- Email: [email protected]
Rapid diagnosis of goose viral infections by multiplex PCR
Journal of Virological Methods 191 (2013) 101–104
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Rapid diagnosis of goose viral infections by multiplex PCR Zongyan Chen, Chuanfeng Li, Guoxin Li, Hai Yu, Yifeng Jiang, Liping Yan, Chunchun Meng, Yanjun Zhou, Guangzhi Tong, Guangqing Liu ∗ National Engineering Research Center for Poultry, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, No. 518 Ziyue Road, Minhang District, Shanghai 200241, China
a b s t r a c t Article history: Received 22 May 2012 Received in revised form 14 September 2012 Accepted 28 September 2012 Available online 18 March 2013 Keywords: Goose parvovirus Newcastle disease virus Goose herpesvirus Goose adenovirus Multiplex PCR
Goose parvovirus (GPV), newcastle disease virus (NDV), goose herpesvirus (GHV) and goose adenovirus (GAV) are considered collectively to be four of the most important and widespread viruses of geese. Because all of these viruses cause similar pathological changes, histological differentiation among these viruses is difficult. A reliable, specific and sensitive multiplex PCR (mPCR) assay was developed for the combined detection of GPV, NDV, GHV and GAV in clinical samples of geese. Using the mPCR technique, single infections with GPV (28/76; 36.8%), NDV (9/76; 11.8%), GHV (3/76; 3.9%) and GAV (12/76; 15.8%) were identified in the samples; co-infections with GAV and either GPV or NDV (31.6%; 24/76) were also identified with this approach. The results for all of the samples tested were the same in both the uPCR and mPCR systems. The mPCR approach is considered to be useful for routine molecular diagnosis and epidemiological applications in geese. © 2013 Published by Elsevier B.V.
1. Introduction Parvovirus, paramyxovirus, herpesvirus and adenovirus are four of the most common viral infections in goslings. Infections with goose parvovirus (GPV) have been reported frequently in goslings with diffuse fibrinous perihepatitis; swollen, friable livers; and large intestinal contents of variable consistency (Gough et al., 2005; Jansson et al., 2007; Irvine et al., 2008). Affected birds may also develop other clinical signs, including lethargy, depression, ataxia, dysphagia, anorexia, diarrhea, weight loss, watery ocular discharges, vomiting and neurological symptoms. In addition to GPV, Newcastle disease virus (NDV) has been isolated from diseased goslings (Chen et al., 2005; Czeglédia et al., 2006; Xu et al., 2008). Goose herpesvirus (GHV), which is distinct antigenically and genomically from duck virus enteritis (DVE) herpesvirus, is also reported frequently in goslings (Gough and Hansen, 2000; Salguero et al., 2002). These viruses cause diarrhea and depression in goslings. A fourth viral pathogen, goose adenovirus (GAV) (Benkö et al., 2005), was added to this list of common gosling viruses. GAV is a member of the genus Aviadenovirus in the family Adenoviridae. GAV infections were first documented in the United Kingdom in 1984 (Zsak and Kisary, 1984), but these infections have also occurred more recently in other countries (Chen et al., 2009; Ivanics et al., 2010). Because all of these viruses cause similar
∗ Corresponding author. Tel.: +86 2134293426; fax: +86 2134293498. E-mail address: [email protected] (G. Liu). 0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2012.09.027
pathological changes, histological differentiation of these viruses is difficult. Traditionally, the diagnosis of infection with one of these viruses must be confirmed by electron microscopy (Alexandrov et al., 1999; Gough et al., 2005), immunofluorescence (Chen et al., 2009) or virus isolation (Cheng et al., 2001; Gough et al., 2005); however, these techniques are time consuming, laborious and relatively insensitive. In addition, in certain cases, these approaches may be impossible due to a lack of antibodies or suitable cell lines. The uniplex PCR (uPCR) has become the method of choice for direct identification or verification of the viruses referred to above. Several uPCR approaches have been developed, each of which permits the detection of one of the following viruses: GPV (Ball et al., 2004), NDV (Qin et al., 2008), GHV (Gough and Hansen, 2000) and fowl adenovirus (Raue and Hess, 1998). However, the use of conventional PCR technology to for detection of several viruses individually is timeconsuming, laborious and costly. These limitations can be overcome by employing a multiplex PCR (mPCR) assay, which incorporates multiple primers that amplify simultaneously RNA or DNA from several viruses in a single reaction (Elnifro et al., 2000). The objective of this study was to develop a mPCR for detection of GPV, NDV, GHV and/or GAV, which are considered collectively to be four of the most important and widespread viruses in goslings. A rapid, sensitive and specific one-tube detection technique will be useful, particularly in goslings which present nonspecific clinical signs and have high morbidity and mortality rates.
