- Email: [email protected]
Rapid detection of Vibrio parahaemolyticus in raw oysters using immunomagnetic separation combined with loop-mediated isothermal amplification
International Journal of Food Microbiology 174 (2014) 123–128
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Rapid detection of Vibrio parahaemolyticus in raw oysters using immunomagnetic separation combined with loop-mediated isothermal amplification Jing Zeng a,⁎, Haiyan Wei a, Lei Zhang a,c, Xuefeng Liu b, Haiyu Zhang c, Jinxia Cheng a,c, Dan Ma a, Ximeng Zhang a, Pubo Fu a, Li Liu a a b c
Food Safety Testing Center, Beijing Entry–Exit Inspection and Quarantine Bureau of the People's Republic of China, Beijing 100026, China National Center for Nanoscience and Technology, Beijing 100190, China Beijing University of Agriculture, Beijing 102206, China
a r t i c l e
i n f o
Article history: Received 30 July 2013 Received in revised form 16 November 2013 Accepted 4 January 2014 Available online 13 January 2014 Keywords: Nanoparticle Immunomagnetic separation Vibrio parahaemolyticus Loop-mediated isothermal amplification (LAMP) Oyster
a b s t r a c t The objective of this study was to develop a method that combined nanoparticle-based immunomagnetic separation (IMS) with real-time loop-mediated isothermal amplification (LAMP) for the rapid detection of Vibrio parahaemolyticus. Magnetic nanoparticles were functionalized with monoclonal antibodies that were produced against flagella from V. parahaemolyticus to capture and separate the target cells from raw oysters. After optimization, the immunomagnetic nanoparticles (IMNPs) presented a capture efficiency of 87.3% for 105 colonyforming unit (CFU)/mL of V. parahaemolyticus using 2.5 μg of IMNPs within 30 min. Although a very low level of non-specific binding was seen among 8 non-V. parahaemolyticus Vibrio spp. and 5 non-Vibrio strains, the IMS–LAMP method identified 133 V. parahaemolyticus strains correctly without the amplification from 54 other strains. The detection limit was about 1.4 × 102 CFU/mL in pure culture and was unaffected by the presence of 108 CFU/mL of competing microflora. When applied in spiked oysters, the sensitivity was found to be 1.9 × 103 CFU/g without enrichment. After enrichment for 6–8 h, the limit of detectability could be improved to 1.9 to 0.19 CFU/g. Hence, the IMS–LAMP assay provided a rapid, simple, and cost-effective method for total V. parahaemolyticus detection. This method will have important implications in the rapid detection of contaminated food in the early stage before distribution. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Gram-negative, halophilic marine bacterium Vibrio parahaemolyticus has emerged as an important cause of seafoodassociated outbreaks throughout the world, and it is a significant concern for seafood safety (Su and Liu, 2007). Shellfish, particularly oysters, has been frequently implicated in V. parahaemolyticus infections (Potasman et al., 2002). To prevent consumption of contaminated food, various methods were developed to detect V. parahaemolyticus in food and environments. The detection of V. parahaemolyticus using conventional culture- and biochemical-based assays is time-consuming and laborious, requiring more than three days. Recently, molecular techniques such as polymerase chain reaction (PCR), real-time PCR (rPCR) and the loopmediated isothermal amplification (LAMP) assay have been developed (Nordstrom et al., 2007; Yamazaki et al., 2010; Zhu et al., 2012). In particular, the LAMP assay is advantageous because of its simple operation,
⁎ Corresponding author at: Food Safety Testing Center, Beijing Entry–Exit Inspection and Quarantine Bureau of the People's Republic of China, No. 6 Tian Shui Yuan Street, Chao Yang District, Beijing 100026, China. Tel.: +86 10 5861 9245; fax: +86 10 6585 3805. E-mail address: [email protected] (J. Zeng). 0168-1605/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ijfoodmicro.2014.01.004
rapid reaction, and easy detection (Yamazaki et al., 2010). However, the molecular methods are only possible if the bacteria cells are concentrated to an appropriate volume for the reaction. Furthermore, detecting bacteria in contaminated samples using molecular techniques can be inhibited by food components, selective enrichment media, or large amounts of non-target DNA when total bacterial DNA is directly extracted from food systems (Yang et al., 2007). One approach to circumvent these problems and improve the recovery and detection of V. parahaemolyticus in seafood samples is through the use of immunomagnetic separation (IMS). IMS, which has been successfully used to concentrate and isolate numerous pathogens (Jadeja et al., 2010; Rijpens et al., 1999; Shim et al., 2008; Zhu et al., 2011), can effectively eliminate the polymerase inhibitors in the sample matrix, thereby reducing the time required for enriching and improving the detection limit (Rijpens et al., 1999). However, the previously reported IMS studies for V. parahaemolyticus (Datta et al., 2008; Seo et al., 2010) were both carried out with microsized magnetic beads. Recently, nanomaterials coated with pathogenspecific antibody have been used for IMS (Kanayeva et al., 2012; Varshney et al., 2005; Yang et al., 2013). The major advantage of using nanomaterials instead of microbeads is the higher capture efficiency (CE), faster reaction kinetics, and minimal sample preparation (Varshney et al., 2005). Furthermore, IMS has been used in conjunction
124
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
with several techniques, such as selective agar plating (Yoshitomi et al., 2012), enzyme-linked immunosorbent assay (ELISA, Shim et al., 2008) and chemiluminescent detection (Gehring et al., 2006), DNA hybridization (Jacobsen, 1995), PCR-based assays (Fedio et al., 2011; Yang et al., 2013; Yoshitomi et al., 2012), laser cytometry (Pyle et al., 1999), and mass spectrometry (Ochoa and Harrington, 2005), to detect bacterial pathogens. To our knowledge, this is the first report where IMS was coupled with LAMP in the rapid detection of V. parahaemolyticus. In this study, this method was developed, the optimal conditions were determined, and the detection of this pathogen in oyster was evaluated.
2. Materials and methods 2.1. Bacterial strains and culture conditions A total of 187 bacterial strains were used, including 133 V. parahaemolyticus, 49 non-V. parahaemolyticus Vibrio spp., and 5 non-Vibrio strains (Table 1). Of the 133 V. parahaemolyticus strains, two environmental strains were identified to be tdh- and toxRS/newpositive, and no strains possessed the trh, toxRS/old, or orf8 genes based on previously reported PCR assays (Okura et al., 2003). All Vibrio strains were grown on thiosulfate citrate bile salt sucrose agar (TCBS; BD Diagnostic Systems, Sparks, MD, USA) and incubated overnight at 35 °C. Other bacterial strains were cultured on tryptic soy agar or blood agar (BD Diagnostic Systems) and cultured overnight at 37 °C.
2.3. IMS by IMNPs V. parahaemolyticus ATCC 17802 was grown in alkaline peptone water (APW; BD Diagnostic Systems) at 35 °C for 18 h. Serial 10-fold dilutions of the culture were made in 0.1 M phosphate-buffered saline (PBS), at pH 7.2. In separate experiments, 1 mL of cell suspension was removed from selected dilutions and mixed with various amounts of IMNPs. Negative controls were prepared using 1 mL of PBS instead of V. parahaemolyticus cells. The mixture was incubated for 15, 30, 60, or 90 min at room temperature. IMNP-bacteria complex was collected by magnet, and the supernatant was plated onto TCBS plates and incubated at 37 °C for 24 h. Colonies on agar plates were counted. Collected IMNPbacteria complex was resuspended in 50 μL of deionized water with or without washing with PBS buffer. Total bacterial DNA of cells captured by IMNPs was extracted by boiling in a water bath for 10 min and subsequently centrifuging at 12,000 ×g for 5 min, and the supernatant was used as template DNA for rPCR or LAMP assays.
2.4. CE calculation and optimization The CE with the IMNPs was calculated using the following equation: CE (%) = (C 0 − Ca) / C0 × 100%, where C0 is the total number of cells present in the sample (colony-forming unit (CFU)/mL), and Ca is the number of cells not bound to IMNPs (CFU/mL). Specific comparisons of CEs that were obtained with different concentrations of V. parahaemolyticus suspension, different amounts of IMNPs, different reaction times, and with or without washing were made.
