Rapid identification of mitochondrial DNA (mtDNA) mutations in neuromuscular disorders by using surveyor strategy

Available online at www.sciencedirect.com

Mitochondrion 8 (2008) 136–145 www.elsevier.com/locate/mito

Rapid identification of mitochondrial DNA (mtDNA) mutations in neuromuscular disorders by using surveyor strategy S. Bannwarth a,k, V. Procaccio b, C. Rouzier a, K. Fragaki a,k, J. Poole b, B. Chabrol c, C. Desnuelle d, J. Pouget e, J.P. Azulay e, S. Attarian e, J.F. Pellissier f, J.J. Gargus b, J.E. Abdenur g, T. Mozaffar b, P. Calvas h, P. Labauge i, M. Pages j, D.C. Wallace b, J.C. Lambert a, V. Paquis-Flucklinger a,k,* a

b

Department of Medical Genetics, Archet 2 Hospital, CHU Nice, France Center for Molecular and Mitochondrial, Medicine and Genetics, University of California, Irvine, CA, USA c Department of Neuropediatrics, Timone Hospital, CHU Marseille, France d Department of Reeducation, Archet 2 Hospital, CHU Nice, France e Department of Neurology, Timone Hospital, CHU Marseille, France f Department of Neuropathology, Timone Hospital, CHU Marseille, France g Division of Metabolic Disorders, Children’s Hospital of Orange County, CA, USA h Department of Genetics, Purpan Hospital, CHU Toulouse, France i ˆ mes, France Department of Neurology, Caremeau Hospital, CHU Nı j Department of Neurology, Gui de Chauliac Hospital, CHU Montpellier, France k UMR CNRS 6543, Medicine School, Nice, France Received 23 August 2007; received in revised form 22 October 2007; accepted 26 October 2007 Available online 6 November 2007

Abstract Mutations of mitochondrial genome are responsible for respiratory chain defects in numerous patients. We have used a strategy, based on the use of a mismatch-specific DNA endonuclease named ‘‘ Surveyor Nuclease’’, for screening the entire mtDNA in a group of 50 patients with neuromuscular features, suggesting a respiratory chain dysfunction. We identified mtDNA mutations in 20% of patients (10/50). Among the identified mutations, four are not found in any mitochondrial database and have not been reported previously. We also confirm that mtDNA polymorphisms are frequently found in a heteroplasmic state (15 different polymorphisms were identified among which five were novel).  2007 Elsevier B.V. and Mitochondria Research Society. All rights reserved. Keywords: mtDNA; Neuromuscular disorder; Respiratory chain dysfunction; Surveyor endonuclease

1. Introduction Mutations of mtDNA are responsible for respiratory chain (RC) defects in numerous patients (Dimauro and Schon, 2001). The mitochondrial genome encompasses 37 genes with two ribosomal RNAs 12S and 16S, 22 tRNAs *

Corresponding author. Address: Department of Medical Genetics, Archet 2 Hospital, 151 Route de Saint Antoine de Ginestiere, BP 3079, 06202 Nice cedex 3, France. Tel.: +33 4 92 03 64 60; fax: +33 4 92 03 64 65. E-mail address: [email protected] (V. Paquis-Flucklinger).

and 13 encoded polypeptide genes. These 13 polypeptides include seven subunits (ND1-6 and ND4L) of complex I, one subunit (cytochrome b) of complex III, three subunits (COXI-III) of complex IV and two (ATPase 6 and 8) of complex V (Wallace, 2005). Each cell contains thousand copies of mtDNA and normal and mutated mtDNAs may coexist within cells, a condition known as heteroplasmy. Mitochondrial diseases are clinically heterogeneous making diagnosis particularly challenging for clinicians. Thus, the detection of mtDNA mutations represents a critical step in the diagnosis of mitochondrial disor-

1567-7249/$ - see front matter  2007 Elsevier B.V. and Mitochondria Research Society. All rights reserved. doi:10.1016/j.mito.2007.10.008

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

ders but also for defining the prevalence of mtDNA gene defects in different clinical presentations. Previous studies have shown that at least 20% of respiratory chain enzyme deficiencies are related to heteroplasmic mtDNA mutations (Thorburn et al., 2004). Nevertheless, when the most common point mutations have been ruled out, the identification of unknown mtDNA mutations remains challenging. Different techniques are available (Barros et al., 1997; Sternberg et al., 1998; Biggin et al., 2005). DNA sequencing remains the gold standard but it is time-consuming and fails to detect mutations that may be present at a low heteroplasmic level (20% or below) (Wong et al., 2002; Moraes et al., 2003). Recently, we have developed a new strategy for the rapid and reliable identification of heteroplasmic mtDNA mutations (Bannwarth et al., 2005; Bannwarth et al., 2006). This method is based on the use of a mismatch-specific DNA endonuclease, named ‘‘Surveyor Nuclease’’ (Qiu et al., 2004). This enzyme cleaves DNA heteroduplexes formed by the hybridization of PCR products derived from wild-type and mutant mtDNA. The limitation of the technique concerns the impossibility to detect deleterious homoplasmic mutations. Nevertheless, pathogenic mutations are commonly found in a heteroplasmic state and this method enables a fast and systematic screening of the entire mitochondrial genome when a patient is negative for the most common mtDNA mutations and still with a high suspicion of mitochondrial disease due to the mitochondrial genome. Furthermore, we have shown previously that this technique is highly sensitive and able to detect different mtDNA mutants present at as low as 3% heteroplasmy (Bannwarth et al., 2005). In this report, this methodology was applied to a large series of patients with neuromuscular features suggestive of mitochondrial respiratory chain dysfunction and negative for mtDNA deletion and m.3243A>G mutation. The specific aim of the study was to search for novel mtDNA mutations by using a new strategy, which allows the systematic screening of the entire mitochondrial genome in 48 h. 2. Patients and methods 2.1. Patients We have analysed 50 patients referred to our laboratory in the Department of Medical Genetics, University of Nice Sophia-Antipolis or to the Center for Molecular and Mitochondrial Medicine and Genetics, University of California, Irvine. These patients were selected on the following inclusion criteria: (1) neuromuscular features suggesting a respiratory chain dysfunction and/or (2) morphological evidence of altered mitochondrial function in the muscle biopsy specimen (ragged-red and cytochrome c oxidase negative fibers). 2.2. Mitochondrial DNA analysis Samples were obtained from patients who had given informed consent. Genomic DNA was extracted from leu-