102
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104
Table 1 The virus-specific primers that were used to amplify each target gene. Virusa
Target gene
Primer sequence (5 –3 )b
Tm
Target products (bp)
GPV
VP3
GPV-s GPV-as
GATTTCAACCGCTTCCACTG TAGCCGAGCCCAGCACATAC
58.1 59.1
226
NDV
F gene
NDV-s NDV-as
GCTCTTCTATCACAGAACCGACTT GCTGACCATCCAGGCACTTT
59.1 59.8
302
GHV
TK
GHV-s GHV-as
CAATGGCAGCAACATAACAA ATGGGATGGAACGTAACAGC
58.4 57.3
501
GAV
Hexon
GAV-s GAV-as
TACGGAGGAACCGCATACAA GCCATCACGCCCAGATACTT
59.0 59.9
401
a GPV, goose parvovirus, GenBank accession number JF333590; NDV, goose paramyxovirus, GenBank accession number GQ245793; GHV, goose herpesvirus, Genbank accession number EF053033; GAV, goose adenovirus, Genbank accession number EU979376. b The orientation for each of these sequences is either sense (-s) or antisense (-as).
The SH strain of GPV, the JS strain of NDV, the HN strain of GHV and the YZ strain of GAV were obtained from the Shanghai Veterinary Research Institute of the Chinese Academy of Agricultural Sciences and used as positive controls. NDV is an RNA virus, whereas the other viruses, which were used are DNA viruses. The primers were designed with the Primer 5.0 software package and selected within the conserved region of each virus. Four pairs of primer sets, which were designed to amplify specifically GPV, NDV, GHV or GAV (Table 1) were synthesized commercially (Invitrogen, Shanghai, China). For the first-strand synthesis of complementary DNA, 2 L of the viral RNA/DNA preparation were included in a total reaction volume of 20 L; this reaction volume contained 4 L reverse transcriptase (RT) buffer (50 mM Tris–HCl, 8 mM MgCl2 , 30 mM KCl, 1 mM dithiothreitol, pH 8.3), 0.5 mM of each deoxynucleotide triphosphate (dNTP), 50 pM oligo (dT)18 primer, 20 U of RNase inhibitor and 10 U of AMV reverse transcriptase (TaKaRa, Dalian, China). After this reaction mixture was incubated for 60 min at 42 ◦ C, it was heated for 3 min at 95 ◦ C to denature the products. The mixture was then chilled on ice. The specificity of primer pairs for each virus was first examined by uPCR amplification and analyzed by agarose gel electrophoresis. A premix containing the following components was prepared for the PCR: 1.25 U of TaqTM DNA polymerase (TaKaRa, Dalian, China), 2.5 L of 10× reaction buffer (200 mM Tris–HCl,pH 8.55, 160 mM (NH4 )2 SO4 and 20 mM MgCl2 ), 10 mM of each dNTP (TaKaRa, Dalian, China) and 50 pmol of each primer (Table 1). These components were mixed with 4 L of template cDNA/DNA in a total volume of 25 L. The PCR procedure began with an initial denaturation step of 5 min at 95 ◦ C, which was followed by 35 cycles of 30 s of denaturation at 94 ◦ C, 30 s of primer annealing at 58 ◦ C and 30 s of elongation at 72 ◦ C. The reaction was terminated after a final elongation step of 7 min at 72 ◦ C. The PCR products were analyzed by electrophoresis in 1% agarose gels for uPCR or 2.5% agarose gels for mPCR, followed by ethidium bromide staining and visualization under ultraviolet (UV) light. The target fragments were cloned into pMD-18T vectors, and the resulting products were named pGPV, pNDV, pGHV and pGAV. To verify the results of the uPCR assays, each construct was confirmed by sequencing (Invitrogen, Shanghai, China). Each viral target gene could be amplified specifically using its defined primer pair. The sequence of each construct is identical to the sequence that is found in the target virus strains (data not shown). The primers, which were used for the detection of GPV, NDV and NDV by uPCR amplification were also tested by mPCR amplification. A mPCR protocol for rapid detection of GPV, NDV, GHV and GAV was developed. To reach the detection limit and avoid nonspecific products, the optimum annealing temperature for this mPCR had to be determined; thus, a different temperature (55–62 ◦ C) and cycle
conditions were used in an mPCR amplification that included GPV, GHV and GAV DNA and NDV cDNA as its templates. PCR products with specific lengths of 226 bp (GPV), 302 bp (NDV), 501 bp (GHV) and 401 bp (GAV) were distinguishable visually following the separation of these products on a 2.5% agarose gel. The other optimum conditions for this mPCR were as follows: primer quantities of 10 pmol for each virus; dNTP concentrations of 200 M each and a TaqTM DNA Polymerase (TaKaRa,Dalian, China) quantity of 1.5 U. These reaction mixture components were then supplemented with DEPC-treated water to a total reaction volume of 50 L, and 35 cycles of the mPCR were conducted. The resulting amplicons were detected by electrophoresing 10 L aliquots of the mPCR products through 2.5% agarose gels in 1× TAE (40 mM Tris–acetate, pH 8.0) and 1 mM EDTA. After the multiplex conditions were optimized, the mPCR procedure amplified effectively all four viruses. The reaction was considered to be optimized with an annealing temperature of 58.5 ◦ C and 35 cycles of the mPCR because lower annealing temperatures or a higher number of cycles resulted in the formation of nonspecific products, whereas higher annealing temperatures or a smaller number of cycles decreased rapidly the sensitivity of the mPCR amplification. If different combinations of the four viruses (including one or more viruses) were used in the mPCR amplification, the expected virus amplicons were produced and could be differentiated by agarose gel electrophoresis (Fig. 1, lanes 2–15). No amplicons were produced by the negative control. In the specificity studies of the uPCR and mPCR assays, duck hepatitis B virus (DHBV), duck hepatitis virus (DHV), chicken anemia virus (CAV), Infectious bronchitis virus (IBV), Escherichia coli, GPV, NDV, GHV and GAV were tested with the primers for GPV, NDV, GHV and GAV.