2.2. Preparation of immunomagnetic nanoparticles (IMNPs) Monoclonal antibodies (immunoglobulin G2b [IgG2b]) that were produced against flagella from V. parahaemolyticus ATCC 17802 were prepared by the method described previously (Datta et al., 2008) in the Laboratory for Animal Center, Peking University. The IMNPs were produced and characterized according to our previous study (Liu et al., 2013). The resultant IMNPs were about 70 nm and had a saturation magnetization value of 58.5 emu/g and zeta potential of −11 mV. Table 1 Specificity performance of the immunomagnetic separation–loop-mediated isothermal amplification (IMS–LAMP) system. Species
V. parahaemolyticus V. parahaemolyticus V. cholerae O1 V. cholerae O139 V. cholerae non-O1/ non-O139 V. vulnificus V. mimicus V. fluvialis V. alginolyticus V. furnissii V. proteolyticus L. monocytogenes S. aureus E. cloacae S. typhimurium E. coli a
Strain ID or sources
ATCC 17802b Seafood, BJCIQc Environmental waters, GDCIQe Environmental waters, GDCIQ Seafood, BJCIQ ATCC 27562 ATCC 33653 ATCC 33809 ATCC 33787 ATCC 33813 ATCC 53559 ATCC 15313 ATCC 29213 ATCC 700323 ATCC 14028 ATCC 25922
No. of strains
Results CE (%)a
IMS– LAMP
78.65 ± 2.42 NDd 5.3 ± 2.03
+ + −
3.7 ± 2.04
−
41
ND
−
1 1 1 1 1 1 1 1 1 1 1
3.6 6.9 4.2 8.3 1.9 2.3 0.5 4.8 6.4 5.4 3.6
1 132 1 1
± ± ± ± ± ± ± ± ± ± ±
0.97 1.27 1.27 2.07 1.23 1.32 0.47 1.90 0.75 1.27 1.57
− − − − − − − − − − −
CE, the capture efficiency with the IMNPs for Vibrio species and the other foodborne bacteria at a concentration of 103 CFU/mL. b ATCC, American Type Culture Collection. c BJCIQ, Beijing Entry–Exit Inspection and Quarantine Bureau, Beijing, China. d ND, not determined. e GDCIQ, Guangdong Entry–Exit Inspection and Quarantine Bureau, Guangzhou, China.
2.5. LAMP A set of six primers were designed from sequence data that were submitted to GenBank (thermolabile hemolysin gene, tlh, M36437). The sequences and locations of each primer were shown in Table 2. The 25-μL LAMP reaction mix consisted of the following: 1 × Thermo buffer, 6 mM MgSO4, 0.8 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 1.4 mM deoxynucleotide triphosphate, 0.2 μM of each outer primer (F3 and B3), 1.6 μM of each inner primer (FIP and BIP), 0.8 μM of each loop primer (LF and LB), 8 U Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), 3 μL DNA template, and 0.2 μM calcein fluorescent dye (DE AOU Biotechnology, Guangzhou, China). For real-time monitoring, the LAMP reactions were incubated at 63 °C for 60 min with an ESEQuant tube scanner (Qiagen, Hilden, Germany). Fluorescence readings were acquired every 20 s using the FAM channel (excitation at 470 nm and detection at 520 nm). The fluorescence threshold unit was set to 900. Table 2 Primers and probe of loop-mediated isothermal amplification and real-time polymerase chain reaction for the detection of total V. parahaemolyticus. Primers/ probe
Sequence (5′-3′)
Positiona
Reference
F3 B3 FIP
GCGCAAGGTTACAACATCAC GCGTGACATTCCAGAACACA CGCGTTCACGAAACCGTGCTGATACT CACGCCTTGTTCGA TTGGACATCAACCGCTCATCGTGACG CTGCACACTCAGAG TCGGGCGCAGAAGTTAGC CTGTCGATTACATGTACACCCAC ACTCAACACAAGAAGAGATCGACAA GATGAGCGGTTGATGTCCAA CGCTCGCGTTCACGAAACCGT
1093–1112 1281–1300 F1c: 1163–1182 F2: 1120–1139 B1c: 1195–1216 B2: 1248–1265 1143–1160 1217–1239 1007–1031 1195–1214 1166–1186
This study
BIP LF LB TLH-F TLH-R TLH-Pb
Nordstrom et al. (2007)
a The positions are numbered based on the coding sequence of thermolabile hemolysin gene of V. parahaemolyticus (GenBank: M36437). b The Taqman probe was 5′-end labeled with FAM, and 3′-end labeled with the TAMRA quencher.
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
125
2.6. rPCR rPCR was performed with primers and probe (Table 2) designed to target the tlh gene of V. parahaemolyticus as described by Nordstrom et al. (2007). Reactions were performed in 25-μL mixtures containing 12.5 μL 2 × Taqman Universal PCR Mastermix (Applied Biosystems, Foster City, CA, USA), 400 nM of each primer, 200 nM probe, and 3 μL template DNA. The amplification conditions were followed as previously described (Campbell and Wright, 2003) with the ABI PRISM 7900 sequence detection system (Applied Biosystems, Foster City, California, USA). 2.7. Specificity test The non-specific binding of IMNPs was tested for the bacteria listed in Table 1, and their CE values were determined following the above procedure. The resulting DNA from IMS was detected by LAMP to assess the specific performance of IMS–LAMP for V. parahaemolyticus. To further evaluate the ability of IMS–LAMP to retrieve target cells from complex samples, the sensitivity of IMS–LAMP in detecting a 10-fold serially diluted V. parahaemolyticus in the presence of 108 CFU/mL non-target bacteria cells (Vibrio vulnificus ATCC 27562, Staphylococcus aureus ATCC 29213, Listeria monocytogenes ATCC 15313, or Escherichia coli ATCC 25922) was also determined. 2.8. Detection of V. parahaemolyticus in artificially contaminated oyster Oyster samples were obtained from a local retail market and determined to be V. parahaemolyticus-negative by rPCR methods. A 1-mL portion of the serially diluted overnight culture of V. parahaemolyticus ATCC 17802 was added to 25 g oyster samples. Each sample was mixed with 225 mL of APW, and the final contamination value ranged from 1.9 × 105 to 1.9 × 10−1 CFU/g after samples were homogenized in a stomacher (Seward 400, Worthing, West Sussex, UK). No-spike samples were prepared as controls. To determine the sensitivity of V. parahaemolyticus detection in seafood without enrichment, 1 mL of spiked homogenates was mixed with 50 μL of IMNPs. After IMS, the concentrated cells were subjected to rPCR, LAMP, and plating. In parallel, bacterial DNA was extracted as previously described (Yoshitomi et al., 2012) without the use of IMS. Furthermore, a conventional culture assay (CC) was also carried out as a comparison. For artificially contaminated seafood with low concentrations (0.19–1.9 CFU/g), the CC, rPCR, LAMP, IMS–CC, IMS–rPCR, and IMS–LAMP techniques were compared for the rapid detection of V. parahaemolyticus after 4, 6, 8, 10, and 12 h of enrichment. 2.9. Statistical analysis All measurements were conducted three times in each experiment, and all experiments were performed in triplicate. The means and standard deviations of all collected data were calculated from independent replicates and analyzed with the t-test. Differences were considered significant at P b 0.05. 3. Results
Fig. 1. Effect of bacteria concentration (A), amounts of immunomagnetic nanoparticles (B), and reaction time and wash step (C) on the capture efficiency of Vibrio parahaemolyticus ATCC 17802. The capture efficiency was determined using 103 CFU/mL of V. parahaemolyticus in (B) and (C), 2.5 μg of immunomagnetic nanoparticles in (A) and (C), and a 30-min reaction time with one wash step in (A) and (B). Error bars represent standard deviations obtained from triplicate experiments.
at 30 min. Further increases in the concentration of IMNPs did not change the CE significantly (P N 0.05, Fig. 1B). An increase in the incubation time from 15 to 30 min significantly increased the CE of IMNPs (2.5 μg) to V. parahaemolyticus ATCC 17802 (103 CFU/mL) from 43.8% to 76.5%. However, incubation times that were longer than 30 min resulted in a decreased CE (Fig. 1C). With an incubation time of 30 min, an additional 2.8% of the initially bound bacteria was washed away, leaving an estimated 76.5% of the original 103 CFU/mL bacteria on the IMNPs (2.5 μg) after one wash. There were no significant differences (P N 0.05) between CEs that were obtained with or without washing IMNPs exposed to the cell suspension (Fig. 1C). Therefore, one washing was performed in order to remove the non-target bacteria that were loosely bound to IMNPs and contaminants in the samples.
