- Email: [email protected]
Rapid detection protocol for filoviruses
Journal of Clinical Virology 30 (2004) 94–99
Rapid detection protocol for filoviruses Manfred Weidmann a,∗ , Elke Mühlberger b , Frank T. Hufert a a
b
Department of Virology, Institute of Medical Microbiology and Hygiene, University of Freiburg, Hermann-Herder-Street 11, 79104 Freiburg, Germany Institute of Virologiy, Philipps Universität Marburg, Robert-Koch-Street 17, 35037 Marburg, Germany Accepted 10 September 2003
Abstract Background: The incidence of filovirus disease outbreaks has been increasing in recent years. Although there have been advances in the developments of diagnostics, field tests are rare. Apart from family members of infected patients, health care workers are at high risk of being infected during the initial phase of an outbreak. RT-PCR has been shown to be helpful in containing outbreaks. Objectives: To develop Taqman-RT-PCR for the detection of Ebola-Zaire virus (EBOV-Z), Ebola-Sudan virus (EBOV-S) and Marburg virus (MBGV). Study desgin: Quantitative Taqman-RT-PCRs for the detection of these viruses were developed and established on a portable Smartcycler TD. Results and conclusions: All three assays were highly sensitive and specific. The mobility of the assay system may help to contain future outbreaks. © 2003 Elsevier B.V. All rights reserved. Keywords: Filovirus; Ebola virus; Marburg virus; Taqman; Real-time PCR; Lightcycler; Smartcycler; Rapid detection
1. Introduction Since the sudden occurrence of Marburg disease in 1967 in Germany and Yougoslavia and the subsequent isolation of Marburg virus (MBGV) (Siegert et al., 1968) and the isolation of Ebola virus (EBOV) in Zaire in 1977 (Johnson et al., 1977) there have been, a recently ever increasing number, of Ebola and Marburg disease outbreaks in Africa. Ebola viruses are subdivided into four species: Ebola-Zaire (EBOV-Z), Ebola-Sudan (EBOV-S), Ebola–Ivory Coast (EBOV-IC), and Ebola-Reston (EBOV-R). The viruses elicit disease with fever, joint pain, muscle pain, and abdominal pain that tends to take a fulminant course leading to rapid deterioration with rapid respiration, bleeding, oliguria shock, and death after 6–9 weeks (Colebunders and Borchert, 2000) or days (Bitekyerezo et al., 2002). Disease mortality in reported outbreaks ranges from 74% to 88% for EBOV-Z (Khan et al., 1999), (Leroy et al., 2002) and from 53% to 65% for EBOV-S (Okware et al., 2002). A fatality rate of up to 83% has been reported for MBGV disease outbreaks (Muyembe-Tamfum et al., 2001).
∗ Corresponding author. Tel.: +49-761-203-6610; fax: +49-761-203-6608. E-mail address: [email protected] (M. Weidmann).
1386-6532/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2003.09.004
Although diagnosis is often presumptive and laboratory confirmation essential, laboratory tests have been available on-site only during very recent epidemics, testing being mainly performed on stored samples sent to specialized laboratories (Colebunders and Borchert, 2000). A method to collect formalin-fixed skin specimen for laboratory testing and the use of immunohistochemistry on these specimen has been successfully used in a long-term disease surveillance program in the Bandundu region of the Democratic Republic of the Congo initiated after the Kikwit outbreak. (Lloyd et al., 1999; Zaki et al., 1999). In Gulu, case identification of Ebola haemorrhagic fever (EHF) relied on active case surveillance and clinical symptom categories. Laboratory diagnostics were performed in a field lab maintained by a CDC team using RT-PCR and IgG-ELISA and the NIV in South Africa as a backup lab (Okware et al., 2002). During the outbreak in Gulu, 425 persons were infected in three districts. Epidemiological findings were that transmission occurred at funerals of presumptive EHF case patients were ritual contact with the deceased occurred. Intrafamilial and nosocomial transmission also spread the disease to 22 health care workers infected in Gulu (2001). Similarily, in the Kikwit outbreak more than 70% of the first generation of patients were health care workers (Khan et al., 1999). Ill patients have a very high viremia, and RT-PCR has been
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
shown to be useful in an epidemic setting (Leroy et al., 2000 ; Sanchez et al., 1999). It is also routinely used on shipped specimen in specialized laboratories (Guimard et al., 1999). We have developed rapid Taqman-RT-PCR assays for EBOV-Z, EBOV-S, and MBGV. The assays are highly sensitive and specific, can be operated on a portable Smartcycler TD, and could therefore be of use for mobile investigation teams.