Fig. 1. The specificity of the mPCR assay that has been developed for the detection of GPV, NDV, GHV and GAV. This figure presents an agarose gel that indicates the simultaneous mPCR amplification of different combinations of viruses with the four sets of primers. Lane M: 50 bp DNA ladder; lane 1: GPV alone; lane 2: NDV alone; lane 3: GAV alone; lane 4: GHV alone; lane 5: GPV + NDV; lane 6: GPV + GAV; lane 7: GPV + GHV; lane 8: NDV + GHV; lane 9: NDV + GAV; lane 10: GHV + GAV; lane 11: GPV + NDV + GHV; lane 12: GPV + NDV + GAV; lane 13: GPV + GHV + GAV; lane 14: NDV + GHV + GAV; lane 15: GPV +NDV + GHV + GAV; and lane 16: negative control.
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104 Table 2 The frequency of viruses alone or in combination in the 76 tested samples. Sample source
Viruses
Number of cases that were positive
% Positive
Shanghai, Zhejiang Anhui Sichuan Shanghai Shanghai, Zhejiang Henan
GPV only NDV only GHV only GAV only GPV + GAV NDV + GAV
28 9 3 12 23 1
36.8% 11.8% 3.9% 15.8% 30.3% 1.3%
The mPCR primers produced no discernible amplification products during the course of this test. For sensitivity testing, the plasmids pGPV, pNDV, pGHV and pGAV were purified using the Tiangen Plasmid Mini Kit (Tiangen, Beijing, China) and the DNA concentration was determined photometrically. Plasmid stocks were diluted serially by factors of 10 in DEPC-treated water. These dilutions were used as templates in the uPCR and mPCR amplifications. The detection limits of the mPCR were 3.57 × 105 , 2.08 × 105 , 4.25 × 104 and 1.07 × 105 copies/L for the GPV, NDV, GHV and GAV plasmid constructs of pGPV, pNDV, pGHV and pGAV, respectively, which contained the specific viral target fragments. The minimum quantities, which were detected by the uPCR were 1.78 × 104 , 1.04 × 104 , 2.14 × 104 and 5.45 × 104 copies/L for the GPV, NDV, GHV and GAV plasmid constructs, respectively. These results indicated that the mPCR was either as sensitive as or 10-fold less sensitive than the uPCR. In total, 76 specimens including blood, liver, spleen, kidney, cerebrum and duodenum were collected from 8- to 46-day-old geese from Shanghai, Zhejiang, Henan, Anhui and Sichuan between October 2008 and May 2009. These specimens were collected from the goslings following the appearance of clinical signs of disease. The specimens were stored at −80 ◦ C and were retested by mPCR. The samples were homogenized for 15–30 s with a homogenizer. Viral genomic DNA or RNA were extracted simultaneously from the homogenized tissues or from lysate of infected cell cultures with the TaKaRa MiniBEST Viral RNA/DNA Extraction Kit, version 3.0, according to the manufacturer’s protocols (TaKaRa, Dalian, China). In all of the uPCR samples, which were negative for a particular virus, no gene from the virus in question was amplified by mPCR. In addition, the mPCR identified clearly all of the samples, which was positive by the uPCR for GPV, NDV, GHV or GAV. In particular, using the mPCR approach, single infections with GPV (28/76; 36.8%), NDV (9/76; 11.8%), GHV (3/76; 3.9%) and GAV (12/76; 15.8%) were identified in these samples. In addition, co-infections with GAV and either GPV or NDV (31.6%; 24/76) were identified by the mPCR; however, no specimens were co-infected with three or four viruses (Table 2). The results for all of the samples tested were the same by both uPCR and mPCR. The results from mPCR were also confirmed by virus isolation of individual viruses. To verify the results of the single PCR and multiplex PCR assays, viruses were isolated from whole clinical samples as described previously (Gough and Hansen, 2000; Gough et al., 2005). The samples, which were found positive based on virus isolation were positive by mPCR. Additional partial data on virus isolation and sequencing have been published (Zongyan et al., in press). Previous studies have demonstrated that GAV is potentially related to many diseases of goslings and causes acute symptoms and pathological lesions (Cheng et al., 2001; Chen et al., 2009; Ivanics et al., 2010). GAV is considered to be an important virulence factor, which is associated with pathological lesions in goslings; in the current study, 24/76 (31.6%) of the samples were co-infected with GAV and another virus. These results indicated that a common co-infection with GAV and GPV is an important cause of decreased production levels, high incidence of opportunistic pathogenic diseases and intestinal damage among goslings in China. The results
103
also suggest that single and co-infections with GAV are related to the pathogenesis of gosling diseases. However, little is known about the prevalence of wild-type adenovirus infections in goslings and the effects of these infections on pathological lesions. It is necessary to isolate, identify and characterize GAV in goslings infected with this virus only or its co-infected goslings. The detailed molecular features of the replication and pathogenic mechanisms of GAV in goslings require further study. In this study, the applicability of an mPCR approach was demonstrated for the investigation of clinical samples, which were obtained from field cases of viral infection in goslings. The mPCR amplifications produced comparable results to the uPCR method of identifying the viruses of interest, even in cases involving multiple infections. In conclusion, a reliable, specific and sensitive mPCR technique was developed for combined detection of GPV, NDV and GAV in clinical samples of geese. This technique is useful for routine molecular diagnosis and epidemiological studies of geese.