137

kocytes and muscle biopsy using standard phenol chloroform extraction procedure. Mitochondrial DNA deletions were detected by ‘‘large fragments’’ PCR as previously described (Paul et al., 1996). The m.3243A>G mutation was analysed by PCR/RFLP with digestion of relevant PCR products with ApaI restriction enzyme (Vialettes et al., 1997). For Surveyor analysis, the entire human mtDNA was amplified by using 17 primer sets as previously described (Bannwarth et al., 2005; Bannwarth et al., 2006). Reactions were performed in a final volume of 50 ll, using Optimase DNA Polymerase (Transgenomic, Crewe, UK), as follows: one cycle at 95 C for 4 min, followed by 35 cycles at 95 C for 30 s, 57 C for 30 s, and 72 C for 4 min, and finally one cycle at 72 C for 5 min. As positive control for Surveyor digestion, two plasmid DNAs control G and control C, provided in the Surveyor Mutation Detection kit were amplified in same PCR conditions with one minute for extension step. After the final PCR extension, it is conventional to melt the newly extended DNA and reanneal, without a second extension, in order to increase the formation of heteroduplex DNA. Nevertheless, in our hands, the results were not improved by the addition of this step. 2.3. Surveyor Nuclease digestion After amplification, 15 ll of each PCR product was digested in a final volume of 60 with 6 ll of 10· Surveyor Nuclease reaction buffer, 1 ll of Surveyor Nuclease Enhancer W and 1 ll of Surveyor Nuclease W (Surveyor) mutation detection kit for WAVE HS System (Transgenomic, Crewe, UK). After 20 min at 42 C, 6 ll of Stop solution was added. For controls, 15 ll of undigested PCR products were systematically mixed with water in a final volume of 60 ll. Twenty microliters of digested and undigested products were analysed on a 1.5% agarose gel. 2.4. Sequencing of mtDNA PCR products were purified on Montage PCR columns (Millipore S.A., Saint-Quentin, France), processed with an ABI PRISM dRhodamine Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and sequenced on an ABI 310 automated sequencer (Applied Biosystems). Sequences were compared with the human mtDNA consensus sequence, Genbank number J01415.2 (Andrews et al., 1999). 2.5. Quantitation of mitochondrial heteroplasmy The proportion of wild-type and mutated mtDNA was determined for the following mutations: m.4295A>G, m.5667G>A, m.5703G>A, m.5985G>A, m.8344A>G, m.8993T>G, m.10191T>C, m.14710G>A and m.15952C>T. Primer sequences and restriction enzymes used for heteroplasmy quantitation are listed in Table 1. The amplified fragment, encompassing the mutation site, was labelled with

267 231 269 147 211 945 137

128 356

Reverse primer position

4539–4518 5692–5669 5730–5704 6010–5986 8366–8345 9556–9538 10300–10280 nt nt nt nt nt nt nt

nt 14810–14791 nt 15967–15953

Reverse Primer (5 0 –3 0 )

AGCTTAGCGCTGTGATGAGT ACTAAGTGTTTGTGGGTTTAAGGC GTAGATTGAAGCCAGTTGATTAGGAAG AGGAGGCTTAGACGTGTGCCTAGAA TTTCACTGTAAAGAGGTGTGGG GGCCAGTGCCCTCCTAAT GTTTGTAGGGCTCATGGTAGG

GGAGGTCGATGAATGAGTGG GGAGTTAAAGACTTTTTCTCTGATTG

NdeI NdeII

[a-32P]dCTP added just before the last cycle. The addition of the labelled dCTP at this stage prevents an underestimation of the proportion of mutant mtDNA caused by heteroduplex formation (PCR ‘‘Last Cycle Hot’’) (Moraes et al., 1992). The digested fragments were subsequently size fractionated by electrophoresis on 8% or 12% polyacrylamide gels which were dried and exposed in a cassette at 80 C during 24 h. The relative proportions of mutant and wild-type mtDNA were determined by densitometric analysis, using a StudioScan scanner (Agfa). 2.6. Mitochondrial DNA databases A total of 61 mammal sequences were used for interspecies comparison for mtDNA polypeptides from GiiB-JST mtSNP (mitochondrial Single Nucleotide Polymorphism) database (http://www.giib.or.jp/mtsnp/index_e.shtml) and ribosomal genes (available upon request). For tRNA interspecies analysis, a series of 30 mammal sequences were selected from Mamit-tRNA database (http://mamit-trna. u-strasbg.fr/Summary.html). The conservation index (CI) was calculated as described for mtDNA polypeptides, tRNA and rRNA mutations (Ruiz-Pesini et al., 2004; Ruiz-Pesini and Wallace, 2006). We also referred to mtDB: Human Mitochondrial Genome Database (http://www. genpat.uu.se/mtDB/) and MITOMAP: A Human Mitochondrial Genome Database (http://www.mitomap.org, 2006).