2. Material and methods 2.1. One-step Taqman-RT-PCR Amplicons were placed into conserved regions of sequence alignments done with the Megalign software (DNAstar, Lasergene, USA). Primers were designed for an annealing TM of 58–60 ◦ C using the PCR-document window of the Primer-Express software (Applied Biosystems, USA) which operates using the algorithm (nearest neighbor method) developed by Rychlik et al., 1990. Species-specific amplicons were designed in conserved regions. The TM of the 5 FAM and 3 TAMRA tagged probes ranged from 68 to 70 ◦ C. RT-PCR conditions for the Lightcycler (Roche, Germany): RT at 53 ◦ C/5 min and 40 cycles of PCR at 95 ◦ C/5 s, 60 ◦ C/50 s. We used the RNA-Master-Hybridization-Probes-Kit (Roche, Germany) with 500 nM primers and 200 nM probes. RT-PCR conditions for the Smartcycler (Cepheid, USA): RT at 53 ◦ C/5 min and 40 cycles of PCR at 95 ◦ C/5 s, 60 ◦ C/50 s (reaction conditions in 25 l total volume: 1 U RAV-2/1 U Tth, 500 M dNTPs, 500 nM primers, 200 nM probes, in 50 mM Bicine (pH 8.2), 115 mM KOAc, 5 mM Mn(OAc)2 , 8% glycerol, and Smartcycler additive reagent (200 mM Tris–HCl, pH 8.0, 200 ng/ml BSA, 0.15 M trehalose, between 0.2%–20%). To increase sensitivity, 2 g of the single strand binding protein GP32 (Roche, Germany) were added per reaction (Schwarz et al., 1990). 2.2. Cell culture and RNA extraction EDOV-Z and MBGV were cultured on VeroE6-cells, EBOV-S, and EBOV-R on Huh-T7 cells as described in Muhlberger et al. (1992). Viral RNA was extracted from culture supernatants using RNeasy columns (Qiagen, Germany) according to the manufacturers instructions.
3. Results 3.1. Primer design When surveying all sequences for EBOV-Z and MBGV we found most sequences published for the nucleoprotein (NP) gene. Primers and probes were placed into blocks of conserved sequences across sequence alignments of the
95
nucleoprotein gene sequences of variant Ebola and Marburg isolates. The advantage of the Taqman chemistry (two primers, one probe) being the need for three blocks of conserved sequences across the species variants as opposed to four blocks for the hydprobe chemistry (two primers, two probes). The amplicon for EBOV-Z was placed into a highly conserved region of the EBOV-Z nucleoprotein gene (nt 1854–1923 in reference to the EBV sequence NC002549). Unfortunately, only one EBOV-S sequence has been published for this gene. Assuming that the region is also conserved in EBOV-S, we placed the EBOV-S amplicon into the same region, which shows sufficient divergence to the EBOV-Z sequences (Fig. 1A). The amplicon for MBGV was placed into a highly conserved region of the MBGV nucleoprotein gene upstream from the target site for the EBV viruses (Fig. 1B, nt 1180–1256 in reference to the MBGV sequence NC001608). 3.2. Cloning of nucleoprotein genes and PCR-transcription We amplified the nucleoproteins of EBOV-Z and MBGV from a recombinant pcDNA3 plasmid carrying the nucleoprotein of EBOV-Z and from a recombinant pQE32 plasmid carrying the nucleoprotein of MBGV using the primers listed in Table 1. The amplificates were cloned into pCRII by TA-cloning. Positive orientation of the recloned amplificates was confirmed by full-length sequencing of the sequences cloned into pCRII. Next the sequences cloned into pCRII were reamplified by using the M13 reverse primer and the M13 forward (−20) primer, which hybridize to sequences flanking the multiple cloning site (MCS) of pCRII. The M13-primer amplificate included the SP6 promoter upstream of the MCS and the T7 promoter downstream of the MCS. After purification of the M13-primer amplificate, Table 1 Primers used to amplify S-fragments and for species-specific RT-PCR Name
Nucleoprotein primer
EBOORF UP EBOORF DP MARORF UP MARORF DP M13 FP M13 (−20) RP
ATGGATTCTCGTCCTCAGAAAAT TCACTGATGATGTTGCAGGATT ATGGATTTACACAGTTTGTTGGAGT CTACAAGTTCATCGCAACATGTCT GTAAAACGACGGCCAG CAGGAAACAGCTATGAC
ENZ FP ENZ P ENZ RP ENS FP ENS P ENS RP MN FP MN P MN RP
Species primer and probes ATGATGGAAGCTACGGCG CCAGAGTTACTCGGAAAACGGCATG AGGACCAAGTCATCTGGTGC TTGACCCGTATGATGATGAGAGTA CCTGACTACGAGGATTCGGCTGAAGG CAAATTGAAGAGATCAAGATCTCCT CAATTCCACCTTCAGAAAACTG CACACACAGTCAGACACTAGCCGTCCT GCTAATTTTTCTCGTTTCTGGCT
All primers are shown in 5 –3 orientation. The Taqman probes had 5 -FAM and 3 -TAMRA dye tags.
96
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Fig. 1. Target amplicons. (A) Alignment of all available EBOVS and EBOVZ nucleoprotein gene sequences and primers. Nucleotides in red differ from the consensus of the total alignment. The marked differences between EBOVS and EBOVZ can be judged by the sequence variations and the gapping. (B) Alignment of MBGV nucleoprotein gene sequences and primers.
2 g of amplificate were used for SP-6 transcription. The resulting positive single strand RNA was used to generate RNA standards for EBOV-Z and MBGV.