Acknowledgments This study was funded by grants from the Chinese Natural Sciences Foundation (30870114), the Special Fund for Agro-scientific Research in the Public Interest (nos. 2010JB18 and 2012JB13) and the National Advanced Technology Research and Development Program of China (863 program) (no. 2011AA10A200).
References Alexandrov, M., Alexandrova, R., Alexandrov, I., Zacharieva, S., Lasarova, S., Doumanova, L., Peshev, R., Donev, T., 1999. Fluorescent and electron-microscopy immunoassays employing polyclonal and monoclonal antibodies for detection of goose parvovirus infection. J. Virol. Methods 79, 21–32. Ball, N.W., Smyth, J.A., Weston, J.H., Borghmans, B.J., Palya, V., Glávits, R., Ivanics, É., DánÁ, Todd, D., 2004. Diagnosis of goose circovirus infection in Hungarian geese samples using polymerase chain reaction and dot blot hybridization tests. Avian Pathol. 33, 51–58. Benkö, M., Harrach, B., Both, G.W., 2005. Family adenoviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus Taxonomy VIIIth Report of the International Committee on Taxonomy of Viruses. Elsevier, New York, pp. 213 228. Chen, J.D., Liao, M., Ren, T., Xin, C.A., 2005. A goose-sourced paramyxovirus isolated from southern China. Avian Dis. 49, 170–173. Chen, S., Cheng, A.C., Wang, M.S., Zhu, D.K., Luo, Q.H., Liu, F., Chen, X.Y., 2009. Detection and localization of a goose adenovirus in experimentally infected goslings using indirect immunofluorescence with paraffin-embedded tissue sections. Avian Pathol. 38, 167–174. Cheng, A.C., Wang, M.S., Chen, X.Y., Guo, Y.F., Liu, Z.Y., Fang, P.F., 2001. Pathogenic and pathological characteristic of new type gosling viral enteritis first observed in China. World J. Gastroenterol. 7, 678–684. Czeglédia, A., Ujvária, D., Somogyia, E., Wehmanna, E., Wernerb, O., Lomniczia, B., 2006. Third genome size category of avian paramyxovirus serotype 1 (newcastle disease virus) and evolutionary implications. Virus Res. 120, 36–48. Elnifro, E.M., Ashshi, A.M., Cooper, R.J., Klapper, P.E., 2000. Multiplex PCR: optimization and application in diagnostic virology. Clin. Microbiol. Rev. 13, 559–570. Gough, D., Ceeraz, V., Cox, B., Palya, V., Mato, T., 2005. Isolation and identification of goose parvovirus in the UK. Vet. Rec. 156, 424–524. Gough, R.E., Hansen, W.R., 2000. Characterization of a herpesvirus isolated from domestic geese in Australia. Avian Pathol. 29, 417–422. Ivanics, E., Palya, V., Markos, B., Dan, A., Ursu, K., Harrach, B., Kaján, G., Glávits, R., 2010. Hepatitis and hydropericardium syndrome associated with adenovirus infection in goslings. Acta Vet. Hung. 58, 47–58. Irvine, R., Ceeraz, V., Cox, B., Twomey, F., Young, S., Bradshaw, J., Featherstone, C., Holmes, P., Ainsworth, H., Jones, R., 2008. Goose parvovirus in Great Britain. Vet. Rec. 163, 461. Jansson, D.S., Feinstein, R., Kardi, V., Mató, T., Palya, V., 2007. Epidemiologic investigation of an outbreak of goose parvovirus infection in Sweden. Avian Dis. 51, 609–613. Qin, Z.M., Tan, L.T., Xu, H.Y., Ma, B.C., Wang, Y.L., Yuan, X.Y., Liu, W.J., 2008. Pathotypical characterization and molecular epidemiology of newcastle disease virus isolates from different hosts in China from 1996 to 2005. J. Clin. Microbiol. 46, 601–611. Raue, R., Hess, M., 1998. Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus. J.Virol. Methods 73, 211–217.
104
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104
˜ Salguero, F.J., Sánchez, P.J., Núnez, A., Gómez, J.C., 2002. Histopathological and ultrastructural changes associated with herpesvirus infection in waterfowl. Avian Pathol. 31, 133–140. Xu, M., Chang, S., Ding, Z., Gao, H.W., Wan, J.-Y., Liu, W.S., Liu, L.N., Gao, Y., Xu, J., 2008. Genomic analysis of newcastle disease virus strain NA-1 isolated from geese in China. Arch. Virol. 153, 1281–1289.
Zsak, L., Kisary, J., 1984. Characterisation of adenoviruses isolated from geese. Avian Pathol. 13, 253–264. Zongyan, C., Li, C., Zhu, Y., Wang, B., Meng, C., Liu, G. Immunogenicity of virus-like particles containing modified Goose parvovirus VP2 protein. Virus Res., in press.