CACGGACTACAACCACGACCAATCATA nt 14682–14708 GCCCTATTACTATCCATCCTC nt 15623–15643 m.14710G>A tRNAGlu m.15952C>T tRNAThr

The entire mtDNA of each sample was PCR amplified in nine overlapping fragments and selected RFLP haplotype markers, defining the major mitochondrial haplogroups, were analysed as described previously (Torroni et al., 1996). 3. Results 3.1. MtDNA analysis with Surveyor Nuclease strategy

nt, nucleotide; bp, base pair.

nt nt nt nt nt nt nt TCTGATAAAAGAGTTACTTTGCT CCCTTACCACGCTACTCCTA CCCTTACCACGCTACTCCTA AGTCCAATGCTTCACTCAGC GGTATACTACGGTCAATGCTC CTATTGATCCCCACCTCC CCCTTACGAGTGCGGCTTCGACCGTA m.4295A>G tRNAIle m.5667G>A tRNAAsn m.5703G>A tRNAAsn m.5985G>A COXI m.8344A>G tRNALys m.8993T>G ATPase 6 m.10191T>C ND3

4272–4294 5461–5480 5461–5480 5863–5882 8155–8175 8611–8628 10163–10188

Forward primer position Forward Primer (5 0 –3 0 )

Primer sequence

2.7. Mitochondrial DNA Haplotyping

Mutation

Table 1 Primer sequences and restriction enzymes used for quantitation of mitochondrial DNA heteroplasmy (GenBank J01415.2)

MaeI Eco147I HindIII EcoRI BanII HpaII Bst1107I

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

Amplicon size Restriction (bp) Enzyme

138

We selected 50 patients on the following inclusion criteria: neuromuscular features suggesting respiratory chain dysfunction and/or morphological evidence of altered mitochondrial function in the muscle biopsy specimen. Ages of the subjects (23 males and 27 females) ranged between 2 months and 77 years (mean: 28 years). A total of 33 (66%) patients underwent a muscle biopsy as part of the diagnostic workup. In all cases, we excluded the presence of the m.3243A>G mutation in blood. We did find neither mtDNA deletion, nor m.3243A>G mutation in muscle biopsies which were available. With Surveyor strategy, we identified 27 different sequence variations (Table 2) and a total of 11 patients harbored known or putative deleterious mtDNA mutations. Their reports are presented in more details in Table 3 and their pedigrees are given in Fig. 1. In addition, two of them carried homo-

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

139

Table 2 mtDNA sequence variations identified in patients presenting with neuromuscular symptoms Amplicons

Heteroplasmic nucleotide variations

Amino acid substitutions

Locus

Number of patients

Conservation index (% CI)

Presence in mtDB databasea (2469 sequences)

A/ P

m. 214A>T m.310T>C m.315_316insC m.424_425insT m.441C>G m.568_569insC(2–8) m.573A>C m.4295A>G m.4520A>T m.4851C>T m.5667G>A m.5703G>A m.5985G>A m.7028C>T m.7472A>C m.7472–7473insC m.8344A>G m.8993T>G m.9896A>G m.10191T>C m.14710G>A m.15952C>T m.16145G>A m.16189T>C m.16271T>C

– – – – – – – – p.T17T p.L128L – – p.V28I p.A375A – – – p.L156R p.K230K p.S45P – – – – –

D Loop D Loop D Loop D Loop D Loop D Loop D Loop tRNAIle ND2 ND2 tNRAAsn tRNAAsn COXI COXI tRNASer tRNASer tRNALys ATPase 6 COX III ND3 tRNAGlu tRNAThr D Loop D Loop D Loop

1/50 13/50 3/50 1/50 1/50 2/50 2/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 1/50 10/50 1/50

– – – – – – – 100 – – 90 9.6 14.7 – 67.7 – 35.4 98.3 – 14.7 100 96.7 – – –

No Yes No No Yes No No Yes No No No No No Yes Yes No Yes No No No No No Yes Yes Yes

Amplicons

Homoplasmic nucleotide variations

Amino acid substitutions

Locus

Number of patients

Conservation index (% CI)

Presence in mtDB databasea (2469 sequences)

C/ J H0/ P

m.4317delA m.15735T>C

– p.A330V

tRNAIle Cyt b

1/50 1/50

– 83.6

No Yes (1)

C/ J

C/ K K D/ K D D/ L E/ L E F/ M H/ P H0/ P

(15)

(1)

(5)

(457) (1) (1)

(45) (442) (9)

Novel mtDNA variations are in bold. Conservation index was calculated as described in Ruiz-Pesini et al. (2004), a from Ingman and Gyllensten (2006). Numbers in brackets indicate the number of sequences harboring the same substitution among the 2469 found in the mtDB database.

plasmic mutations (Tables 2 and 3) detected by sequencing amplicons containing heteroplasmic variants. The substitutions listed in Table 3 were first identified in DNA extracted from muscle in 6 patients and from leukocytes in 5 patients. Restriction fragment lengh polymorphism (RFLP) was used to confirm the presence of the mutations detected by Surveyor Nuclease and identified by sequencing. Furthermore, a high level of heteroplasmy in affected tissues is a good criterion for the deleterious nature of a mtDNA variation. The percentage heteroplasmy of the mutations was determined by analyzing radioactive labeled PCR products after restriction digest in tissues of patients and relatives which were available (Table 4). 3.2. Clinical presentations of patients harboring candidate mtDNA mutations 3.2.1. Family M1 Patient M1, III1 a 57 year-old man presented with progressive falls and myoclonus epilepsy since the age of 35 (Table 3). Family history strongly suggests a maternal inheritance with neurological disorders associated with early death and wheelchair bound patients (Fig. 1). The patient’s sister (M1, III2) is a 51 year-old female. At 40

year-old, she developed myoclonus epilepsy, gait imbalance associated with spasmodic dysphonia. Histochemical examination of the skeletal muscle biopsy showed raggedred and cytochrome c oxidase negative fibers. The respiratory chain enzyme activities revealed a complex IV defect. But, unfortunately, no more material was available for a complementary molecular analysis. The mother of both probands died earlier of leukemia and a 53 year-old younger sister seems unaffected but has denied further testing. By screening the entire mitochondrial genome with Surveyor Nuclease strategy, we identified the m.8344A>G mutation in the lysine tRNALys gene in combination with a second m.4295A>G substitution in the tRNAIle gene. The percentage of both m.4295A>G and m.8344A>G mutants varies in different tissues in both affected individuals in family M1 (Table 4). The m.8344A>G mutation is responsible for MERRF syndrome (Shoffner et al., 1990). The m.4295A>G substitution has been previously associated with hypertrophic cardiomyopathy (Merante et al., 1996). This sequence variation, highly conserved among various species (100% conservation index), occurs at the nucleotide immediately following the anticodon residues of the tRNA molecule. Nevertheless, the m.4295A>G variant is found in mtDB database (Table 2) and has been suggested to represent a rare, haplogroup K-specific