Table 2 Interassay variability of filovirus assays Standard RNA molecules
MBGV S.D. of CT values
EBOV-Z S.D. of CT values
3.3. Performance and sensitivity of the species-specific EBOV-Z and MBGV assays
107 106 105 104 103 102 101
0.20 0.06 0.04 0.73 0.13 0.04 0.78 0.28
0.28 0.23 0.21 0.61 0.80 0.31 0.96 0.48
When the species-specific amplicons for EBOV-Z and MBGV were tested on the RNA standards, we found the amplicons to be very efficient and highly sensitive. We achieved detection sensitivities of 10 RNA molecules with the EBOV-Z and the MBGV amplicons on the Lightcycler using the RNA-Amplification-Hybridisation-Probes-Kit (Roche, Germany) and on the Smartcycler TD using the RAV-2/Tth enzyme mix suggested by Kuno (1998) (see Figs. 2 and 3.). We did not generate a quantification standard for EBOV-S and assessed the sensitivity by diluting the RNA prepared from cell culture supernatant. The limit of detection (LOD) was at a dilution of 10−7 , which was identical to the LOD of the other two assays, and therefore the EBOV-S assay has a comparable sensitivity. We tested the intra-assay variation of the EBOV-Z and MBGV assay by running the 102 and the 106 RNA molecules standards simultaneously on eight reaction chambers of the Smartcycler. The CT standard mean deviation (S.D.) ranged from 0.097 to 0.668 CT for 106 –102 RNA molecules detected and from 0.183 to 0.668 CT for 106 –102 RNA molecules detected for the EBOV-Z assay and for the MBGV assay, respectively. The inter-assay variation was assessed by running each standard range on three consecutive days. The standard deviations of the single standard points are listed in Table 2, the mean of the standard deviations was 0.28 CT for the MBGV assay and 0.48 CT for the EBOV assay.
The standard mean deviation (S.D.) of the CT of each standard point of three separate standard runs are listed. The last line gives the overall CT standard mean deviation for each assay.
3.4. Specificity of the EBOV-Z, EBOV-S, and MBGV assays The specificity of the EBOV-Z, EBOV-S, and MBGV assays was checked by cross-amplification of RNA extracted from cell cultures infected with EBOV-Z, EBOV-S, EBOV-R, (Reston) and MBGV (Fig. 2 panels A–C). The presence of the RNA in the extracts from these cultures was confirmed by separate analysis with in-house RT-PCRs at the Institute of Virology in Marburg (Fig. 2 panel D). We found our species-specific assays highly specific to the strains they had been designed for. Each assay was tested on the RNAs extracted from all filovirus cultures available and no cross-amplification was observed.
4. Discussion Filovirus infections are very severe and highly contagious (Colebunders and Borchert, 2000). They are rare
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
97
Fig. 2. Cross amplification test. (A) EBOV-Z assay. (B) EBOV-S assay. (C) MBGV assay. Cross-amplification was performed with synthetic RNA produced for EBOV-Z and MBGV and viral RNA of EBOV-Z, EBOV-S, EBOV-R, and MBGV from infected cell cultures. (D) Detection of viral RNA in cell culture supernatant by in-house RT-PCR. (1) marker (50 bp ladder), (2) EBOV-Z-RNA, (3) EBOV-S-RNA, (4) MBGV-RNA, (5) EBOV-R-RNA, and (6) negative control.
diseases and initially present as non-specific acute fevers (Bitekyerezo et al., 2002). Mortality can be very high and transmission during an outbreak requires direct contact to an infected patient or his bodily fluids (Dowell et al., 1999). Therefore, identification and isolation of
suspected patients is essential in controlling a filovirus outbreak. The three assays presented here should be helpful for an initial identification of the filovirus involved in an outbreak. As soon as a specific strain has been identified, only one
98
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Fig. 3. Performance of RNA standards for EBOV-Z and MBGV. Panels A and C show the performance of the amplicons for EBOV-Z and MBGV on their respective synthetic standards. Standard points range from 107 –101 . Panels B and D show the respective standard correlations.
specific assay is needed for continuous diagnostic screening and monitoring throughout the outbreak. Confirming the status of suspect cases by rapid detection can help to support the effectiveness of isolation measures, and thereby contribute to the safety of health workers. In doing so, it could also reduce the anguish experienced by those suspected to be Ebola patient contacts, waiting to know whether they are indeed infected or not (Locsin and Matua, 2002). Detection of EBOV-RNA in blood samples by two-step RT-PCR has been shown to be an effective rapid and reliable tool for low cost diagnosis in an outbreak situation in Gabon (Leroy et al., 2000). Previous publications have described Syber green assays for EBOV and MBGV on the Lightcycler (Drosten et al., 2002), and a EBOV-Z and EBOV-S, and a MBGV assay on the ABI 7700 (Gibb et al., 2001a,b). In nucleic acid diagnostics, specific probe assay formats such as Taqman probes and hydprobes are superior to unspecific Syber green assays. For the design of fluorescent probe assays across highly variant RNA virus sequences, Taqman assays have the adavantage of needing only three oligonucleotides instead of four as in hydprobe assays (Gibb et al., 2001a,b; Weidmann et al., 2003). All three assays presented here are highly specific and sensitive. Two of our assays have the combined advantage of using synthetic RNA standards for quantification with the potential to facilitate monitoring of viral load in patients. All assays perform reliably on the Smartcycler TD as inter- and intra-assay variation of the assays are minute. The feasibility of PCR in the field us-
ing the Smartcycler TD has been described (Schaad, N.W. et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, third ed. APS Press) and this feature could help to overcome the notorious problems of sample transportation in Africa or at least improve the capabilities of initial investigation teams. Latest developments like RCR beads or coated reaction tubes ‘ready-to-use’ containing all necessary ingredients for PCR will help to facilitate field PCR. The assays presented here can reduce the hands on time for one-step RT-PCR considerably, since amplification and analysis of the amplificate by fluorescent probe can be completed in an hour as compared to almost a days work for two-step RT-PCR and gel analysis. One still has to calculate the time needed for RNA preparation and setting up the PCR assay itself but overall a considerable time saving effect can be achieved with this accurate method. The diagnostic assays we have developed should be able to improve early detection and identification of filoviruses at an early stage of a suspected filovirus disease. The specificity of any nucleic acid test is directly dependent on the available sequence information. A negative result never excludes a false negative due to sequence variations. To keep nucleic acid detection assays up to date, and to be able to identify conservative regions in sequence alignments for oligonucleotide design it is imperative that sequences of isolates from recent outbreaks should be made available. As yet there have been no sequence submissions to the data banks from the large filovirus disease outbreaks in Uganda in 2000–2001 or in Gabon/Congo 2001/2003.