3.1. Optimizing IMS As shown in Fig. 1A, the IMNPs presented the highest CE, which was 87.3%, for 105 CFU/mL of V. parahaemolyticus ATCC 17802 using 2.5 μg of IMNPs within 30 min. The CE decreased with reduced bacteria concentrations. Increasing the amount of IMNPs in each assay raised the CE from 17.0% (0.5 μg of IMNPs) to 78.0% (2.5 μg of IMNPs) for 103 CFU/mL of V. parahaemolyticus ATCC 17802 when the incubation time was fixed
3.2. Specificity of IMS–LAMP To evaluate the specificity of the IMNPs, 8 non-V. parahaemolyticus Vibrio spp. and 5 non-Vibrio strains were separated. A very low level of non-specific binding was observed after IMS in PBS containing 103 CFU/mL of bacteria cells, and CE values were no more than 9% (Table 1). When coupling the IMNPs to the LAMP amplification, the
126
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
assay identified 133 V. parahaemolyticus strains correctly without the amplification of 54 other strains (Table 1). 3.3. Sensitivity of IMS–LAMP with pure cultures of V. parahaemolyticus When 10-fold serially diluted V. parahaemolyticus ATCC 17802 suspensions were tested, the IMS–LAMP sensitivity was 8.4 CFU/reaction, which corresponded to 140 CFU/mL (Fig. 2A). This sensitivity was comparable to that of the IMS–rPCR assay (Fig. 2B) and was unaffected by the presence of 108 CFU/mL non-target bacteria cells (data not shown). 3.4. Detection of V. parahaemolyticus in artificially contaminated oysters In comparative analyses of artificially inoculated oysters, the sensitivity of the IMS–rPCR and IMS–LAMP assays for the direct detection of V. parahaemolyticus ATCC 17802 without enrichment was 1.9 × 103 CFU/g (1.9 × 102 CFU/mL, 11.4 CFU/reaction), which was 10-fold more sensitive than those of the rPCR and LAMP assays alone and 100-fold more sensitive than that of the CC method (Table 3). As for oyster samples that were inoculated with a low concentration (1.9 CFU/g) of V. parahaemolyticus ATCC 17802, the CC method required 12 h of enrichment to obtain a positive result, whereas the rPCR and LAMP methods required 10 h, the IMS–CC method required 8 h, and
Fig. 2. Comparison of sensitivities of immunomagnetic separation–loop-mediated isothermal amplification (IMS–LAMP) (A) and IMS–real-time polymerase chain reaction (IMS–rPCR) (B) with pure cultures of Vibrio parahaemolyticus ATCC 17802. Total bacterial DNA was extracted from the 10-fold serially diluted V. parahaemolyticus suspensions by immunomagnetic nanoparticles and measured by LAMP and rPCR, respectively. The curves that are shown are representative of triplicate experiments. Decreasing concentrations of bacterial cells (1.4 × 105 to 1.4 CFU/mL) are indicated from left to right.
the IMS–LAMP and IMS–rPCR methods required only 6 h of enrichment (Table 3). Analyses of samples that were inoculated with 0.19 CFU/g V. parahaemolyticus ATCC 17802 produced similar results, indicating that the enrichment time could be shortened by at least 4 h when using the IMS–LAMP method instead of methods without IMS (Table 3). 4. Discussion Recently, nanoparticles have opened new dimensions in IMS because of their unique optical properties, high surface-to-volume ratio, and other size-dependent qualities. In this study, novel magnetic nanoparticles with an average diameter of 70 nm were functionalized with monoclonal antibodies that were produced against flagella from V. parahaemolyticus to capture and separate the target cells from raw oysters. First, the CE was higher (N 70%) than previously reported CEs of 32% to 56% for the separation of V. parahaemolyticus (Datta et al., 2008). The difference in CEs could be attributed to the size of the magnetic beads. Varshney et al. (2005) reported that the surface area of nanoparticles with a diameter of 145 nm for capture of E. coli O157 was 78 times larger than that of magnetic microbeads (2.8-μm in diameter). Therefore, the IMNPs that were used in this study, which had a 70-nm diameter, should exhibit a higher surface-to-volume ratio and provide more binding sites for antibodies. Second, the binding reaction can be finished in half an hour (Fig. 1C) without shaking, and the immunoreaction took 60 min to 120 min on a shaker when magnetic microbeads were used in the IMS methods (Seo et al., 2010; Zhu et al., 2011). The most probable reason for this difference is the rapid binding kinetics of IMNPs to target cells. Liberti et al. (1996) showed that magnetic nanoparticles are 5- to 20-fold faster than 1- to 100-μm of magnetic microbeads in reaction kinetics. Nanoparticles, because of their small size, move by diffusion, whereas microbeads experience gravitational settling (Varshney et al., 2005). Hence, no mixing was required during the IMS of V. parahaemolyticus in this study because IMNPs had efficient diffusion properties. Previous studies showed that paramagnetic beads may exhibit a high degree of non-specific binding to various pathogens (Rijpens et al., 1999; Tomoyasu, 1998). In this study, a very low level of nonspecific binding of IMNPs was observed (Table 1), and this may have resulted from the shortened incubation time and the wash step after the binding reaction. In the future, the use of more specific antibodies and better solutions to block the non-specific sites of IMNPs could further reduce the number of non-specific interactions. Even if cross-reacting bacterial species were absorbed by the IMNPs, V. parahaemolyticus cells could be specifically detected by coupling the IMNPs with the LAMP amplification (Table 1). The specificity of this assay was largely controlled by the primer sets that were used during LAMP, which included eight distinct sequences that were required for recognition. When combining IMS with the LAMP assay, the sensitivities in pure cultures and in oyster homogenate were not dramatically different (Fig. 2A, Table 3), indicating that the oyster homogenate did not have an inhibitory effect on the binding capacity of the IMNPs. In contrast, Jeníková et al. (2000) reported that the binding capacity decreased significantly when IMS was performed with ground beef and attributed the reduced binding capacity to the high fat content of beef, which may entrap some beads in the food matrix. Therefore, the lack of interference from oyster homogenate might be explained by the lower fat content of oyster meat (about 2.4%) compared with ground beef (17%) (Varshney et al., 2005). Besides, the ability of IMNPs to concentrate target cells and remove PCR inhibitors of food origin may account for the added sensitivity of IMS–LAMP in spiked raw oysters when compared with methods without IMS (Table 3). The rapid detection of V. parahaemolyticus at a low limiting number (101 to 102 CFU/g) is very important to prevent seafood consumers from being infected by the highly offensive bacteria (Datta et al., 2008). To meet this demand, a 6-h enrichment step was used prior to detection (Table 3). This short enrichment procedure combined with
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
127
Table 3 Comparison of methods with or without immunomagnetic separation (IMS) for the detection of V. parahaemolyticus ATCC 17802 in seeded oysters. V. parahaemolyticus concentration (CFU/g)
1.9 1.9 1.9 1.9 1.9 1.9
× × × × × ×
5
10 104 103 102 101 10°
1.9 × 10−1
a b c d e
Enrichment time (h)
e
0 0 0 0 0 4 6 8 10 12 4 6 8 10 12
Results without IMSa
Results with IMSa
LAMPb
rPCRc
CCd
IMS–LAMP
IMS–rPCR
IMS–CC
+ + − − − − − − + + − − − − +
+ + − − − − − − + + − − − − +
+ − − − − − − − − + − − − − −
+ + + − − − + + + + − − + + +
+ + + − − − + + + + − − + + +
+ + − − − − − + + + − − − + +
The results of three independent experiments with artificially contaminated oyster samples. +, triplicate assays were all positive; and −, triplicate assays were all negative. LAMP, loop-mediated isothermal amplification. rPCR, real-time PCR. CC, conventional culture assay. Samples with high inoculating levels (1.9 × 101–1.9 × 105 CFU/g) were directly detected without enrichment.