No No Yes Yes 10 10 48 15 32 39 50 17 M F F M M8, II2 M9, II1 M10, II5 M11, II1

= Deceased; PEO, progressive external ophtalmoplegia; ND, not done; RRF, ragged red fibers; Cox, cytochrome oxydase negative fibers; CI, CIV, respiratory chain complexes I or IV, respectively. Novel mutations are in bold.

m.5667G>A m.14710G>A m.4317delA m.15735C>T Normal Normal Normal ND RRF, Cox RRF, Cox RRF, Cox RRF

m.15952C>T Normal M M7, II1

26

3

No

Ataxia, developmental delay, muscle weakness, retinitis pigmentosa Bilateral PEO and ptosis Bilateral PEO, retinitis pigmentosa, migraines ‘‘Stroke-like’’ episode, ptosis Muscle weakness, ptosis,

Normal

Bilateral basal ganglia subacute necrotizing lesions on MRI, lactic acidosis Bilateral basal ganglia subacute necrotizing lesions on MRI – – – Cardiomyopathy No 4 months M M6, II1

4

No 17 M M5, II1

43

Yes Yes Yes 19 Birth 30 F M F M2, II1 M3, I11 M4, II1

29 =5 months 60

Normal

m. 10191T>C CI defect

ND –

ND

ND CIV defect Normal RRF, Cox RRF, Cox RRF, Cox Gastrointestinal dysmotility Severe lactic acidosis Diabetes, Hashimoto thyroiditis

ND ND

Myoclonus epilepsy, muscle proximal weakness, dysarthria PEO, muscle proximal weakness Hypotonia, developmental delay Muscle proximal weakness, Parkinson disease Ataxia, neuropathy, epilepsy, retinitis pigmentosa Leigh syndrome (hypotonia, developmental delay, seizures) M M1, III1

55

35

Yes

Multiple lipomas

Enzymology Histology

Muscle biopsy Other symptoms Neurological symptoms

Familial history Onset (years) Age (years) Sex Patient

Table 3 Clinical phenotypes of patients harboring known or putative pathogenic mtDNAs

m.4295A>G + m.8344A>G m.5703G>A m.5985G>A m.7472A>C + 7472_7473insC m.8993T>G

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

MtDNA sequence variations

140

polymorphism (Herrnstadt et al., 2002). However, haplogroup-specific markers defining K (m.12308 A>G; m.9055G>A) were absent in our patient M1, III1. Indeed this family belongs to haplogroup I based on HVS1 motif and the presence of haplogroup-specific polymorphisms at positions 10398 A>G, m.4529A>T, m.10034T>C and m.10238T>C. Hence, this variant present in a different mtDNA background demonstrates that the m.4295A>G has arisen at least two independent times. 3.2.2. Family M2 We identified an heteroplasmic m.5703G>A mutation in the tRNAAsn gene in muscle of patient M2, II1 who presented with a myopathy associated with gastrointestinal dysmotility (Table 3). The patient’s mother also suffered from muscle weakness. The m.5703G>A mutation has been previously reported in patients with a pure myopathy (Hao et al., 1997; Vives-Bauza et al., 2003) and functional studies have shown that the m.5703G>A mutation causes a conformational change and leads to a severe reduction in the tRNAAsn pool (Hao et al., 1997). 3.2.3. Family M3 The patient M3, II1 was born, from non consanguinous parents, at term after a normal pregnancy and delivery. Motor developmental delay was rapidly noted with hypotonia and severe lactic acidosis leading to death at 5 months of age. Histopathology performed on skeletal muscle showed cytochrome c oxidase negative and ragged-red fibers. Complex IV enzyme activity on muscle was significantly decreased (Table 3). A novel heteroplasmic substitution m.5985G>A (p.V28I) in the COXI gene was detected in skeletal muscle. This substitution leads to a replacement of a hydrophobic valine by an isoleucine and the conservation index of this amino acid replacement is low (14.7%) (Table 2). The mutant load of this variant is similar in muscle and blood (17 and 16%, respectively) (Table 4). A second child (M3, II2) presented with a rapidly progressive hepatic failure and died at 4 months of age but we failed to identify the m.5985G>A variant in muscle biopsy. Even if liver was not tested in this second child, all these arguments do not argue in favor of a deleterious nature of this variant, which is likely a polymorphism. 3.2.4. Family M4 Patient M4, II1 presented with a large spectrum of disorders, including myopathy, Parkinson disease, type 2 diabetes, without sensorineural deafness, and Hashimoto thyroiditis (Table 3). A maternal uncle died after a stroke episode. We identified a m.7472_7473insC mutation associated with a m.7472A>C substitution at the same nucleotide in the tRNASer(UCN) gene. The m.7472_7473insC mutation has been reported in patients mainly affected with sensorineural deafness and ataxia (Tiranti et al., 1995; Jaksch et al., 1998; Schuelke et al., 1998). Two patients who harbored both m.7472_7473insC and m.7472A>C variations have been previously reported. The first one presented with

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

141

I 1

2

I

II 1

2

1

3

III

2

3

4

II 1

2

3

4

5

1

6

IV

I 1

2

3

6

4 5

1

V

III

I

7

1

2

II

1

1

Family M1

2

IV

II

1

I 1

2

Family M2

2

3

1

2

1

2

I 1

II 1

2

Family M3

Family M4

2

3

4

II 1

2

Family M6

Family M5

I 1

2

1

2

I

II 1

2

3

4

5

1

6

1

III 1

2

3

4

5

2

I

II 1

6

1

2

2

3

4

5

6

7

I 1

II 1

IV

2

II

III 1

2

I

2

III 1

1

Family M7

Family M8

II 1

Family M9

2

2

3

4

5

Family M10

6

1

2

3

Family M11

Fig. 1. Pedigrees of patients harboring known or putative mtDNA mutations. Solid symbols indicate affected individuals and open symbols represent unaffected individuals.