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Acknowledgements This work was supported by grants InSanI 0598-V4301 and InSanI 030-V4304 of the Bundesministerium für Verteidigung, Germany. We are indebted to Melanie Feuerstein and Heike Schley for perfect technical assistance.
References Bitekyerezo M, et al. The outbreak and control of Ebola viral haemorrhagic fever in a Ugandan medical school. Trop Doct 2002;32:10–5. Colebunders R, Borchert M. Ebola haemorrhagic fever—a review. J Infect 2000;40:16–20. Dowell SF, Mukunu R, Ksiazek TG, Khan AS, Rollin PE, Peters CJ. Transmission of Ebola hemorrhagic fever: a study of risk factors in family members, Kikwit, Democratic Republic of the Congo, 1995. Commission de Lutte contre les Epidemies a Kikwit. J Infect Dis 1999;179(Suppl 1):S87–91. Drosten C, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol 2002;40:2323– 30. Gibb TR, Norwood Jr DA, Woollen N, Henchal EA. Development and evaluation of a fluorogenic 5 nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan. J Clin Microbiol 2001a;39:4125–30. Gibb TR, Norwood Jr DA, Woollen N, Henchal EA. Development and evaluation of a fluorogenic 5 -nuclease assay to identify Marburg virus. Mol Cell Probes 2001b;15:259–66. Guimard Y, et al. Organization of patient care during the Ebola hemorrhagic fever epidemic in Kikwit, Democratic Republic of the Congo, 1995. J Infect Dis 1999;179(Suppl 1):S268–73. Johnson KM, Lange JV, Webb PA, Murphy FA. Isolation and partial characterisation of a new virus causing acute haemorrhagic fever in Zaire. Lancet 1977;1:569–71. Khan AS, et al. The reemergence of Ebola hemorrhagic fever, Democratic Republic of the Congo, 1995. Commission de Lutte contre les Epidemies a Kikwit. J Infect Dis 1999;179(Suppl 1):S76–86.
99
Khan, ASTF, Heymann, DL, Le Guenno, B, Nabeth, P, Kerstiens, B, Fleerackers, YKP, et al. The reemergence of Ebola hemorrhagic fever, Democratic Republic of the Congo, 1995. J. Infect. Dis. 179, S76–S86. Kuno G. Universal diagnostic RT-PCR protocol for arboviruses. J Virol Methods 1998;72:27–41. Leroy EM, Souquiere S, Rouquet P, Drevet D. Re-emergence of ebola haemorrhagic fever in Gabon. Lancet 2002;359:712. Leroy EM, et al. Diagnosis of Ebola haemorrhagic fever by RT-PCR in an epidemic setting. J Med Virol 2000;60:463–7. Lloyd, ESZS, Rollin, PE, Tshioko, K, Bwaka, MA, Ksiazek, TG, Calain, P, et al. Long-term disease surveillance in Bandundu region, Democratic Republic of the Congo: a model for early detection and prevention of Ebola hemorrhagic fever. J. Infect. Dis. 179, S274–S280. Locsin RC, Matua AG. The lived experience of waiting-to-know: Ebola at Mbarara, Uganda—hoping for life, anticipating death. J Adv Nurs 2002;37:173–81. Muhlberger E, et al. The nucleotide sequence of the L gene of Marburg virus, a filovirus: homologies with paramyxoviruses and rhabdoviruses. Virology 1992;187:534–47. Muyembe-Tamfum J-J, Borchert M, Swanepoel R, Bausch DG, Tshioko FK, Roth C, et al. Marburg hemorrhagic fever in Watsa/Durba (DRC): an endemoepidemic phenomenon. Infect Dis Rev 2001;3:34–45. Okware SI, et al. An outbreak of Ebola in Uganda. Trop Med Int Health 2002;7:1068–75. Rychlik W, Spencer WJ, Rhoads RE. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res 1990;18:6409–12. Sanchez, A.K.T., Rollin, P.E., Miranda, M.E., Trappier, S.G., Khan, A.S., Peters, C.J.N.S. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates. J. Infect. Dis. 179, S164–S169. Schwarz K, Hansen-Hagge T, Bartram C. Improved yields of long PCR products using gene 32 protein. Nucleic Acids Res 1990;18:1079. Siegert R, Shu HL, Slenczka W. Isolation and identification of the “Marburg virus”. Deutsche Medizinische Wochenschrift 1968;93:604– 12. Weidmann, M.R., Nunes, R.M.R.T. Vasconcelos, P.F.C., Hufert, F.T. Rapid detection of human pathogenic orthobunyaviruses. J. Clin. Microb. 41. Zaki, SRSW, Greer, PW, Goldsmith, CS, Ferebee, T, Katshitshi, J, Tshioko, FKBM, et al. A novel immunohistochemical assay for the detection of Ebola virus in skin: implications for diagnosis, spread, and surveillance of Ebola hemorrhagic fever. J. Infect. Dis. 179, S36–S47.