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Short communication
Rapid diagnosis of goose viral infections by multiplex PCR Zongyan Chen, Chuanfeng Li, Guoxin Li, Hai Yu, Yifeng Jiang, Liping Yan, Chunchun Meng, Yanjun Zhou, Guangzhi Tong, Guangqing Liu ∗ National Engineering Research Center for Poultry, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, No. 518 Ziyue Road, Minhang District, Shanghai 200241, China
a b s t r a c t Article history: Received 22 May 2012 Received in revised form 14 September 2012 Accepted 28 September 2012 Available online 18 March 2013 Keywords: Goose parvovirus Newcastle disease virus Goose herpesvirus Goose adenovirus Multiplex PCR
Goose parvovirus (GPV), newcastle disease virus (NDV), goose herpesvirus (GHV) and goose adenovirus (GAV) are considered collectively to be four of the most important and widespread viruses of geese. Because all of these viruses cause similar pathological changes, histological differentiation among these viruses is difficult. A reliable, specific and sensitive multiplex PCR (mPCR) assay was developed for the combined detection of GPV, NDV, GHV and GAV in clinical samples of geese. Using the mPCR technique, single infections with GPV (28/76; 36.8%), NDV (9/76; 11.8%), GHV (3/76; 3.9%) and GAV (12/76; 15.8%) were identified in the samples; co-infections with GAV and either GPV or NDV (31.6%; 24/76) were also identified with this approach. The results for all of the samples tested were the same in both the uPCR and mPCR systems. The mPCR approach is considered to be useful for routine molecular diagnosis and epidemiological applications in geese. © 2013 Published by Elsevier B.V.
1. Introduction Parvovirus, paramyxovirus, herpesvirus and adenovirus are four of the most common viral infections in goslings. Infections with goose parvovirus (GPV) have been reported frequently in goslings with diffuse fibrinous perihepatitis; swollen, friable livers; and large intestinal contents of variable consistency (Gough et al., 2005; Jansson et al., 2007; Irvine et al., 2008). Affected birds may also develop other clinical signs, including lethargy, depression, ataxia, dysphagia, anorexia, diarrhea, weight loss, watery ocular discharges, vomiting and neurological symptoms. In addition to GPV, Newcastle disease virus (NDV) has been isolated from diseased goslings (Chen et al., 2005; Czeglédia et al., 2006; Xu et al., 2008). Goose herpesvirus (GHV), which is distinct antigenically and genomically from duck virus enteritis (DVE) herpesvirus, is also reported frequently in goslings (Gough and Hansen, 2000; Salguero et al., 2002). These viruses cause diarrhea and depression in goslings. A fourth viral pathogen, goose adenovirus (GAV) (Benkö et al., 2005), was added to this list of common gosling viruses. GAV is a member of the genus Aviadenovirus in the family Adenoviridae. GAV infections were first documented in the United Kingdom in 1984 (Zsak and Kisary, 1984), but these infections have also occurred more recently in other countries (Chen et al., 2009; Ivanics et al., 2010). Because all of these viruses cause similar
∗ Corresponding author. Tel.: +86 2134293426; fax: +86 2134293498. E-mail address: [email protected] (G. Liu). 0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2012.09.027
pathological changes, histological differentiation of these viruses is difficult. Traditionally, the diagnosis of infection with one of these viruses must be confirmed by electron microscopy (Alexandrov et al., 1999; Gough et al., 2005), immunofluorescence (Chen et al., 2009) or virus isolation (Cheng et al., 2001; Gough et al., 2005); however, these techniques are time consuming, laborious and relatively insensitive. In addition, in certain cases, these approaches may be impossible due to a lack of antibodies or suitable cell lines. The uniplex PCR (uPCR) has become the method of choice for direct identification or verification of the viruses referred to above. Several uPCR approaches have been developed, each of which permits the detection of one of the following viruses: GPV (Ball et al., 2004), NDV (Qin et al., 2008), GHV (Gough and Hansen, 2000) and fowl adenovirus (Raue and Hess, 1998). However, the use of conventional PCR technology to for detection of several viruses individually is timeconsuming, laborious and costly. These limitations can be overcome by employing a multiplex PCR (mPCR) assay, which incorporates multiple primers that amplify simultaneously RNA or DNA from several viruses in a single reaction (Elnifro et al., 2000). The objective of this study was to develop a mPCR for detection of GPV, NDV, GHV and/or GAV, which are considered collectively to be four of the most important and widespread viruses in goslings. A rapid, sensitive and specific one-tube detection technique will be useful, particularly in goslings which present nonspecific clinical signs and have high morbidity and mortality rates.
102
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104
Table 1 The virus-specific primers that were used to amplify each target gene. Virusa
Target gene
Primer sequence (5 –3 )b
Tm
Target products (bp)
GPV
VP3
GPV-s GPV-as
GATTTCAACCGCTTCCACTG TAGCCGAGCCCAGCACATAC
58.1 59.1
226
NDV
F gene
NDV-s NDV-as
GCTCTTCTATCACAGAACCGACTT GCTGACCATCCAGGCACTTT
59.1 59.8
302
GHV
TK
GHV-s GHV-as
CAATGGCAGCAACATAACAA ATGGGATGGAACGTAACAGC
58.4 57.3
501
GAV
Hexon
GAV-s GAV-as
TACGGAGGAACCGCATACAA GCCATCACGCCCAGATACTT
59.0 59.9
401
a GPV, goose parvovirus, GenBank accession number JF333590; NDV, goose paramyxovirus, GenBank accession number GQ245793; GHV, goose herpesvirus, Genbank accession number EF053033; GAV, goose adenovirus, Genbank accession number EU979376. b The orientation for each of these sequences is either sense (-s) or antisense (-as).