Table 4 Heteroplasmy levels (%) in patients harboring known or putative deleterious mtDNA sequence variations Patient number

% mutant mtDNA Blood

Buccal mucosa

Urinary epithelial cells

Muscle

90 72

83 –

92 65

– –

70 69

55 –

83 73

– –

5703 mutant mtDNA M2, II1

–

–

–

38

5985 mutant mtDNA M3, II1 M3, II2

16 –

– –

– –

17 0

8993 mutant mtDNA M5, II1

73

–

–

–

10191 mutant mtDNA M6, II1 M6, I1 M6, I2

68 0 0

– – –

– – –

69 – –

15952 mutant mtDNA M7, III1 M7, II2

43 18

22 34

– –

51 –

5667 mutant mtDNA M8

10.5

–

–

32

14710 mutant mtDNA M9

–

–

–

62

4295 mutant mtDNA M1, III1 M1, III2 8344 mutant mtDNA M1, III1 M1, III2

early onset myopathy (Pulkes et al., 2005) and the second patient died of progressive encephalomyopathy (Cardaioli et al., 2006). 3.2.5. Family M5 Patient M5, II1 had no family history. The clinical phenotype was consistent with a NARP syndrome (Table 3) and the only mtDNA variant that we identified in blood, with Surveyor strategy, was the m.8993T>G mutation with a mutant load estimated at 73% of heteroplasmy (Table 4). 3.2.6. Family M6 Patient M6, II1 presented with Leigh syndrome at 6 months of age (Table 3). His mother had seizures as a child until the age of seven and is healthy now. Mitochondrial enzyme activities on patient muscle revealed a complex I defect and we identified a m.10191T>C mutation in the ND3 gene. This m.10191T>C mutation changes a hydrophilic serine residue into a hydrophobic proline (p.S45P) in a highly conserved part of the ND3 subunit and has been previously reported in children with Leigh or Leigh-like encephalopathy (Taylor et al., 2001; Lebon et al., 2003; McFarland et al., 2004). The proband was shown to harbor 68% and 69% of heteroplasmy in blood and muscle, respectively, (Table 4). Maternal relatives of our patient were found negative for the m.10191T>C mutation in DNA extracted from blood (Table 4). De novo occurrence of this mutation has been suggested in previous cases (McFarland et al., 2004).

142

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

3.2.7. Family M7 Patient M7, III1 is now 26 and presented with hypotonia and developmental delay at 3 years of age. At 10 years of age, he was diagnosed with Tourette syndrome with motor and verbal tics. He developed at 23 years of age progressive ataxia and muscle weakness with frequent falls associated with retinitis pigmentosa. A brain MRI done at this time revealed bilateral lesions in the basal ganglia suggesting a progressive encephalopathy. Plasma and urinary lactate and pyruvate were constantly normal. Investigation of his muscle biopsy (histology, electron microscopy and enzyme activities) was unremarkable (Table 3). We identified a novel m.15952C>T heteroplasmic mutation in the tRNAThr gene. This nucleotide is highly conserved (CI: 96.7%) and its replacement disrupts the Watson-Crick base pairing rules and may cause instability of the aminoacyl stem (Helm et al., 2000). The mutation was also found at lower level (18%) in the leukocytes of the unaffected mother (Table 4). 3.2.8. Family M8 The 32-year-old patient M8, II2 presented with a unilateral ptosis when he was 10-year-old. Five years later, he developed bilateral progressive external ophtalmoplegia and ptosis. No respiratory chain defect was found in muscle biopsy, which revealed the presence of few ragged-red, cytochrome oxydase negative fibers (Table 3). We identified a novel m.5667G>A variation in the tRNAAsn gene. This nucleotide has a high CI (90%) and is located in the T stem of the tRNA (Table 2). The level of heteroplasmy was higher in muscle than in blood (32% and 10.5%, respectively) and the percentage of mutant DNA in muscle was consistent with the absence of enzymatic defect and the identification of only few ragged-red fibers (Table 4). 3.2.9. Family M9 The 39-year-old patient M9, II1 is a woman who presented with retinitis pigmentosa at 10 years of age. Later, she developed bilateral progressive external ophtalmoplegia and ptosis. At present, she suffers from recurrent migraine attacks. Muscle biopsy showed ragged-red and COX negative fibers but no respiratory chain enzyme defect was detected by spectrophotometry analysis (Table 3). We found a novel G to A transition at mtDNA position 14710, which changes the anticodon normally found in glutamic acid tRNAs (UUC) to the one found in lysine tRNAs (UUU). The mutant mtDNA was heteroplasmic in muscle (62%) (Table 4). 3.2.10. Family M10 The patient M10, II5 is a 50-year-old woman who presented with a stroke-like episode. His brother had a similar clinical history. The diagnosis of multiple sclerosis was evocated for the elder sister when she was 32-year-old. Later, she developed epilepsy and progressive generalized muscle weakness. Investigation of her muscle biopsy led to the diagnosis of mitochondrial defect based on the presence