Rapid detection protocol for filoviruses Manfred Weidmann a,∗ , Elke Mühlberger b , Frank T. Hufert a a
b
Department of Virology, Institute of Medical Microbiology and Hygiene, University of Freiburg, Hermann-Herder-Street 11, 79104 Freiburg, Germany Institute of Virologiy, Philipps Universität Marburg, Robert-Koch-Street 17, 35037 Marburg, Germany Accepted 10 September 2003
Abstract Background: The incidence of filovirus disease outbreaks has been increasing in recent years. Although there have been advances in the developments of diagnostics, field tests are rare. Apart from family members of infected patients, health care workers are at high risk of being infected during the initial phase of an outbreak. RT-PCR has been shown to be helpful in containing outbreaks. Objectives: To develop Taqman-RT-PCR for the detection of Ebola-Zaire virus (EBOV-Z), Ebola-Sudan virus (EBOV-S) and Marburg virus (MBGV). Study desgin: Quantitative Taqman-RT-PCRs for the detection of these viruses were developed and established on a portable Smartcycler TD. Results and conclusions: All three assays were highly sensitive and specific. The mobility of the assay system may help to contain future outbreaks. © 2003 Elsevier B.V. All rights reserved. Keywords: Filovirus; Ebola virus; Marburg virus; Taqman; Real-time PCR; Lightcycler; Smartcycler; Rapid detection
1. Introduction Since the sudden occurrence of Marburg disease in 1967 in Germany and Yougoslavia and the subsequent isolation of Marburg virus (MBGV) (Siegert et al., 1968) and the isolation of Ebola virus (EBOV) in Zaire in 1977 (Johnson et al., 1977) there have been, a recently ever increasing number, of Ebola and Marburg disease outbreaks in Africa. Ebola viruses are subdivided into four species: Ebola-Zaire (EBOV-Z), Ebola-Sudan (EBOV-S), Ebola–Ivory Coast (EBOV-IC), and Ebola-Reston (EBOV-R). The viruses elicit disease with fever, joint pain, muscle pain, and abdominal pain that tends to take a fulminant course leading to rapid deterioration with rapid respiration, bleeding, oliguria shock, and death after 6–9 weeks (Colebunders and Borchert, 2000) or days (Bitekyerezo et al., 2002). Disease mortality in reported outbreaks ranges from 74% to 88% for EBOV-Z (Khan et al., 1999), (Leroy et al., 2002) and from 53% to 65% for EBOV-S (Okware et al., 2002). A fatality rate of up to 83% has been reported for MBGV disease outbreaks (Muyembe-Tamfum et al., 2001).
∗ Corresponding author. Tel.: +49-761-203-6610; fax: +49-761-203-6608. E-mail address: [email protected] (M. Weidmann).
1386-6532/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2003.09.004
Although diagnosis is often presumptive and laboratory confirmation essential, laboratory tests have been available on-site only during very recent epidemics, testing being mainly performed on stored samples sent to specialized laboratories (Colebunders and Borchert, 2000). A method to collect formalin-fixed skin specimen for laboratory testing and the use of immunohistochemistry on these specimen has been successfully used in a long-term disease surveillance program in the Bandundu region of the Democratic Republic of the Congo initiated after the Kikwit outbreak. (Lloyd et al., 1999; Zaki et al., 1999). In Gulu, case identification of Ebola haemorrhagic fever (EHF) relied on active case surveillance and clinical symptom categories. Laboratory diagnostics were performed in a field lab maintained by a CDC team using RT-PCR and IgG-ELISA and the NIV in South Africa as a backup lab (Okware et al., 2002). During the outbreak in Gulu, 425 persons were infected in three districts. Epidemiological findings were that transmission occurred at funerals of presumptive EHF case patients were ritual contact with the deceased occurred. Intrafamilial and nosocomial transmission also spread the disease to 22 health care workers infected in Gulu (2001). Similarily, in the Kikwit outbreak more than 70% of the first generation of patients were health care workers (Khan et al., 1999). Ill patients have a very high viremia, and RT-PCR has been
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
shown to be useful in an epidemic setting (Leroy et al., 2000 ; Sanchez et al., 1999). It is also routinely used on shipped specimen in specialized laboratories (Guimard et al., 1999). We have developed rapid Taqman-RT-PCR assays for EBOV-Z, EBOV-S, and MBGV. The assays are highly sensitive and specific, can be operated on a portable Smartcycler TD, and could therefore be of use for mobile investigation teams.
2. Material and methods 2.1. One-step Taqman-RT-PCR Amplicons were placed into conserved regions of sequence alignments done with the Megalign software (DNAstar, Lasergene, USA). Primers were designed for an annealing TM of 58–60 ◦ C using the PCR-document window of the Primer-Express software (Applied Biosystems, USA) which operates using the algorithm (nearest neighbor method) developed by Rychlik et al., 1990. Species-specific amplicons were designed in conserved regions. The TM of the 5 FAM and 3 TAMRA tagged probes ranged from 68 to 70 ◦ C. RT-PCR conditions for the Lightcycler (Roche, Germany): RT at 53 ◦ C/5 min and 40 cycles of PCR at 95 ◦ C/5 s, 60 ◦ C/50 s. We used the RNA-Master-Hybridization-Probes-Kit (Roche, Germany) with 500 nM primers and 200 nM probes. RT-PCR conditions for the Smartcycler (Cepheid, USA): RT at 53 ◦ C/5 min and 40 cycles of PCR at 95 ◦ C/5 s, 60 ◦ C/50 s (reaction conditions in 25 l total volume: 1 U RAV-2/1 U Tth, 500 M dNTPs, 500 nM primers, 200 nM probes, in 50 mM Bicine (pH 8.2), 115 mM KOAc, 5 mM Mn(OAc)2 , 8% glycerol, and Smartcycler additive reagent (200 mM Tris–HCl, pH 8.0, 200 ng/ml BSA, 0.15 M trehalose, between 0.2%–20%). To increase sensitivity, 2 g of the single strand binding protein GP32 (Roche, Germany) were added per reaction (Schwarz et al., 1990). 2.2. Cell culture and RNA extraction EDOV-Z and MBGV were cultured on VeroE6-cells, EBOV-S, and EBOV-R on Huh-T7 cells as described in Muhlberger et al. (1992). Viral RNA was extracted from culture supernatants using RNeasy columns (Qiagen, Germany) according to the manufacturers instructions.