simplified sample processing by IMS (b 1 h) and rapid LAMP confirmation (b50 min) would make it possible to complete the analysis within a workday. To our knowledge, this is the first report that combined IMS with the LAMP assay to target the species-specific tlh gene for the rapid detection of total V. parahaemolyticus from oyster samples, and the combination could easily be expanded for the comprehensive detection of pathogenic strains with a virulence gene-specific LAMP assay (Nemoto et al., 2009; Yamazaki et al., 2010). Moreover, V. parahaemolyticus can activate a viable but non-culturable (VBNC) state, and changes in surface antigens (Falcioni et al., 2008) may disguise the pathogen from the IMS method. Further studies will focus on the applicability of the developed IMS–LAMP method to detect VBNC cells of V. parahaemolyticus after recovery from cultures. In conclusion, the IMS–LAMP would be a significant assay to detect total V. parahaemolyticus in routine tests, and it has potential applications in the most probable number method. The IMS–LAMP assay has a potential value for the rapid, simple, and cost-effective screening of total V. parahaemolyticus-contaminated samples before they are consumed and can therefore facilitate the surveillance of V. parahaemolyticus contamination in seafood. Acknowledgments We gratefully acknowledge Xuesong Liu and Dong Cao for the monoclonal antibody preparation. References Campbell, M.S., Wright, A.C., 2003. Real-time PCR analysis of Vibrio vulnificus from oysters. Appl. Environ. Microbiol. 69, 7137–7144. Datta, S., Janes, M.E., Simonson, J.G., 2008. Immunomagnetic separation and coagglutination of Vibrio parahaemolyticus with anti-flagellar protein monoclonal antibody. Clin. Vaccine Immunol. 15, 1541–1546. Falcioni, T., Papa, S., Campana, R., Manti, A., Battistelli, M., Baffone, W., 2008. State transitions of Vibrio parahaemolyticus VBNC cells evaluated by flow cytometry. Cytometry B Clin. Cytom. 74, 272–281. Fedio, W.M., Jinneman, K.C., Yoshitomi, K.J., Zapata, R., Wendakoon, C.N., Browning, P., Weagant, S.D., 2011. Detection of E. coli O157:H7 in raw ground beef by Pathatrix™ immunomagnetic-separation, real-time PCR and cultural methods. Int. J. Food Microbiol. 148, 87–92. Gehring, A.G., Albin, D.M., Irwin, P.L., Reed, S.A., Tu, S.I., 2006. Comparison of enzyme-linked immunomagnetic chemiluminescence with U.S. Food and Drug Administration's Bacteriological Analytical Manual method for the detection of Escherichia coli O157:H7. J. Microbiol. Methods 67, 527–533.
Jacobsen, C.S., 1995. Microscale detection of specific bacterial DNA in soil with a magnetic capture-hybridization and PCR amplification assay. Appl. Environ. Microbiol. 61, 3347–3352. Jadeja, R., Janes, M.E., Simonson, J.G., 2010. Immunomagnetic separation of Vibrio vulnificus with antiflagellar monoclonal antibody. J. Food Prot. 73, 1288–1293. Jeníková, G., Pazlarová, J., Demnerová, K., 2000. Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Int. Microbiol. 3, 225–229. Kanayeva, D.A., Wang, R., Rhoads, D., Erf, G.F., Slavik, M.F., Tung, S., Li, Y., 2012. Efficient separation and sensitive detection of Listeria monocytogenes using an impedance immunosensor based on magnetic nanoparticles, a microfluidic chip, and an interdigitated microelectrode. J. Food Prot. 75, 1951–1959. Liberti, P.A., Chiarappa, J.N., Hovsepian, A.C., Rao, C.G., 1996. Bioreceptor ferrofluids: novel characteristics and their utility in medical applications. In: Pelizzetti, E. (Ed.), Fine Particles Science and Technology. Kluwer Academic Publishers, pp. 777–790. Liu, X., Zhang, L., Zeng, J., Gao, Y., Tang, Z., 2013. Superparamagnetic nano-immunobeads toward food safety insurance. J. Nanoparticle Res. 15, 1796–1805. Nemoto, J., Sugawara, C., Akahane, K., Hashimoto, K., Kojima, T., Ikedo, M., Konuma, H., Hara-Kudo, Y., 2009. Rapid and specific detection of the thermostable direct hemolysin gene in Vibrio parahaemolyticus by loop-mediated isothermal amplification. J. Food Prot. 72, 748–754. Nordstrom, J.L., Vickery, M.C., Blackstone, G.M., Murray, S.L., DePaola, A., 2007. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 73, 5840–5847. Ochoa, M.L., Harrington, P.B., 2005. Immunomagnetic isolation of enterohemorrhagic Escherichia coli O157:H7 from ground beef and identification by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and database searches. Anal. Chem. 77, 5258–5267. Okura, M., Osawa, R., Iguchi, A., Arakawa, E., Terajima, J., Watanabe, H., 2003. Genotypic analyses of Vibrio parahaemolyticus and development of a pandemic group-specific multiplex PCR assay. J. Clin. Microbiol. 41, 4676–4682. Potasman, I., Paz, A., Odeh, M., 2002. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin. Infect. Dis. 35, 921–928. Pyle, B.H., Broadaway, S.C., McFeters, G.A., 1999. Sensitive detection of Escherichia coli O157:H7 in food and water by immunomagnetic separation and solid-phase laser cytometry. Appl. Environ. Microbiol. 65, 1966–1972. Rijpens, N., Herman, L., Vereecken, F., Jannes, G., De Smedt, J., De Zutter, L., 1999. Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separation and PCR. Int. J. Food Microbiol. 46, 37–44. Seo, S.M., Cho, I.H., Jeon, J.W., Cho, H.K., Oh, E.G., Yu, H.S., Shin, S.B., Lee, H.J., Paek, S.H., 2010. An ELISA-on-a-chip biosensor system coupled with immunomagnetic separation for the detection of Vibrio parahaemolyticus within a single working day. J. Food Prot. 73, 1466–1473. Shim, W.B., Choi, J.G., Kim, J.Y., Yang, Z.Y., Lee, K.H., Kim, M.G., Ha, S.D., Kim, K.S., Kim, K.Y., Kim, C.H., Eremin, S.A., Chung, D.H., 2008. Enhanced rapidity for qualitative detection of Listeria monocytogenes using an enzyme-linked immunosorbent assay and immunochromatography strip test combined with immunomagnetic bead separation. J. Food Prot. 71, 781–789. Su, Y.C., Liu, C., 2007. Vibrio parahaemolyticus: a concern of seafood safety. Food Microbiol. 24, 549–558. Tomoyasu, T., 1998. Improvement of the immunomagnetic separation method selective for Escherichia coli O157 strains. Appl. Environ. Microbiol. 64, 376–382.
128
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
Varshney, M., Yang, L., Su, X.L., Li, Y., 2005. Magnetic nanoparticle-antibody conjugates for the separation of Escherichia coli O157:H7 in ground beef. J. Food Prot. 68, 1804–1811. Yamazaki, W., Kumeda, Y., Misawa, N., Nakaguchi, Y., Nishibuchi, M., 2010. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of the tdh and trh genes of Vibrio parahaemolyticus and related Vibrio species. Appl. Environ. Microbiol. 76, 820–828. Yang, H., Qu, L., Wimbrow, A.N., Jiang, X., Sun, Y., 2007. Rapid detection of Listeria monocytogenes by nanoparticle-based immunomagnetic separation and real-time PCR. Int. J. Food Microbiol. 118, 132–138. Yang, Y., Xu, F., Xu, H., Aguilar, Z.P., Niu, R., Yuan, Y., Sun, J., You, X., Lai, W., Xiong, Y., Wan, C., Wei, H., 2013. Magnetic nano-beads based separation combined with propidium monoazide treatment and multiplex PCR assay for simultaneous detection of viable
Salmonella typhimurium, Escherichia coli O157:H7 and Listeria monocytogenes in food products. Food Microbiol. 34, 418–424. Yoshitomi, K.J., Jinneman, K.C., Zapata, R., Weagant, S.D., Fedio, W.M., 2012. Detection and isolation of low levels of E. coli O157:H7 in cilantro by real-time PCR, immunomagnetic separation, and cultural methods with and without an acid treatment. J. Food Sci. 77, M481–M489. Zhu, P., Shelton, D.R., Li, S., Adams, D.L., Karns, J.S., Amstutz, P., Tang, C.M., 2011. Detection of E. coli O157:H7 by immunomagnetic separation coupled with fluorescence immunoassay. Biosens. Bioelectron. 30, 337–341. Zhu, R.G., Li, T.P., Jia, Y.F., Song, L.F., 2012. Quantitative study of viable Vibrio parahaemolyticus cells in raw seafood using propidium monoazide in combination with quantitative PCR. J. Microbiol. Methods 90, 262–266.
