J. & Cowman, A. F. (1990). Several alleles of the multidrug resistance gene are closely linked to Nature, chloroquine resistance in Plasmodium falciparum. 345, 255-258. Mercier, B., Gaucher, C., Feugaeas, 0. & Mazurier, C. (1990). Direct PCR from whole blood, without DNA extraction. Nucleic

Acids

Research,

18, 5908.

Robson, K. J. H. & Jennings, M. W. (1991). The structure of the calmodulin gene of Plasmodium falciparum. Molecular in press. and Biochemical Parasitology, Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Sequencing amplified DNA by the Sanger dideoxymediated chain termination method. In: Molecular Cloning. Cold Spring Harbor: Cold Spring Harbor Laboratory Press, pp. 14.2214.24. Warhurst, D. C.,, Awad El Kariem, F. M. & Miles, M. A. (1991). Simphfied preparation of malarial blood samples for polymerase chain reaction. Lancet, 337, 303-304. Wellems, T. E., Panton, L. J., Gluzman, I. Y., do Rosario, V. E., Gwadz, R. W., Walker-Jonah, A. & Krogstad, D. J. (1990). Chloroquine resistance not linked to mdr-like genes cross.Nature, 345, 253-255. in a Plasmodium falciparum Wellems, T. E., Walker-Jonah, A. & Panton, L. J. (1991). Genetic mapping of the chloroquine resistance locus on Plasmodium falciparum chromosome 7. Proceedings of the National

Academy

of Sciences of the USA,

88, 3382-3386.

Winship, I’. R. (1989). An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Research, 17, 1266. Received publication

24 May 2 July

1991; revised 2 July 1991; accepted for 1991