The SH strain of GPV, the JS strain of NDV, the HN strain of GHV and the YZ strain of GAV were obtained from the Shanghai Veterinary Research Institute of the Chinese Academy of Agricultural Sciences and used as positive controls. NDV is an RNA virus, whereas the other viruses, which were used are DNA viruses. The primers were designed with the Primer 5.0 software package and selected within the conserved region of each virus. Four pairs of primer sets, which were designed to amplify specifically GPV, NDV, GHV or GAV (Table 1) were synthesized commercially (Invitrogen, Shanghai, China). For the first-strand synthesis of complementary DNA, 2 L of the viral RNA/DNA preparation were included in a total reaction volume of 20 L; this reaction volume contained 4 L reverse transcriptase (RT) buffer (50 mM Tris–HCl, 8 mM MgCl2 , 30 mM KCl, 1 mM dithiothreitol, pH 8.3), 0.5 mM of each deoxynucleotide triphosphate (dNTP), 50 pM oligo (dT)18 primer, 20 U of RNase inhibitor and 10 U of AMV reverse transcriptase (TaKaRa, Dalian, China). After this reaction mixture was incubated for 60 min at 42 ◦ C, it was heated for 3 min at 95 ◦ C to denature the products. The mixture was then chilled on ice. The specificity of primer pairs for each virus was first examined by uPCR amplification and analyzed by agarose gel electrophoresis. A premix containing the following components was prepared for the PCR: 1.25 U of TaqTM DNA polymerase (TaKaRa, Dalian, China), 2.5 L of 10× reaction buffer (200 mM Tris–HCl,pH 8.55, 160 mM (NH4 )2 SO4 and 20 mM MgCl2 ), 10 mM of each dNTP (TaKaRa, Dalian, China) and 50 pmol of each primer (Table 1). These components were mixed with 4 L of template cDNA/DNA in a total volume of 25 L. The PCR procedure began with an initial denaturation step of 5 min at 95 ◦ C, which was followed by 35 cycles of 30 s of denaturation at 94 ◦ C, 30 s of primer annealing at 58 ◦ C and 30 s of elongation at 72 ◦ C. The reaction was terminated after a final elongation step of 7 min at 72 ◦ C. The PCR products were analyzed by electrophoresis in 1% agarose gels for uPCR or 2.5% agarose gels for mPCR, followed by ethidium bromide staining and visualization under ultraviolet (UV) light. The target fragments were cloned into pMD-18T vectors, and the resulting products were named pGPV, pNDV, pGHV and pGAV. To verify the results of the uPCR assays, each construct was confirmed by sequencing (Invitrogen, Shanghai, China). Each viral target gene could be amplified specifically using its defined primer pair. The sequence of each construct is identical to the sequence that is found in the target virus strains (data not shown). The primers, which were used for the detection of GPV, NDV and NDV by uPCR amplification were also tested by mPCR amplification. A mPCR protocol for rapid detection of GPV, NDV, GHV and GAV was developed. To reach the detection limit and avoid nonspecific products, the optimum annealing temperature for this mPCR had to be determined; thus, a different temperature (55–62 ◦ C) and cycle
conditions were used in an mPCR amplification that included GPV, GHV and GAV DNA and NDV cDNA as its templates. PCR products with specific lengths of 226 bp (GPV), 302 bp (NDV), 501 bp (GHV) and 401 bp (GAV) were distinguishable visually following the separation of these products on a 2.5% agarose gel. The other optimum conditions for this mPCR were as follows: primer quantities of 10 pmol for each virus; dNTP concentrations of 200 M each and a TaqTM DNA Polymerase (TaKaRa,Dalian, China) quantity of 1.5 U. These reaction mixture components were then supplemented with DEPC-treated water to a total reaction volume of 50 L, and 35 cycles of the mPCR were conducted. The resulting amplicons were detected by electrophoresing 10 L aliquots of the mPCR products through 2.5% agarose gels in 1× TAE (40 mM Tris–acetate, pH 8.0) and 1 mM EDTA. After the multiplex conditions were optimized, the mPCR procedure amplified effectively all four viruses. The reaction was considered to be optimized with an annealing temperature of 58.5 ◦ C and 35 cycles of the mPCR because lower annealing temperatures or a higher number of cycles resulted in the formation of nonspecific products, whereas higher annealing temperatures or a smaller number of cycles decreased rapidly the sensitivity of the mPCR amplification. If different combinations of the four viruses (including one or more viruses) were used in the mPCR amplification, the expected virus amplicons were produced and could be differentiated by agarose gel electrophoresis (Fig. 1, lanes 2–15). No amplicons were produced by the negative control. In the specificity studies of the uPCR and mPCR assays, duck hepatitis B virus (DHBV), duck hepatitis virus (DHV), chicken anemia virus (CAV), Infectious bronchitis virus (IBV), Escherichia coli, GPV, NDV, GHV and GAV were tested with the primers for GPV, NDV, GHV and GAV.