Contents lists available at ScienceDirect
International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro
Rapid detection of Vibrio parahaemolyticus in raw oysters using immunomagnetic separation combined with loop-mediated isothermal amplification Jing Zeng a,⁎, Haiyan Wei a, Lei Zhang a,c, Xuefeng Liu b, Haiyu Zhang c, Jinxia Cheng a,c, Dan Ma a, Ximeng Zhang a, Pubo Fu a, Li Liu a a b c
Food Safety Testing Center, Beijing Entry–Exit Inspection and Quarantine Bureau of the People's Republic of China, Beijing 100026, China National Center for Nanoscience and Technology, Beijing 100190, China Beijing University of Agriculture, Beijing 102206, China
a r t i c l e
i n f o
Article history: Received 30 July 2013 Received in revised form 16 November 2013 Accepted 4 January 2014 Available online 13 January 2014 Keywords: Nanoparticle Immunomagnetic separation Vibrio parahaemolyticus Loop-mediated isothermal amplification (LAMP) Oyster
a b s t r a c t The objective of this study was to develop a method that combined nanoparticle-based immunomagnetic separation (IMS) with real-time loop-mediated isothermal amplification (LAMP) for the rapid detection of Vibrio parahaemolyticus. Magnetic nanoparticles were functionalized with monoclonal antibodies that were produced against flagella from V. parahaemolyticus to capture and separate the target cells from raw oysters. After optimization, the immunomagnetic nanoparticles (IMNPs) presented a capture efficiency of 87.3% for 105 colonyforming unit (CFU)/mL of V. parahaemolyticus using 2.5 μg of IMNPs within 30 min. Although a very low level of non-specific binding was seen among 8 non-V. parahaemolyticus Vibrio spp. and 5 non-Vibrio strains, the IMS–LAMP method identified 133 V. parahaemolyticus strains correctly without the amplification from 54 other strains. The detection limit was about 1.4 × 102 CFU/mL in pure culture and was unaffected by the presence of 108 CFU/mL of competing microflora. When applied in spiked oysters, the sensitivity was found to be 1.9 × 103 CFU/g without enrichment. After enrichment for 6–8 h, the limit of detectability could be improved to 1.9 to 0.19 CFU/g. Hence, the IMS–LAMP assay provided a rapid, simple, and cost-effective method for total V. parahaemolyticus detection. This method will have important implications in the rapid detection of contaminated food in the early stage before distribution. © 2014 Elsevier B.V. All rights reserved.
1. Introduction The Gram-negative, halophilic marine bacterium Vibrio parahaemolyticus has emerged as an important cause of seafoodassociated outbreaks throughout the world, and it is a significant concern for seafood safety (Su and Liu, 2007). Shellfish, particularly oysters, has been frequently implicated in V. parahaemolyticus infections (Potasman et al., 2002). To prevent consumption of contaminated food, various methods were developed to detect V. parahaemolyticus in food and environments. The detection of V. parahaemolyticus using conventional culture- and biochemical-based assays is time-consuming and laborious, requiring more than three days. Recently, molecular techniques such as polymerase chain reaction (PCR), real-time PCR (rPCR) and the loopmediated isothermal amplification (LAMP) assay have been developed (Nordstrom et al., 2007; Yamazaki et al., 2010; Zhu et al., 2012). In particular, the LAMP assay is advantageous because of its simple operation,
⁎ Corresponding author at: Food Safety Testing Center, Beijing Entry–Exit Inspection and Quarantine Bureau of the People's Republic of China, No. 6 Tian Shui Yuan Street, Chao Yang District, Beijing 100026, China. Tel.: +86 10 5861 9245; fax: +86 10 6585 3805. E-mail address: [email protected] (J. Zeng). 0168-1605/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ijfoodmicro.2014.01.004
rapid reaction, and easy detection (Yamazaki et al., 2010). However, the molecular methods are only possible if the bacteria cells are concentrated to an appropriate volume for the reaction. Furthermore, detecting bacteria in contaminated samples using molecular techniques can be inhibited by food components, selective enrichment media, or large amounts of non-target DNA when total bacterial DNA is directly extracted from food systems (Yang et al., 2007). One approach to circumvent these problems and improve the recovery and detection of V. parahaemolyticus in seafood samples is through the use of immunomagnetic separation (IMS). IMS, which has been successfully used to concentrate and isolate numerous pathogens (Jadeja et al., 2010; Rijpens et al., 1999; Shim et al., 2008; Zhu et al., 2011), can effectively eliminate the polymerase inhibitors in the sample matrix, thereby reducing the time required for enriching and improving the detection limit (Rijpens et al., 1999). However, the previously reported IMS studies for V. parahaemolyticus (Datta et al., 2008; Seo et al., 2010) were both carried out with microsized magnetic beads. Recently, nanomaterials coated with pathogenspecific antibody have been used for IMS (Kanayeva et al., 2012; Varshney et al., 2005; Yang et al., 2013). The major advantage of using nanomaterials instead of microbeads is the higher capture efficiency (CE), faster reaction kinetics, and minimal sample preparation (Varshney et al., 2005). Furthermore, IMS has been used in conjunction
124
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
with several techniques, such as selective agar plating (Yoshitomi et al., 2012), enzyme-linked immunosorbent assay (ELISA, Shim et al., 2008) and chemiluminescent detection (Gehring et al., 2006), DNA hybridization (Jacobsen, 1995), PCR-based assays (Fedio et al., 2011; Yang et al., 2013; Yoshitomi et al., 2012), laser cytometry (Pyle et al., 1999), and mass spectrometry (Ochoa and Harrington, 2005), to detect bacterial pathogens. To our knowledge, this is the first report where IMS was coupled with LAMP in the rapid detection of V. parahaemolyticus. In this study, this method was developed, the optimal conditions were determined, and the detection of this pathogen in oyster was evaluated.
2. Materials and methods 2.1. Bacterial strains and culture conditions A total of 187 bacterial strains were used, including 133 V. parahaemolyticus, 49 non-V. parahaemolyticus Vibrio spp., and 5 non-Vibrio strains (Table 1). Of the 133 V. parahaemolyticus strains, two environmental strains were identified to be tdh- and toxRS/newpositive, and no strains possessed the trh, toxRS/old, or orf8 genes based on previously reported PCR assays (Okura et al., 2003). All Vibrio strains were grown on thiosulfate citrate bile salt sucrose agar (TCBS; BD Diagnostic Systems, Sparks, MD, USA) and incubated overnight at 35 °C. Other bacterial strains were cultured on tryptic soy agar or blood agar (BD Diagnostic Systems) and cultured overnight at 37 °C.
2.3. IMS by IMNPs V. parahaemolyticus ATCC 17802 was grown in alkaline peptone water (APW; BD Diagnostic Systems) at 35 °C for 18 h. Serial 10-fold dilutions of the culture were made in 0.1 M phosphate-buffered saline (PBS), at pH 7.2. In separate experiments, 1 mL of cell suspension was removed from selected dilutions and mixed with various amounts of IMNPs. Negative controls were prepared using 1 mL of PBS instead of V. parahaemolyticus cells. The mixture was incubated for 15, 30, 60, or 90 min at room temperature. IMNP-bacteria complex was collected by magnet, and the supernatant was plated onto TCBS plates and incubated at 37 °C for 24 h. Colonies on agar plates were counted. Collected IMNPbacteria complex was resuspended in 50 μL of deionized water with or without washing with PBS buffer. Total bacterial DNA of cells captured by IMNPs was extracted by boiling in a water bath for 10 min and subsequently centrifuging at 12,000 ×g for 5 min, and the supernatant was used as template DNA for rPCR or LAMP assays.
2.4. CE calculation and optimization The CE with the IMNPs was calculated using the following equation: CE (%) = (C 0 − Ca) / C0 × 100%, where C0 is the total number of cells present in the sample (colony-forming unit (CFU)/mL), and Ca is the number of cells not bound to IMNPs (CFU/mL). Specific comparisons of CEs that were obtained with different concentrations of V. parahaemolyticus suspension, different amounts of IMNPs, different reaction times, and with or without washing were made.