3. Results 3.1. Primer design When surveying all sequences for EBOV-Z and MBGV we found most sequences published for the nucleoprotein (NP) gene. Primers and probes were placed into blocks of conserved sequences across sequence alignments of the
95
nucleoprotein gene sequences of variant Ebola and Marburg isolates. The advantage of the Taqman chemistry (two primers, one probe) being the need for three blocks of conserved sequences across the species variants as opposed to four blocks for the hydprobe chemistry (two primers, two probes). The amplicon for EBOV-Z was placed into a highly conserved region of the EBOV-Z nucleoprotein gene (nt 1854–1923 in reference to the EBV sequence NC002549). Unfortunately, only one EBOV-S sequence has been published for this gene. Assuming that the region is also conserved in EBOV-S, we placed the EBOV-S amplicon into the same region, which shows sufficient divergence to the EBOV-Z sequences (Fig. 1A). The amplicon for MBGV was placed into a highly conserved region of the MBGV nucleoprotein gene upstream from the target site for the EBV viruses (Fig. 1B, nt 1180–1256 in reference to the MBGV sequence NC001608). 3.2. Cloning of nucleoprotein genes and PCR-transcription We amplified the nucleoproteins of EBOV-Z and MBGV from a recombinant pcDNA3 plasmid carrying the nucleoprotein of EBOV-Z and from a recombinant pQE32 plasmid carrying the nucleoprotein of MBGV using the primers listed in Table 1. The amplificates were cloned into pCRII by TA-cloning. Positive orientation of the recloned amplificates was confirmed by full-length sequencing of the sequences cloned into pCRII. Next the sequences cloned into pCRII were reamplified by using the M13 reverse primer and the M13 forward (−20) primer, which hybridize to sequences flanking the multiple cloning site (MCS) of pCRII. The M13-primer amplificate included the SP6 promoter upstream of the MCS and the T7 promoter downstream of the MCS. After purification of the M13-primer amplificate, Table 1 Primers used to amplify S-fragments and for species-specific RT-PCR Name
Nucleoprotein primer
EBOORF UP EBOORF DP MARORF UP MARORF DP M13 FP M13 (−20) RP
ATGGATTCTCGTCCTCAGAAAAT TCACTGATGATGTTGCAGGATT ATGGATTTACACAGTTTGTTGGAGT CTACAAGTTCATCGCAACATGTCT GTAAAACGACGGCCAG CAGGAAACAGCTATGAC
ENZ FP ENZ P ENZ RP ENS FP ENS P ENS RP MN FP MN P MN RP
Species primer and probes ATGATGGAAGCTACGGCG CCAGAGTTACTCGGAAAACGGCATG AGGACCAAGTCATCTGGTGC TTGACCCGTATGATGATGAGAGTA CCTGACTACGAGGATTCGGCTGAAGG CAAATTGAAGAGATCAAGATCTCCT CAATTCCACCTTCAGAAAACTG CACACACAGTCAGACACTAGCCGTCCT GCTAATTTTTCTCGTTTCTGGCT
All primers are shown in 5 –3 orientation. The Taqman probes had 5 -FAM and 3 -TAMRA dye tags.
96
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Fig. 1. Target amplicons. (A) Alignment of all available EBOVS and EBOVZ nucleoprotein gene sequences and primers. Nucleotides in red differ from the consensus of the total alignment. The marked differences between EBOVS and EBOVZ can be judged by the sequence variations and the gapping. (B) Alignment of MBGV nucleoprotein gene sequences and primers.
2 g of amplificate were used for SP-6 transcription. The resulting positive single strand RNA was used to generate RNA standards for EBOV-Z and MBGV.
Table 2 Interassay variability of filovirus assays Standard RNA molecules
MBGV S.D. of CT values
EBOV-Z S.D. of CT values
3.3. Performance and sensitivity of the species-specific EBOV-Z and MBGV assays
107 106 105 104 103 102 101
0.20 0.06 0.04 0.73 0.13 0.04 0.78 0.28
0.28 0.23 0.21 0.61 0.80 0.31 0.96 0.48
When the species-specific amplicons for EBOV-Z and MBGV were tested on the RNA standards, we found the amplicons to be very efficient and highly sensitive. We achieved detection sensitivities of 10 RNA molecules with the EBOV-Z and the MBGV amplicons on the Lightcycler using the RNA-Amplification-Hybridisation-Probes-Kit (Roche, Germany) and on the Smartcycler TD using the RAV-2/Tth enzyme mix suggested by Kuno (1998) (see Figs. 2 and 3.). We did not generate a quantification standard for EBOV-S and assessed the sensitivity by diluting the RNA prepared from cell culture supernatant. The limit of detection (LOD) was at a dilution of 10−7 , which was identical to the LOD of the other two assays, and therefore the EBOV-S assay has a comparable sensitivity. We tested the intra-assay variation of the EBOV-Z and MBGV assay by running the 102 and the 106 RNA molecules standards simultaneously on eight reaction chambers of the Smartcycler. The CT standard mean deviation (S.D.) ranged from 0.097 to 0.668 CT for 106 –102 RNA molecules detected and from 0.183 to 0.668 CT for 106 –102 RNA molecules detected for the EBOV-Z assay and for the MBGV assay, respectively. The inter-assay variation was assessed by running each standard range on three consecutive days. The standard deviations of the single standard points are listed in Table 2, the mean of the standard deviations was 0.28 CT for the MBGV assay and 0.48 CT for the EBOV assay.