of ragged red and COX negative fibers (Table 3). The mother (I2) had an unilateral ptosis only. By sequencing mtDNA regions containing putative heteroplasmic variations detected with Surveyor strategy, we identified a novel homoplasmic mutation in the muscle of the proband. This deletion m.4317delA, which was also found in patient’s II2 leukocytes, is located in the tRNAIle gene and has not been described previously. Nevertheless, a m.4317A>G mutation has been reported in a patient with fatal infantile cardiomyopathy (Tanaka et al., 1990). The m.4317A>G point mutation is located in the T loop and induces a decrease in isoleucylation (Degoul et al., 1998). 3.2.11. Family M11 The proband (M11, II1) presented with cardiomyopathy, ptosis, and muscular weakness and the muscle biopsy showed ragged-red fibers (Table 3). His mother suffered from optic atrophy. In both mother and son, we also identified a novel homoplasmic variation by sequencing regions of interest in the mitochondrial genome. The m.15735C>T substitution in the cytochrome b gene leads to the replacement of a highly conserved amino acid (CI: 83.6%) changing an alanine in valine at position 330 (p.A330V) (Table 2). Unfortunately no muscle sample was available for spectrophotometric analysis. 4. Discussion 4.1. Mitochondrial gene defects in neuromuscular phenotypes We analysed a series of 50 children and adults with neuromuscular symptoms and clinical presentations suggesting a respiratory chain dysfunction and negative for both mtDNA deletion and m.3243A>G mutation. We identified a total of 27 different sequence variations. In addition, we found putative or known overtly deleterious mutations in 11 patients out of 50. All but one (m.5985G>A) are likely to be responsible for the phenotype but will require functional studies such as cybrid cell lines analysis, to demonstrate their pathological nature. Hence, a mtDNA gene defect was found in approximately 20% of patients in agreement with previous study (Thorburn et al., 2004). Ten sequence variations were located in the D-loop, nine in tRNA genes and eight in genes coding for respiratory chain proteins. Two different substitutions in tRNAIle and tRNALys genes (m.4295A>G and m.8344A>G, respectively) co-segregated in family M1 with different levels of heteroplasmy in different patients. This m.4295A>G variant has been suggested to be part of a rare mtDNA K haplogroup but our patient belongs to a different mtDNA background. Moreover, a functional analysis of several tRNAIle mutations including the m.4295A>G has demonstrated that this mutation is responsible for a significant reduction of 3 0 -tRNase processing efficiency but without affecting the secondary structure (Levinger et al., 2003). Further studies would need to be performed to be certain that the m.4295A>G variant is playing a role in modifying

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

the phenotype. Examples of such ‘‘two mutations’’ have been previously reported in other pedigrees harboring for instance two primary LHON mutations (Brown et al., 2001). Nevertheless, our results and previous studies suggest that a combination of two variants may modulate the different phenotypes observed within a family and illustrates the interest to screen the entire mtDNA even when a pathogenic mutation has been identified. Among the sequence variations listed in Table 2, nine were novel and four corresponded to overtly deleterious mutations. The majority of pathogenic mutations were located in tRNA genes (seven different mutations in six out of 10 patients). Known deleterious mutations are principally concentrated in the tRNALeu(UUR), tRNAIle and tRNALys genes (Ruiz-Pesini and Wallace, 2006). We found no mutation in the tRNALeu(UUR) gene but patients carrying the m.3243A>G mutation had been previously ruled out from the study by RFLP analysis. Two mutations were located in tRNAIle and one in each of tRNALys, tRNASer, tRNAAsn, tRNAGlu and tRNAThr genes. The other mutations were located in genes coding for respiratory chain proteins (COXI, ND3, Cytb). This result emphasizes the importance of scanning the entire mitochondrial genome in patients with neuromuscular symptoms when the m.3243A>G mutation in tRNALeu(UUR)gene has been excluded. Moreover, several mtDNA mutations appear to be de novo mutations, or at least were not detectable in the maternal relative’s blood (Thorburn et al., 2004). In these families, pedigrees information is not helpful but emphasizes the need for a screening of the entire mtDNA even in the absence of maternal inheritance if the clinical phenotype is suggestive of a mitochondrial disease. Among patients listed in Table 3 who underwent a muscle biopsy, all but one (M7, II1) had significant mitochondrial morphologic alterations (RRF or COX- fibers) and/ or a respiratory chain defect. There is no clear correlation between histological and biochemical results. Enzymatic defects are principally found in children while ragged-red and cytochrome negative fibers are mainly observed in adult patients. Numerous studies, including different mtDNA mutations, indicate that mutant mtDNAs impair respiratory chain activity only when present at greater than 90% (Wallace, 2005). Nevertheless, histochemistry and mitochondrial enzyme analysis done on skeletal muscle have proved to be a very useful selection parameter for Surveyor screening. 4.2. Surveyor Nuclease strategy is a relevant method to detect heteroplasmic point mutations Identification of mtDNA point mutations is a difficult task because they may occur at any position and the level of heteroplasmy may be very low according to the nature of the tissues which are analysed. Here we show that exhaustive screening with Surveyor strategy can be routinely used in diagnostic laboratories when common mutations have already been ruled out. The efficiency of this