2.2. Preparation of immunomagnetic nanoparticles (IMNPs) Monoclonal antibodies (immunoglobulin G2b [IgG2b]) that were produced against flagella from V. parahaemolyticus ATCC 17802 were prepared by the method described previously (Datta et al., 2008) in the Laboratory for Animal Center, Peking University. The IMNPs were produced and characterized according to our previous study (Liu et al., 2013). The resultant IMNPs were about 70 nm and had a saturation magnetization value of 58.5 emu/g and zeta potential of −11 mV. Table 1 Specificity performance of the immunomagnetic separation–loop-mediated isothermal amplification (IMS–LAMP) system. Species
V. parahaemolyticus V. parahaemolyticus V. cholerae O1 V. cholerae O139 V. cholerae non-O1/ non-O139 V. vulnificus V. mimicus V. fluvialis V. alginolyticus V. furnissii V. proteolyticus L. monocytogenes S. aureus E. cloacae S. typhimurium E. coli a
Strain ID or sources
ATCC 17802b Seafood, BJCIQc Environmental waters, GDCIQe Environmental waters, GDCIQ Seafood, BJCIQ ATCC 27562 ATCC 33653 ATCC 33809 ATCC 33787 ATCC 33813 ATCC 53559 ATCC 15313 ATCC 29213 ATCC 700323 ATCC 14028 ATCC 25922
No. of strains
Results CE (%)a
IMS– LAMP
78.65 ± 2.42 NDd 5.3 ± 2.03
+ + −
3.7 ± 2.04
−
41
ND
−
1 1 1 1 1 1 1 1 1 1 1
3.6 6.9 4.2 8.3 1.9 2.3 0.5 4.8 6.4 5.4 3.6
1 132 1 1
± ± ± ± ± ± ± ± ± ± ±
0.97 1.27 1.27 2.07 1.23 1.32 0.47 1.90 0.75 1.27 1.57
− − − − − − − − − − −
CE, the capture efficiency with the IMNPs for Vibrio species and the other foodborne bacteria at a concentration of 103 CFU/mL. b ATCC, American Type Culture Collection. c BJCIQ, Beijing Entry–Exit Inspection and Quarantine Bureau, Beijing, China. d ND, not determined. e GDCIQ, Guangdong Entry–Exit Inspection and Quarantine Bureau, Guangzhou, China.
2.5. LAMP A set of six primers were designed from sequence data that were submitted to GenBank (thermolabile hemolysin gene, tlh, M36437). The sequences and locations of each primer were shown in Table 2. The 25-μL LAMP reaction mix consisted of the following: 1 × Thermo buffer, 6 mM MgSO4, 0.8 M betaine (Sigma-Aldrich, St. Louis, MO, USA), 1.4 mM deoxynucleotide triphosphate, 0.2 μM of each outer primer (F3 and B3), 1.6 μM of each inner primer (FIP and BIP), 0.8 μM of each loop primer (LF and LB), 8 U Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), 3 μL DNA template, and 0.2 μM calcein fluorescent dye (DE AOU Biotechnology, Guangzhou, China). For real-time monitoring, the LAMP reactions were incubated at 63 °C for 60 min with an ESEQuant tube scanner (Qiagen, Hilden, Germany). Fluorescence readings were acquired every 20 s using the FAM channel (excitation at 470 nm and detection at 520 nm). The fluorescence threshold unit was set to 900. Table 2 Primers and probe of loop-mediated isothermal amplification and real-time polymerase chain reaction for the detection of total V. parahaemolyticus. Primers/ probe
Sequence (5′-3′)
Positiona
Reference
F3 B3 FIP
GCGCAAGGTTACAACATCAC GCGTGACATTCCAGAACACA CGCGTTCACGAAACCGTGCTGATACT CACGCCTTGTTCGA TTGGACATCAACCGCTCATCGTGACG CTGCACACTCAGAG TCGGGCGCAGAAGTTAGC CTGTCGATTACATGTACACCCAC ACTCAACACAAGAAGAGATCGACAA GATGAGCGGTTGATGTCCAA CGCTCGCGTTCACGAAACCGT
1093–1112 1281–1300 F1c: 1163–1182 F2: 1120–1139 B1c: 1195–1216 B2: 1248–1265 1143–1160 1217–1239 1007–1031 1195–1214 1166–1186
This study
BIP LF LB TLH-F TLH-R TLH-Pb
Nordstrom et al. (2007)
a The positions are numbered based on the coding sequence of thermolabile hemolysin gene of V. parahaemolyticus (GenBank: M36437). b The Taqman probe was 5′-end labeled with FAM, and 3′-end labeled with the TAMRA quencher.
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
125
2.6. rPCR rPCR was performed with primers and probe (Table 2) designed to target the tlh gene of V. parahaemolyticus as described by Nordstrom et al. (2007). Reactions were performed in 25-μL mixtures containing 12.5 μL 2 × Taqman Universal PCR Mastermix (Applied Biosystems, Foster City, CA, USA), 400 nM of each primer, 200 nM probe, and 3 μL template DNA. The amplification conditions were followed as previously described (Campbell and Wright, 2003) with the ABI PRISM 7900 sequence detection system (Applied Biosystems, Foster City, California, USA). 2.7. Specificity test The non-specific binding of IMNPs was tested for the bacteria listed in Table 1, and their CE values were determined following the above procedure. The resulting DNA from IMS was detected by LAMP to assess the specific performance of IMS–LAMP for V. parahaemolyticus. To further evaluate the ability of IMS–LAMP to retrieve target cells from complex samples, the sensitivity of IMS–LAMP in detecting a 10-fold serially diluted V. parahaemolyticus in the presence of 108 CFU/mL non-target bacteria cells (Vibrio vulnificus ATCC 27562, Staphylococcus aureus ATCC 29213, Listeria monocytogenes ATCC 15313, or Escherichia coli ATCC 25922) was also determined. 2.8. Detection of V. parahaemolyticus in artificially contaminated oyster Oyster samples were obtained from a local retail market and determined to be V. parahaemolyticus-negative by rPCR methods. A 1-mL portion of the serially diluted overnight culture of V. parahaemolyticus ATCC 17802 was added to 25 g oyster samples. Each sample was mixed with 225 mL of APW, and the final contamination value ranged from 1.9 × 105 to 1.9 × 10−1 CFU/g after samples were homogenized in a stomacher (Seward 400, Worthing, West Sussex, UK). No-spike samples were prepared as controls. To determine the sensitivity of V. parahaemolyticus detection in seafood without enrichment, 1 mL of spiked homogenates was mixed with 50 μL of IMNPs. After IMS, the concentrated cells were subjected to rPCR, LAMP, and plating. In parallel, bacterial DNA was extracted as previously described (Yoshitomi et al., 2012) without the use of IMS. Furthermore, a conventional culture assay (CC) was also carried out as a comparison. For artificially contaminated seafood with low concentrations (0.19–1.9 CFU/g), the CC, rPCR, LAMP, IMS–CC, IMS–rPCR, and IMS–LAMP techniques were compared for the rapid detection of V. parahaemolyticus after 4, 6, 8, 10, and 12 h of enrichment. 2.9. Statistical analysis All measurements were conducted three times in each experiment, and all experiments were performed in triplicate. The means and standard deviations of all collected data were calculated from independent replicates and analyzed with the t-test. Differences were considered significant at P b 0.05. 3. Results
Fig. 1. Effect of bacteria concentration (A), amounts of immunomagnetic nanoparticles (B), and reaction time and wash step (C) on the capture efficiency of Vibrio parahaemolyticus ATCC 17802. The capture efficiency was determined using 103 CFU/mL of V. parahaemolyticus in (B) and (C), 2.5 μg of immunomagnetic nanoparticles in (A) and (C), and a 30-min reaction time with one wash step in (A) and (B). Error bars represent standard deviations obtained from triplicate experiments.
at 30 min. Further increases in the concentration of IMNPs did not change the CE significantly (P N 0.05, Fig. 1B). An increase in the incubation time from 15 to 30 min significantly increased the CE of IMNPs (2.5 μg) to V. parahaemolyticus ATCC 17802 (103 CFU/mL) from 43.8% to 76.5%. However, incubation times that were longer than 30 min resulted in a decreased CE (Fig. 1C). With an incubation time of 30 min, an additional 2.8% of the initially bound bacteria was washed away, leaving an estimated 76.5% of the original 103 CFU/mL bacteria on the IMNPs (2.5 μg) after one wash. There were no significant differences (P N 0.05) between CEs that were obtained with or without washing IMNPs exposed to the cell suspension (Fig. 1C). Therefore, one washing was performed in order to remove the non-target bacteria that were loosely bound to IMNPs and contaminants in the samples.