The standard mean deviation (S.D.) of the CT of each standard point of three separate standard runs are listed. The last line gives the overall CT standard mean deviation for each assay.
3.4. Specificity of the EBOV-Z, EBOV-S, and MBGV assays The specificity of the EBOV-Z, EBOV-S, and MBGV assays was checked by cross-amplification of RNA extracted from cell cultures infected with EBOV-Z, EBOV-S, EBOV-R, (Reston) and MBGV (Fig. 2 panels A–C). The presence of the RNA in the extracts from these cultures was confirmed by separate analysis with in-house RT-PCRs at the Institute of Virology in Marburg (Fig. 2 panel D). We found our species-specific assays highly specific to the strains they had been designed for. Each assay was tested on the RNAs extracted from all filovirus cultures available and no cross-amplification was observed.
4. Discussion Filovirus infections are very severe and highly contagious (Colebunders and Borchert, 2000). They are rare
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
97
Fig. 2. Cross amplification test. (A) EBOV-Z assay. (B) EBOV-S assay. (C) MBGV assay. Cross-amplification was performed with synthetic RNA produced for EBOV-Z and MBGV and viral RNA of EBOV-Z, EBOV-S, EBOV-R, and MBGV from infected cell cultures. (D) Detection of viral RNA in cell culture supernatant by in-house RT-PCR. (1) marker (50 bp ladder), (2) EBOV-Z-RNA, (3) EBOV-S-RNA, (4) MBGV-RNA, (5) EBOV-R-RNA, and (6) negative control.
diseases and initially present as non-specific acute fevers (Bitekyerezo et al., 2002). Mortality can be very high and transmission during an outbreak requires direct contact to an infected patient or his bodily fluids (Dowell et al., 1999). Therefore, identification and isolation of
suspected patients is essential in controlling a filovirus outbreak. The three assays presented here should be helpful for an initial identification of the filovirus involved in an outbreak. As soon as a specific strain has been identified, only one
98
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Fig. 3. Performance of RNA standards for EBOV-Z and MBGV. Panels A and C show the performance of the amplicons for EBOV-Z and MBGV on their respective synthetic standards. Standard points range from 107 –101 . Panels B and D show the respective standard correlations.
specific assay is needed for continuous diagnostic screening and monitoring throughout the outbreak. Confirming the status of suspect cases by rapid detection can help to support the effectiveness of isolation measures, and thereby contribute to the safety of health workers. In doing so, it could also reduce the anguish experienced by those suspected to be Ebola patient contacts, waiting to know whether they are indeed infected or not (Locsin and Matua, 2002). Detection of EBOV-RNA in blood samples by two-step RT-PCR has been shown to be an effective rapid and reliable tool for low cost diagnosis in an outbreak situation in Gabon (Leroy et al., 2000). Previous publications have described Syber green assays for EBOV and MBGV on the Lightcycler (Drosten et al., 2002), and a EBOV-Z and EBOV-S, and a MBGV assay on the ABI 7700 (Gibb et al., 2001a,b). In nucleic acid diagnostics, specific probe assay formats such as Taqman probes and hydprobes are superior to unspecific Syber green assays. For the design of fluorescent probe assays across highly variant RNA virus sequences, Taqman assays have the adavantage of needing only three oligonucleotides instead of four as in hydprobe assays (Gibb et al., 2001a,b; Weidmann et al., 2003). All three assays presented here are highly specific and sensitive. Two of our assays have the combined advantage of using synthetic RNA standards for quantification with the potential to facilitate monitoring of viral load in patients. All assays perform reliably on the Smartcycler TD as inter- and intra-assay variation of the assays are minute. The feasibility of PCR in the field us-
ing the Smartcycler TD has been described (Schaad, N.W. et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, third ed. APS Press) and this feature could help to overcome the notorious problems of sample transportation in Africa or at least improve the capabilities of initial investigation teams. Latest developments like RCR beads or coated reaction tubes ‘ready-to-use’ containing all necessary ingredients for PCR will help to facilitate field PCR. The assays presented here can reduce the hands on time for one-step RT-PCR considerably, since amplification and analysis of the amplificate by fluorescent probe can be completed in an hour as compared to almost a days work for two-step RT-PCR and gel analysis. One still has to calculate the time needed for RNA preparation and setting up the PCR assay itself but overall a considerable time saving effect can be achieved with this accurate method. The diagnostic assays we have developed should be able to improve early detection and identification of filoviruses at an early stage of a suspected filovirus disease. The specificity of any nucleic acid test is directly dependent on the available sequence information. A negative result never excludes a false negative due to sequence variations. To keep nucleic acid detection assays up to date, and to be able to identify conservative regions in sequence alignments for oligonucleotide design it is imperative that sequences of isolates from recent outbreaks should be made available. As yet there have been no sequence submissions to the data banks from the large filovirus disease outbreaks in Uganda in 2000–2001 or in Gabon/Congo 2001/2003.