Fig. 1. The specificity of the mPCR assay that has been developed for the detection of GPV, NDV, GHV and GAV. This figure presents an agarose gel that indicates the simultaneous mPCR amplification of different combinations of viruses with the four sets of primers. Lane M: 50 bp DNA ladder; lane 1: GPV alone; lane 2: NDV alone; lane 3: GAV alone; lane 4: GHV alone; lane 5: GPV + NDV; lane 6: GPV + GAV; lane 7: GPV + GHV; lane 8: NDV + GHV; lane 9: NDV + GAV; lane 10: GHV + GAV; lane 11: GPV + NDV + GHV; lane 12: GPV + NDV + GAV; lane 13: GPV + GHV + GAV; lane 14: NDV + GHV + GAV; lane 15: GPV +NDV + GHV + GAV; and lane 16: negative control.
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104 Table 2 The frequency of viruses alone or in combination in the 76 tested samples. Sample source
Viruses
Number of cases that were positive
% Positive
Shanghai, Zhejiang Anhui Sichuan Shanghai Shanghai, Zhejiang Henan
GPV only NDV only GHV only GAV only GPV + GAV NDV + GAV
28 9 3 12 23 1
36.8% 11.8% 3.9% 15.8% 30.3% 1.3%
The mPCR primers produced no discernible amplification products during the course of this test. For sensitivity testing, the plasmids pGPV, pNDV, pGHV and pGAV were purified using the Tiangen Plasmid Mini Kit (Tiangen, Beijing, China) and the DNA concentration was determined photometrically. Plasmid stocks were diluted serially by factors of 10 in DEPC-treated water. These dilutions were used as templates in the uPCR and mPCR amplifications. The detection limits of the mPCR were 3.57 × 105 , 2.08 × 105 , 4.25 × 104 and 1.07 × 105 copies/L for the GPV, NDV, GHV and GAV plasmid constructs of pGPV, pNDV, pGHV and pGAV, respectively, which contained the specific viral target fragments. The minimum quantities, which were detected by the uPCR were 1.78 × 104 , 1.04 × 104 , 2.14 × 104 and 5.45 × 104 copies/L for the GPV, NDV, GHV and GAV plasmid constructs, respectively. These results indicated that the mPCR was either as sensitive as or 10-fold less sensitive than the uPCR. In total, 76 specimens including blood, liver, spleen, kidney, cerebrum and duodenum were collected from 8- to 46-day-old geese from Shanghai, Zhejiang, Henan, Anhui and Sichuan between October 2008 and May 2009. These specimens were collected from the goslings following the appearance of clinical signs of disease. The specimens were stored at −80 ◦ C and were retested by mPCR. The samples were homogenized for 15–30 s with a homogenizer. Viral genomic DNA or RNA were extracted simultaneously from the homogenized tissues or from lysate of infected cell cultures with the TaKaRa MiniBEST Viral RNA/DNA Extraction Kit, version 3.0, according to the manufacturer’s protocols (TaKaRa, Dalian, China). In all of the uPCR samples, which were negative for a particular virus, no gene from the virus in question was amplified by mPCR. In addition, the mPCR identified clearly all of the samples, which was positive by the uPCR for GPV, NDV, GHV or GAV. In particular, using the mPCR approach, single infections with GPV (28/76; 36.8%), NDV (9/76; 11.8%), GHV (3/76; 3.9%) and GAV (12/76; 15.8%) were identified in these samples. In addition, co-infections with GAV and either GPV or NDV (31.6%; 24/76) were identified by the mPCR; however, no specimens were co-infected with three or four viruses (Table 2). The results for all of the samples tested were the same by both uPCR and mPCR. The results from mPCR were also confirmed by virus isolation of individual viruses. To verify the results of the single PCR and multiplex PCR assays, viruses were isolated from whole clinical samples as described previously (Gough and Hansen, 2000; Gough et al., 2005). The samples, which were found positive based on virus isolation were positive by mPCR. Additional partial data on virus isolation and sequencing have been published (Zongyan et al., in press). Previous studies have demonstrated that GAV is potentially related to many diseases of goslings and causes acute symptoms and pathological lesions (Cheng et al., 2001; Chen et al., 2009; Ivanics et al., 2010). GAV is considered to be an important virulence factor, which is associated with pathological lesions in goslings; in the current study, 24/76 (31.6%) of the samples were co-infected with GAV and another virus. These results indicated that a common co-infection with GAV and GPV is an important cause of decreased production levels, high incidence of opportunistic pathogenic diseases and intestinal damage among goslings in China. The results
103
also suggest that single and co-infections with GAV are related to the pathogenesis of gosling diseases. However, little is known about the prevalence of wild-type adenovirus infections in goslings and the effects of these infections on pathological lesions. It is necessary to isolate, identify and characterize GAV in goslings infected with this virus only or its co-infected goslings. The detailed molecular features of the replication and pathogenic mechanisms of GAV in goslings require further study. In this study, the applicability of an mPCR approach was demonstrated for the investigation of clinical samples, which were obtained from field cases of viral infection in goslings. The mPCR amplifications produced comparable results to the uPCR method of identifying the viruses of interest, even in cases involving multiple infections. In conclusion, a reliable, specific and sensitive mPCR technique was developed for combined detection of GPV, NDV and GAV in clinical samples of geese. This technique is useful for routine molecular diagnosis and epidemiological studies of geese.