3.1. Optimizing IMS As shown in Fig. 1A, the IMNPs presented the highest CE, which was 87.3%, for 105 CFU/mL of V. parahaemolyticus ATCC 17802 using 2.5 μg of IMNPs within 30 min. The CE decreased with reduced bacteria concentrations. Increasing the amount of IMNPs in each assay raised the CE from 17.0% (0.5 μg of IMNPs) to 78.0% (2.5 μg of IMNPs) for 103 CFU/mL of V. parahaemolyticus ATCC 17802 when the incubation time was fixed
3.2. Specificity of IMS–LAMP To evaluate the specificity of the IMNPs, 8 non-V. parahaemolyticus Vibrio spp. and 5 non-Vibrio strains were separated. A very low level of non-specific binding was observed after IMS in PBS containing 103 CFU/mL of bacteria cells, and CE values were no more than 9% (Table 1). When coupling the IMNPs to the LAMP amplification, the
126
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
assay identified 133 V. parahaemolyticus strains correctly without the amplification of 54 other strains (Table 1). 3.3. Sensitivity of IMS–LAMP with pure cultures of V. parahaemolyticus When 10-fold serially diluted V. parahaemolyticus ATCC 17802 suspensions were tested, the IMS–LAMP sensitivity was 8.4 CFU/reaction, which corresponded to 140 CFU/mL (Fig. 2A). This sensitivity was comparable to that of the IMS–rPCR assay (Fig. 2B) and was unaffected by the presence of 108 CFU/mL non-target bacteria cells (data not shown). 3.4. Detection of V. parahaemolyticus in artificially contaminated oysters In comparative analyses of artificially inoculated oysters, the sensitivity of the IMS–rPCR and IMS–LAMP assays for the direct detection of V. parahaemolyticus ATCC 17802 without enrichment was 1.9 × 103 CFU/g (1.9 × 102 CFU/mL, 11.4 CFU/reaction), which was 10-fold more sensitive than those of the rPCR and LAMP assays alone and 100-fold more sensitive than that of the CC method (Table 3). As for oyster samples that were inoculated with a low concentration (1.9 CFU/g) of V. parahaemolyticus ATCC 17802, the CC method required 12 h of enrichment to obtain a positive result, whereas the rPCR and LAMP methods required 10 h, the IMS–CC method required 8 h, and
Fig. 2. Comparison of sensitivities of immunomagnetic separation–loop-mediated isothermal amplification (IMS–LAMP) (A) and IMS–real-time polymerase chain reaction (IMS–rPCR) (B) with pure cultures of Vibrio parahaemolyticus ATCC 17802. Total bacterial DNA was extracted from the 10-fold serially diluted V. parahaemolyticus suspensions by immunomagnetic nanoparticles and measured by LAMP and rPCR, respectively. The curves that are shown are representative of triplicate experiments. Decreasing concentrations of bacterial cells (1.4 × 105 to 1.4 CFU/mL) are indicated from left to right.
the IMS–LAMP and IMS–rPCR methods required only 6 h of enrichment (Table 3). Analyses of samples that were inoculated with 0.19 CFU/g V. parahaemolyticus ATCC 17802 produced similar results, indicating that the enrichment time could be shortened by at least 4 h when using the IMS–LAMP method instead of methods without IMS (Table 3). 4. Discussion Recently, nanoparticles have opened new dimensions in IMS because of their unique optical properties, high surface-to-volume ratio, and other size-dependent qualities. In this study, novel magnetic nanoparticles with an average diameter of 70 nm were functionalized with monoclonal antibodies that were produced against flagella from V. parahaemolyticus to capture and separate the target cells from raw oysters. First, the CE was higher (N 70%) than previously reported CEs of 32% to 56% for the separation of V. parahaemolyticus (Datta et al., 2008). The difference in CEs could be attributed to the size of the magnetic beads. Varshney et al. (2005) reported that the surface area of nanoparticles with a diameter of 145 nm for capture of E. coli O157 was 78 times larger than that of magnetic microbeads (2.8-μm in diameter). Therefore, the IMNPs that were used in this study, which had a 70-nm diameter, should exhibit a higher surface-to-volume ratio and provide more binding sites for antibodies. Second, the binding reaction can be finished in half an hour (Fig. 1C) without shaking, and the immunoreaction took 60 min to 120 min on a shaker when magnetic microbeads were used in the IMS methods (Seo et al., 2010; Zhu et al., 2011). The most probable reason for this difference is the rapid binding kinetics of IMNPs to target cells. Liberti et al. (1996) showed that magnetic nanoparticles are 5- to 20-fold faster than 1- to 100-μm of magnetic microbeads in reaction kinetics. Nanoparticles, because of their small size, move by diffusion, whereas microbeads experience gravitational settling (Varshney et al., 2005). Hence, no mixing was required during the IMS of V. parahaemolyticus in this study because IMNPs had efficient diffusion properties. Previous studies showed that paramagnetic beads may exhibit a high degree of non-specific binding to various pathogens (Rijpens et al., 1999; Tomoyasu, 1998). In this study, a very low level of nonspecific binding of IMNPs was observed (Table 1), and this may have resulted from the shortened incubation time and the wash step after the binding reaction. In the future, the use of more specific antibodies and better solutions to block the non-specific sites of IMNPs could further reduce the number of non-specific interactions. Even if cross-reacting bacterial species were absorbed by the IMNPs, V. parahaemolyticus cells could be specifically detected by coupling the IMNPs with the LAMP amplification (Table 1). The specificity of this assay was largely controlled by the primer sets that were used during LAMP, which included eight distinct sequences that were required for recognition. When combining IMS with the LAMP assay, the sensitivities in pure cultures and in oyster homogenate were not dramatically different (Fig. 2A, Table 3), indicating that the oyster homogenate did not have an inhibitory effect on the binding capacity of the IMNPs. In contrast, Jeníková et al. (2000) reported that the binding capacity decreased significantly when IMS was performed with ground beef and attributed the reduced binding capacity to the high fat content of beef, which may entrap some beads in the food matrix. Therefore, the lack of interference from oyster homogenate might be explained by the lower fat content of oyster meat (about 2.4%) compared with ground beef (17%) (Varshney et al., 2005). Besides, the ability of IMNPs to concentrate target cells and remove PCR inhibitors of food origin may account for the added sensitivity of IMS–LAMP in spiked raw oysters when compared with methods without IMS (Table 3). The rapid detection of V. parahaemolyticus at a low limiting number (101 to 102 CFU/g) is very important to prevent seafood consumers from being infected by the highly offensive bacteria (Datta et al., 2008). To meet this demand, a 6-h enrichment step was used prior to detection (Table 3). This short enrichment procedure combined with
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
127
Table 3 Comparison of methods with or without immunomagnetic separation (IMS) for the detection of V. parahaemolyticus ATCC 17802 in seeded oysters. V. parahaemolyticus concentration (CFU/g)
1.9 1.9 1.9 1.9 1.9 1.9
× × × × × ×
5
10 104 103 102 101 10°
1.9 × 10−1
a b c d e
Enrichment time (h)
e
0 0 0 0 0 4 6 8 10 12 4 6 8 10 12
Results without IMSa
Results with IMSa
LAMPb
rPCRc
CCd
IMS–LAMP
IMS–rPCR
IMS–CC
+ + − − − − − − + + − − − − +
+ + − − − − − − + + − − − − +
+ − − − − − − − − + − − − − −
+ + + − − − + + + + − − + + +
+ + + − − − + + + + − − + + +
+ + − − − − − + + + − − − + +
The results of three independent experiments with artificially contaminated oyster samples. +, triplicate assays were all positive; and −, triplicate assays were all negative. LAMP, loop-mediated isothermal amplification. rPCR, real-time PCR. CC, conventional culture assay. Samples with high inoculating levels (1.9 × 101–1.9 × 105 CFU/g) were directly detected without enrichment.