143

procedure is attested by the large number of sequence variations identified. In a previous study, we have shown that Surveyor Nuclease strategy seems to be sensitive enough to detect heteroduplexes even when heteroplasmic mutations are present at levels as low as 3% (Bannwarth et al., 2005). Nevertheless, when a mismatch has been detected, the point mutation has to be identified by sequencing analysis. However, sequence analysis can be challenging since sequencing fails to detect mutations that are present at a low heteroplasmic level (20% or below) (Wong et al., 2002; Biggin et al., 2005). Pyrosequencing has recently been shown to reach a mutation detection level of 5% mutant load (Andreasson et al., 2002). Another alternative is to select another tissue susceptible to harbor a higher level of heteroplasmy (muscle biopsy or urinary cells versus leukocytes, for example). Furthermore, we are currently testing the denaturing high performance liquid chromatography (DHPLC) coupled to a fraction collector module to elute the heteroduplex peak which represents an equimolar mixture of mutant and wild-type DNA strands. After PCR amplification of this heteroduplex specific fraction, the identification of the mutation by sequencing should be easier. Preliminary results regarding to the identification of the m.3243A>G mutation are encouraging (data not shown). In conclusion, this study shows that, in clinical practice, the exhaustive search for mtDNA mutations is highly significant in patients with neuromuscular symptoms evocative of a respiratory chain defect. Surveyor nuclease strategy allows the identification in 48 h of point mutations which are frequently found in tRNA genes but can also be located at any position in the mitochondrial genome. The obvious limitation of the method concerns the impossibility to detect homoplasmic pathogenic mutations responsible for respiratory chain defects. Nevertheless, another potential interest of the method concerns the identification of mitochondrial DNA somatic mutations which have been described in numerous cancers and tumoral cell lines (Brandon et al., 2006). These point mutations are usually found in homoplasmy and in this case, it is possible to mix equimolar amounts of DNA extracted from non tumoral and tumoral tissues in a same patient to create heteroduplexes which can be detected by Surveyor nuclease. Acknowledgments We thank B. Chafino, A. Blombou, S. Charabot, and A. Figueroa for technical help. We also thank Phil Eastlake from Transgenomic for technical help and helpful discussions. This work was made possible by grants to V.P.-F from CHU Nice (CPR UF 699), France, and a grant from the Gessler Foundation awarded to V.P. References Andreasson, A., Asp, A., Alderborn, A., Gyllensten, U., Allen, M., 2002. Mitochondrial sequence analysis for forensic identification using pyrosequencing technology. Biotechniques 32, 124–126.

144

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145

Andrews, R.M., Kubacka, I., Chinnery, P.F., Lightowlers, R.N., Turnbull, D.M., Howell, N., 1999. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet. 23, 147. Bannwarth, S., Procaccio, V., Paquis-Flucklinger, V., 2005. Surveyor nuclease: a new strategy for a rapid identification of heteroplasmic mitochondrial DNA mutations in patients with respiratory chain defects. Hum. Mutat. 25, 575–582. Bannwarth, S., Procaccio, V., Paquis-Flucklinger, V., 2006. Rapid identification of unknown heteroplasmic mutations across the entire human mitochondrial genome with mismatch-specific Surveyor Nuclease. Nat. Protocols 1, 2037–2047. Barros, F., Lareu, M.V., Salas, A., Carracedo, A., 1997. Rapid and enhanced detection of mitochondrial DNA variation using singlestrand conformation analysis of superposed restriction enzyme fragments from polymerase chain reaction-amplified products. Electrophoresis 18, 52–54. Biggin, A., Henke, R., Bennetts, B., Thorburn, D.R., Christodoulou, J., 2005. Mutation screening of the mitochondrial genome using denaturing high-performance liquid chromatography. Mol. Genet. Metab. 84, 61–74. Brandon, M., Baldi, P., Wallace, D.C., 2006. Mitochondrial mutations in cancer. Oncogene 25, 4647–4662. Brown, M.D., Allen, J.C., Van Stavern, G.P., Newman, N.J., Wallace, D.C., 2001. Clinical, genetic, and biochemical characterization of a Leber Hereditary Optic Neuropathy family containing both the 11778 and 14484 primary mutations. Am. J. Med. Genet. 104, 331– 338. Cardaioli, E., Da Pozzo, P., Cerase, A., Sicurelli, F., Malandrini, A., De Stefano, N., Stromillo, M.L., Battisti, C., Dotti, M.T., Federico, A., 2006. Rapidly progressive neurodegeneration in a case with the 7472insC mutation and the A7472C polymorphism in the mtDNA tRNA ser(UCN) gene. Neuromuscul. Disord. 16, 26–31. Degoul, F., Brule, H., Cepanec, C., Helm, M., Marsac, C., Leroux, J., Giege, R., Florentz, C., 1998. Isoleucylation properties of native human mitochondrial tRNAIle and tRNAIle transcripts. Implications for cardiomyopathy-related point mutations (4269, 4317) in the tRNAIle gene. Hum. Mol. Genet. 7, 347–354. Dimauro, S., Schon, E.A., 2001. Mitochondrial DNA mutations in human disease. Am. J. Med. Genet. 106, 18–26. Hao, H., Manfredi, G., Moraes, C.T., 1997. Functional and structural features of a tandem duplication of the human mtDNA promoter region. Am. J. Hum. Genet. 60, 1363–1372. Helm, M., Brule, H., Friede, D., Giege, R., Putz, D., Florentz, C., 2000. Search for characteristic structural features of mammalian mitochondrial tRNAs. RNA 6, 1356–1379. Herrnstadt, C., Elson, J.L., Fahy, E., Preston, G., Turnbull, D.M., Anderson, C., Ghosh, S.S., Olefsky, J.M., Beal, M.F., Davis, R.E., et al., 2002. Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups. Am. J. Hum. Genet. 70, 1152–1171. Ingman, M., Gyllensten, U., 2006. mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences. Nucleic Acids Res. 34, D749–D751, Database Issue. Jaksch, M., Klopstock, T., Kurlemann, G., Dorner, M., Hofmann, S., Kleinle, S., Hegemann, S., Weissert, M., Muller-Hocker, J., Pongratz, D., 1998. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the tRNA(Ser(UCN)) gene others. Ann. Neurol. 44, 635–640. Lebon, S., Chol, M., Benit, P., Mugnier, C., Chretien, D., Giurgea, I., Kern, I., Girardin, E., Hertz-Pannier, L., de Lonlay, P., 2003. Recurrent de novo mitochondrial DNA mutations in respiratory chain deficiency et al.. J. Med. Genet. 40, 896–899. Levinger, L., Giege, R., Florentz, C., 2003. Pathology-related substitutions in human mitochondrial tRNA(Ile) reduce precursor 3 0 end processing efficiency in vitro. Nucleic Acids Res. 3, 1904–1912. McFarland, R., Kirby, D.M., Fowler, K.J., Ohtake, A., Amor, D.J., Fletcher, J.M., Dixon, J.W., Collins, F.A., Turnbull, D.M., 2004. De