Acknowledgments This study was funded by grants from the Chinese Natural Sciences Foundation (30870114), the Special Fund for Agro-scientific Research in the Public Interest (nos. 2010JB18 and 2012JB13) and the National Advanced Technology Research and Development Program of China (863 program) (no. 2011AA10A200).
References Alexandrov, M., Alexandrova, R., Alexandrov, I., Zacharieva, S., Lasarova, S., Doumanova, L., Peshev, R., Donev, T., 1999. Fluorescent and electron-microscopy immunoassays employing polyclonal and monoclonal antibodies for detection of goose parvovirus infection. J. Virol. Methods 79, 21–32. Ball, N.W., Smyth, J.A., Weston, J.H., Borghmans, B.J., Palya, V., Glávits, R., Ivanics, É., DánÁ, Todd, D., 2004. Diagnosis of goose circovirus infection in Hungarian geese samples using polymerase chain reaction and dot blot hybridization tests. Avian Pathol. 33, 51–58. Benkö, M., Harrach, B., Both, G.W., 2005. Family adenoviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus Taxonomy VIIIth Report of the International Committee on Taxonomy of Viruses. Elsevier, New York, pp. 213 228. Chen, J.D., Liao, M., Ren, T., Xin, C.A., 2005. A goose-sourced paramyxovirus isolated from southern China. Avian Dis. 49, 170–173. Chen, S., Cheng, A.C., Wang, M.S., Zhu, D.K., Luo, Q.H., Liu, F., Chen, X.Y., 2009. Detection and localization of a goose adenovirus in experimentally infected goslings using indirect immunofluorescence with paraffin-embedded tissue sections. Avian Pathol. 38, 167–174. Cheng, A.C., Wang, M.S., Chen, X.Y., Guo, Y.F., Liu, Z.Y., Fang, P.F., 2001. Pathogenic and pathological characteristic of new type gosling viral enteritis first observed in China. World J. Gastroenterol. 7, 678–684. Czeglédia, A., Ujvária, D., Somogyia, E., Wehmanna, E., Wernerb, O., Lomniczia, B., 2006. Third genome size category of avian paramyxovirus serotype 1 (newcastle disease virus) and evolutionary implications. Virus Res. 120, 36–48. Elnifro, E.M., Ashshi, A.M., Cooper, R.J., Klapper, P.E., 2000. Multiplex PCR: optimization and application in diagnostic virology. Clin. Microbiol. Rev. 13, 559–570. Gough, D., Ceeraz, V., Cox, B., Palya, V., Mato, T., 2005. Isolation and identification of goose parvovirus in the UK. Vet. Rec. 156, 424–524. Gough, R.E., Hansen, W.R., 2000. Characterization of a herpesvirus isolated from domestic geese in Australia. Avian Pathol. 29, 417–422. Ivanics, E., Palya, V., Markos, B., Dan, A., Ursu, K., Harrach, B., Kaján, G., Glávits, R., 2010. Hepatitis and hydropericardium syndrome associated with adenovirus infection in goslings. Acta Vet. Hung. 58, 47–58. Irvine, R., Ceeraz, V., Cox, B., Twomey, F., Young, S., Bradshaw, J., Featherstone, C., Holmes, P., Ainsworth, H., Jones, R., 2008. Goose parvovirus in Great Britain. Vet. Rec. 163, 461. Jansson, D.S., Feinstein, R., Kardi, V., Mató, T., Palya, V., 2007. Epidemiologic investigation of an outbreak of goose parvovirus infection in Sweden. Avian Dis. 51, 609–613. Qin, Z.M., Tan, L.T., Xu, H.Y., Ma, B.C., Wang, Y.L., Yuan, X.Y., Liu, W.J., 2008. Pathotypical characterization and molecular epidemiology of newcastle disease virus isolates from different hosts in China from 1996 to 2005. J. Clin. Microbiol. 46, 601–611. Raue, R., Hess, M., 1998. Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus. J.Virol. Methods 73, 211–217.
104
Z. Chen et al. / Journal of Virological Methods 191 (2013) 101–104
˜ Salguero, F.J., Sánchez, P.J., Núnez, A., Gómez, J.C., 2002. Histopathological and ultrastructural changes associated with herpesvirus infection in waterfowl. Avian Pathol. 31, 133–140. Xu, M., Chang, S., Ding, Z., Gao, H.W., Wan, J.-Y., Liu, W.S., Liu, L.N., Gao, Y., Xu, J., 2008. Genomic analysis of newcastle disease virus strain NA-1 isolated from geese in China. Arch. Virol. 153, 1281–1289.
Zsak, L., Kisary, J., 1984. Characterisation of adenoviruses isolated from geese. Avian Pathol. 13, 253–264. Zongyan, C., Li, C., Zhu, Y., Wang, B., Meng, C., Liu, G. Immunogenicity of virus-like particles containing modified Goose parvovirus VP2 protein. Virus Res., in press.