simplified sample processing by IMS (b 1 h) and rapid LAMP confirmation (b50 min) would make it possible to complete the analysis within a workday. To our knowledge, this is the first report that combined IMS with the LAMP assay to target the species-specific tlh gene for the rapid detection of total V. parahaemolyticus from oyster samples, and the combination could easily be expanded for the comprehensive detection of pathogenic strains with a virulence gene-specific LAMP assay (Nemoto et al., 2009; Yamazaki et al., 2010). Moreover, V. parahaemolyticus can activate a viable but non-culturable (VBNC) state, and changes in surface antigens (Falcioni et al., 2008) may disguise the pathogen from the IMS method. Further studies will focus on the applicability of the developed IMS–LAMP method to detect VBNC cells of V. parahaemolyticus after recovery from cultures. In conclusion, the IMS–LAMP would be a significant assay to detect total V. parahaemolyticus in routine tests, and it has potential applications in the most probable number method. The IMS–LAMP assay has a potential value for the rapid, simple, and cost-effective screening of total V. parahaemolyticus-contaminated samples before they are consumed and can therefore facilitate the surveillance of V. parahaemolyticus contamination in seafood. Acknowledgments We gratefully acknowledge Xuesong Liu and Dong Cao for the monoclonal antibody preparation. References Campbell, M.S., Wright, A.C., 2003. Real-time PCR analysis of Vibrio vulnificus from oysters. Appl. Environ. Microbiol. 69, 7137–7144. Datta, S., Janes, M.E., Simonson, J.G., 2008. Immunomagnetic separation and coagglutination of Vibrio parahaemolyticus with anti-flagellar protein monoclonal antibody. Clin. Vaccine Immunol. 15, 1541–1546. Falcioni, T., Papa, S., Campana, R., Manti, A., Battistelli, M., Baffone, W., 2008. State transitions of Vibrio parahaemolyticus VBNC cells evaluated by flow cytometry. Cytometry B Clin. Cytom. 74, 272–281. Fedio, W.M., Jinneman, K.C., Yoshitomi, K.J., Zapata, R., Wendakoon, C.N., Browning, P., Weagant, S.D., 2011. Detection of E. coli O157:H7 in raw ground beef by Pathatrix™ immunomagnetic-separation, real-time PCR and cultural methods. Int. J. Food Microbiol. 148, 87–92. Gehring, A.G., Albin, D.M., Irwin, P.L., Reed, S.A., Tu, S.I., 2006. Comparison of enzyme-linked immunomagnetic chemiluminescence with U.S. Food and Drug Administration's Bacteriological Analytical Manual method for the detection of Escherichia coli O157:H7. J. Microbiol. Methods 67, 527–533.
Jacobsen, C.S., 1995. Microscale detection of specific bacterial DNA in soil with a magnetic capture-hybridization and PCR amplification assay. Appl. Environ. Microbiol. 61, 3347–3352. Jadeja, R., Janes, M.E., Simonson, J.G., 2010. Immunomagnetic separation of Vibrio vulnificus with antiflagellar monoclonal antibody. J. Food Prot. 73, 1288–1293. Jeníková, G., Pazlarová, J., Demnerová, K., 2000. Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Int. Microbiol. 3, 225–229. Kanayeva, D.A., Wang, R., Rhoads, D., Erf, G.F., Slavik, M.F., Tung, S., Li, Y., 2012. Efficient separation and sensitive detection of Listeria monocytogenes using an impedance immunosensor based on magnetic nanoparticles, a microfluidic chip, and an interdigitated microelectrode. J. Food Prot. 75, 1951–1959. Liberti, P.A., Chiarappa, J.N., Hovsepian, A.C., Rao, C.G., 1996. Bioreceptor ferrofluids: novel characteristics and their utility in medical applications. In: Pelizzetti, E. (Ed.), Fine Particles Science and Technology. Kluwer Academic Publishers, pp. 777–790. Liu, X., Zhang, L., Zeng, J., Gao, Y., Tang, Z., 2013. Superparamagnetic nano-immunobeads toward food safety insurance. J. Nanoparticle Res. 15, 1796–1805. Nemoto, J., Sugawara, C., Akahane, K., Hashimoto, K., Kojima, T., Ikedo, M., Konuma, H., Hara-Kudo, Y., 2009. Rapid and specific detection of the thermostable direct hemolysin gene in Vibrio parahaemolyticus by loop-mediated isothermal amplification. J. Food Prot. 72, 748–754. Nordstrom, J.L., Vickery, M.C., Blackstone, G.M., Murray, S.L., DePaola, A., 2007. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Appl. Environ. Microbiol. 73, 5840–5847. Ochoa, M.L., Harrington, P.B., 2005. Immunomagnetic isolation of enterohemorrhagic Escherichia coli O157:H7 from ground beef and identification by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and database searches. Anal. Chem. 77, 5258–5267. Okura, M., Osawa, R., Iguchi, A., Arakawa, E., Terajima, J., Watanabe, H., 2003. Genotypic analyses of Vibrio parahaemolyticus and development of a pandemic group-specific multiplex PCR assay. J. Clin. Microbiol. 41, 4676–4682. Potasman, I., Paz, A., Odeh, M., 2002. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin. Infect. Dis. 35, 921–928. Pyle, B.H., Broadaway, S.C., McFeters, G.A., 1999. Sensitive detection of Escherichia coli O157:H7 in food and water by immunomagnetic separation and solid-phase laser cytometry. Appl. Environ. Microbiol. 65, 1966–1972. Rijpens, N., Herman, L., Vereecken, F., Jannes, G., De Smedt, J., De Zutter, L., 1999. Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separation and PCR. Int. J. Food Microbiol. 46, 37–44. Seo, S.M., Cho, I.H., Jeon, J.W., Cho, H.K., Oh, E.G., Yu, H.S., Shin, S.B., Lee, H.J., Paek, S.H., 2010. An ELISA-on-a-chip biosensor system coupled with immunomagnetic separation for the detection of Vibrio parahaemolyticus within a single working day. J. Food Prot. 73, 1466–1473. Shim, W.B., Choi, J.G., Kim, J.Y., Yang, Z.Y., Lee, K.H., Kim, M.G., Ha, S.D., Kim, K.S., Kim, K.Y., Kim, C.H., Eremin, S.A., Chung, D.H., 2008. Enhanced rapidity for qualitative detection of Listeria monocytogenes using an enzyme-linked immunosorbent assay and immunochromatography strip test combined with immunomagnetic bead separation. J. Food Prot. 71, 781–789. Su, Y.C., Liu, C., 2007. Vibrio parahaemolyticus: a concern of seafood safety. Food Microbiol. 24, 549–558. Tomoyasu, T., 1998. Improvement of the immunomagnetic separation method selective for Escherichia coli O157 strains. Appl. Environ. Microbiol. 64, 376–382.
128
J. Zeng et al. / International Journal of Food Microbiology 174 (2014) 123–128
Varshney, M., Yang, L., Su, X.L., Li, Y., 2005. Magnetic nanoparticle-antibody conjugates for the separation of Escherichia coli O157:H7 in ground beef. J. Food Prot. 68, 1804–1811. Yamazaki, W., Kumeda, Y., Misawa, N., Nakaguchi, Y., Nishibuchi, M., 2010. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of the tdh and trh genes of Vibrio parahaemolyticus and related Vibrio species. Appl. Environ. Microbiol. 76, 820–828. Yang, H., Qu, L., Wimbrow, A.N., Jiang, X., Sun, Y., 2007. Rapid detection of Listeria monocytogenes by nanoparticle-based immunomagnetic separation and real-time PCR. Int. J. Food Microbiol. 118, 132–138. Yang, Y., Xu, F., Xu, H., Aguilar, Z.P., Niu, R., Yuan, Y., Sun, J., You, X., Lai, W., Xiong, Y., Wan, C., Wei, H., 2013. Magnetic nano-beads based separation combined with propidium monoazide treatment and multiplex PCR assay for simultaneous detection of viable
Salmonella typhimurium, Escherichia coli O157:H7 and Listeria monocytogenes in food products. Food Microbiol. 34, 418–424. Yoshitomi, K.J., Jinneman, K.C., Zapata, R., Weagant, S.D., Fedio, W.M., 2012. Detection and isolation of low levels of E. coli O157:H7 in cilantro by real-time PCR, immunomagnetic separation, and cultural methods with and without an acid treatment. J. Food Sci. 77, M481–M489. Zhu, P., Shelton, D.R., Li, S., Adams, D.L., Karns, J.S., Amstutz, P., Tang, C.M., 2011. Detection of E. coli O157:H7 by immunomagnetic separation coupled with fluorescence immunoassay. Biosens. Bioelectron. 30, 337–341. Zhu, R.G., Li, T.P., Jia, Y.F., Song, L.F., 2012. Quantitative study of viable Vibrio parahaemolyticus cells in raw seafood using propidium monoazide in combination with quantitative PCR. J. Microbiol. Methods 90, 262–266.