novo mutations in the mitochondrial ND3 gene as a cause of infantile mitochondrial encephalopathy and complex I deficiency et al.. Ann. Neurol. 55, 58–64. Merante, F., Myint, T., Tein, I., Benson, L., Robinson, B.H., 1996. An additional mitochondrial tRNA(Ile) point mutation (A-to-G at nucleotide 4295) causing hypertrophic cardiomyopathy. Hum. Mutat. 8, 216–222. Moraes, C.T., Atencio, D.P., Oca-Cossio, J., Diaz, F., 2003. Techniques and pitfalls in the detection of pathogenic mitochondrial mutations. J. Mol. Diagn. 5, 197–208. Moraes, C.T., Ricci, E., Bonilla, E., Dimauro, S., Schon, E.A., 1992. The mitochondrial tRNA(Leu(UUR)) mutation in mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS): genetic, biochemical, and morphological correlations in skeletal muscle. Am. J. Hum. Genet. 50, 934–949. Paul, R., Santucci, S., Saunieres, A., Desnuelle, C., Paquis-Flucklinger, V., 1996. Rapid mapping of mitochondrial DNA deletions by large fragment PCR. Trends Genet. 12, 131–132. Pulkes, T., Liolitsa, D., Eunson, L.H., Rose, M., Nelson, I.P., Rahman, S., Poulton, J., Marchington, D.R., Landon, D.N., Debono, A.G., 2005. New phenotypic diversity associated with the mitochondrial tRNA(SerUCN) gene mutation et al.. Neuromuscul. Disord. 15, 364– 371. Qiu, P., Shandilya, H., D’Alessio, J.M., O’Connor, K., Durocher, J., Gerard, G.F., 2004. Mutation detection using Surveyor nuclease. BioTechniques 36, 702–707. Ruiz-Pesini, E., Mishmar, D., Brandon, M., Procaccio, V., Wallace, D.C., 2004. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 303, 223–226. Ruiz-Pesini, E., Wallace, D.C., 2006. Evidence for adaptive selection acting on the tRNA and rRNA genes of human mitochondrial DNA. Hum. Mutat. 27, 1072–1081. Schuelke, M., Bakker, M., Stoltenburg, G., Sperner, J., von Moers, A., 1998. Epilepsia partialis continua associated with a homoplasmic mitochondrial tRNA(Ser(UCN)) mutation. Ann. Neurol. 44, 700–704. Shoffner, J.M., Lott, M.T., Lezza, A.M.S., Seibel, P., Ballinger, S.W., Wallace, D.C., 1990. Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA tRNALys mutation. Cell 61 (6), 931–937. Sternberg, D., Danan, C., Lombes, A., Laforeˆt, P., Girodon, E., Goossens, M., Amselem, S., 1998. Exhaustive scanning approach to screen all the mitochondrial tRNA genes for mutations and its application to the investigation of 35 independent patients with mitochondrial disorders. Hum. Mol. Genet. 7, 33–42. Tanaka, M., Ino, H., Ohno, K., Hattori, K., Sato, W., Ozawa, T., Tanaka, T., Itoyama, S., 1990. Mitochondrial mutation in fatal infantile cardiomyopathy. Lancet 336, 1452. Taylor, R.W., Singh-Kler, R., Hayes, C.M., Smith, P.E., Turnbull, D.M., 2001. Progressive mitochondrial disease resulting from a novel missense mutation in the mitochondrial DNA ND3 gene. Ann. Neurol. 50, 104–107. Thorburn, D.R., Sugiana, C., Salemi, R., Kirby, D.M., Worgan, L., Ohtake, A., Ryan, M.T., 2004. Biochemical and molecular diagnosis of mitochondrial respiratory chain disorders. Biochim. Biophys. Acta 1659, 121–128. Tiranti, V., Chariot, P., Carella, F., Toscano, A., Soliveri, P., Girlanda, P., Carrara, F., Fratta, G.M., Reid, F.M., Mariotti, C., 1995. Maternally inherited hearing loss, ataxia and myoclonus associated with a novel point mutation in mitochondrial tRNASer(UCN) gene et al.. Hum. Mol. Genet. 4, 1421–1427. Torroni, A., Huoponen, K., Francalacci, P., Petrozzi, M., Morelli, L., Scozzari, R., Obinu, D., Savontaus, M.L., Wallace, D.C., 1996. Classification of European mtDNAs from an analysis of three European populations. Genetics 144, 1835–1850. Vialettes, B.H., Paquis-Flucklinger, V., Pellissier, J.F., Bendahan, D., Narbonne, H., Silvestre-Aillaud, P., Montfort, M.F., Righini-Chossegros, M., Pouget, J., Cozzone, P.J., 1997. Phenotypic expression of

S. Bannwarth et al. / Mitochondrion 8 (2008) 136–145 diabetes secondary to a T14709C mutation of mitochondrial DNA others. Diabetes Care 20, 1731–1737. Vives-Bauza, C., Del Toro, M., Solano, A., Montoya, J., Andreu, A.L., Roig, M., 2003. Genotype–phenotype correlation in the 5703G>A mutation in the tRNA(Asn) gene of mitochondrial DNA. J. Inherit. Metab. Dis. 26, 507–508.

145

Wallace, D.C., 2005. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: a dawn for evolutionary medicine. Annu. Rev. Genet. 39, 359–407. Wong, L.J., Liang, M.H., Kwon, H., Park, J., Bai, R.K., Tan, D.J., 2002. Comprehensive scanning of the entire mitochondrial genome for mutations. Clin. Chem. 48, 1901–1912.