M. Weidmann et al. / Journal of Clinical Virology 30 (2004) 94–99
Acknowledgements This work was supported by grants InSanI 0598-V4301 and InSanI 030-V4304 of the Bundesministerium für Verteidigung, Germany. We are indebted to Melanie Feuerstein and Heike Schley for perfect technical assistance.
References Bitekyerezo M, et al. The outbreak and control of Ebola viral haemorrhagic fever in a Ugandan medical school. Trop Doct 2002;32:10–5. Colebunders R, Borchert M. Ebola haemorrhagic fever—a review. J Infect 2000;40:16–20. Dowell SF, Mukunu R, Ksiazek TG, Khan AS, Rollin PE, Peters CJ. Transmission of Ebola hemorrhagic fever: a study of risk factors in family members, Kikwit, Democratic Republic of the Congo, 1995. Commission de Lutte contre les Epidemies a Kikwit. J Infect Dis 1999;179(Suppl 1):S87–91. Drosten C, et al. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, dengue virus, and yellow fever virus by real-time reverse transcription-PCR. J Clin Microbiol 2002;40:2323– 30. Gibb TR, Norwood Jr DA, Woollen N, Henchal EA. Development and evaluation of a fluorogenic 5 nuclease assay to detect and differentiate between Ebola virus subtypes Zaire and Sudan. J Clin Microbiol 2001a;39:4125–30. Gibb TR, Norwood Jr DA, Woollen N, Henchal EA. Development and evaluation of a fluorogenic 5 -nuclease assay to identify Marburg virus. Mol Cell Probes 2001b;15:259–66. Guimard Y, et al. Organization of patient care during the Ebola hemorrhagic fever epidemic in Kikwit, Democratic Republic of the Congo, 1995. J Infect Dis 1999;179(Suppl 1):S268–73. Johnson KM, Lange JV, Webb PA, Murphy FA. Isolation and partial characterisation of a new virus causing acute haemorrhagic fever in Zaire. Lancet 1977;1:569–71. Khan AS, et al. The reemergence of Ebola hemorrhagic fever, Democratic Republic of the Congo, 1995. Commission de Lutte contre les Epidemies a Kikwit. J Infect Dis 1999;179(Suppl 1):S76–86.
99
Khan, ASTF, Heymann, DL, Le Guenno, B, Nabeth, P, Kerstiens, B, Fleerackers, YKP, et al. The reemergence of Ebola hemorrhagic fever, Democratic Republic of the Congo, 1995. J. Infect. Dis. 179, S76–S86. Kuno G. Universal diagnostic RT-PCR protocol for arboviruses. J Virol Methods 1998;72:27–41. Leroy EM, Souquiere S, Rouquet P, Drevet D. Re-emergence of ebola haemorrhagic fever in Gabon. Lancet 2002;359:712. Leroy EM, et al. Diagnosis of Ebola haemorrhagic fever by RT-PCR in an epidemic setting. J Med Virol 2000;60:463–7. Lloyd, ESZS, Rollin, PE, Tshioko, K, Bwaka, MA, Ksiazek, TG, Calain, P, et al. Long-term disease surveillance in Bandundu region, Democratic Republic of the Congo: a model for early detection and prevention of Ebola hemorrhagic fever. J. Infect. Dis. 179, S274–S280. Locsin RC, Matua AG. The lived experience of waiting-to-know: Ebola at Mbarara, Uganda—hoping for life, anticipating death. J Adv Nurs 2002;37:173–81. Muhlberger E, et al. The nucleotide sequence of the L gene of Marburg virus, a filovirus: homologies with paramyxoviruses and rhabdoviruses. Virology 1992;187:534–47. Muyembe-Tamfum J-J, Borchert M, Swanepoel R, Bausch DG, Tshioko FK, Roth C, et al. Marburg hemorrhagic fever in Watsa/Durba (DRC): an endemoepidemic phenomenon. Infect Dis Rev 2001;3:34–45. Okware SI, et al. An outbreak of Ebola in Uganda. Trop Med Int Health 2002;7:1068–75. Rychlik W, Spencer WJ, Rhoads RE. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res 1990;18:6409–12. Sanchez, A.K.T., Rollin, P.E., Miranda, M.E., Trappier, S.G., Khan, A.S., Peters, C.J.N.S. Detection and molecular characterization of Ebola viruses causing disease in human and nonhuman primates. J. Infect. Dis. 179, S164–S169. Schwarz K, Hansen-Hagge T, Bartram C. Improved yields of long PCR products using gene 32 protein. Nucleic Acids Res 1990;18:1079. Siegert R, Shu HL, Slenczka W. Isolation and identification of the “Marburg virus”. Deutsche Medizinische Wochenschrift 1968;93:604– 12. Weidmann, M.R., Nunes, R.M.R.T. Vasconcelos, P.F.C., Hufert, F.T. Rapid detection of human pathogenic orthobunyaviruses. J. Clin. Microb. 41. Zaki, SRSW, Greer, PW, Goldsmith, CS, Ferebee, T, Katshitshi, J, Tshioko, FKBM, et al. A novel immunohistochemical assay for the detection of Ebola virus in skin: implications for diagnosis, spread, and surveillance of Ebola hemorrhagic fever. J. Infect. Dis. 179, S36–S47.