- Email: [email protected]
Rapid identification of polymorphic microsatellite loci in a forest pathogen, Dothistroma pini, using anchored PCR
Mycol. Res. 105 (9) : 1075–1078 (September 2001). Printed in the United Kingdom.
1075
Rapid identification of polymorphic microsatellite loci in a forest pathogen, Dothistroma pini, using anchored PCR
Rebecca J. GANLEY1 and Rosie E. BRADSHAW2* " Department of Forest Resources, University of Idaho, Moscow, ID 83844-1133, USA. # Institute of Molecular BioSciences, Massey University, Private Bag 11222, Palmerston North, New Zealand. E-mail : R.E.Bradshaw!massey.ac.nz Received 14 November 2000 ; accepted 16 May 2001.
A microsatellite-based DNA profiling system was developed that can be used to distinguish genetically diverse isolates of a forest pathogen, Dothistroma pini. All isolates of this pathogen identified in New Zealand so far appear to be isogenic and the disease is kept under control by aerial applications of copper fungicide. Although New Zealand has strict importation controls in place, the possibility of genetically diverse isolates of D. pini being introduced from other countries poses a severe biosecurity threat to forest health. Therefore a DNA-based monitoring system was developed. Two informative microsatellite loci were found serendipitously in D. pini sequence data available in our laboratory. Further microsatellite loci were obtained using a rapid 5h-anchored PCR amplification technique. For each informative locus identified, specific primers were designed to flank the repeated sequence and subsequently used to generate DNA profiles for the D. pini strains. The profiles obtained from five microsatellite loci were sufficient to distinguish most isolates tested. The anchored primer technique provides an efficient tool for the identification of polymorphic loci that can be used to screen for genetic differences between fungi.
INTRODUCTION Dothistroma pini causes needle blight of pine trees and consequent loss of growth in commercial forests (Gibson 1972). The motivation for developing a DNA profiling test for this species was to provide a tool for screening and prognosis of infected pine forests in New Zealand. There appears to be only one isogenic strain of D. pini in New Zealand at present (Hirst et al. 1999) and the disease is kept in check by aerial applications of copper fungicide. However the introduction of diversity into the gene pool by introducing overseas strains into New Zealand could potentially have serious economic consequences for the forest industry (Chou 1991). Our observation that some D. pini isolates from other countries produce significantly more of the phytotoxin dothistromin in culture compared to New Zealand isolates (Bradshaw, Ganley & Jones 2000) prompted efforts to develop a screening system. Mycologists have an increasingly wide choice of tools with which to detect specific pathogens, diagnose disease and measure diversity within a species. DNA-based methods, particularly those involving PCR, provide some of the most powerful, sensitive and discriminatory tools currently available. Therefore a DNA-based monitoring system for D. pini was developed as a tool to help maintain New Zealand’s high standard of biosecurity. * Corresponding author.
There are disadvantages to many of the PCR-based methods currently used for fungal typing. For example, although RAPD–PCR (Williams et al. 1990) has high resolution and is simple to carry out it requires exquisite control to achieve robustness. AFLPs (Vos et al. 1995) are also very informative but require careful optimisation of conditions for restriction enzyme activity, ligation of adapters and PCR. Microsatellites (also known as short tandem repeats) are tandemly repeated copies of a short nucleotide sequence that have been used for PCR-based DNA typing of fungi (Groppe et al. 1995, Moon, Tapper & Scott 1999). The main disadvantage of this method is the time and effort required to identify informative microsatellite loci ; screening of a genomic library is often required. We describe here a rapid technique to identify microsatellite loci in fungi, based on a method described for pine trees (Fisher, Gardner & Richardson 1996) involving anchored PCR primers. MATERIALS AND METHODS A representative set of Dothistroma pini isolates from eight countries was used in this study : ALP3 (Germany), BRZ1 (Brazil), CAN3 (Canada), FRA1 (France), GUA1 (Guatemala), MIN11 (Minnesota, USA), NEB1, NEB6, NEB8 (Nebraska, USA), NZE1 (New Zealand), ORE12 (Oregon, USA), SLV1 (Slovakia) as detailed in Bradshaw et al. (2000). DNA was extracted in the UK using a Nucleon PhytoPure Plant DNA extraction kit. Purified DNA was imported into New Zealand
Microsatellites for Dothistroma pini
SLV1 L
KKYNSSHAAGAAGAAGAAGAAG KKVRVRVCTCTCTCTCTCT KKVRVRVTGTGTGTGTGTG GGCACGTTGTACTGTAGCTCCA GCATCGGCTCTACACGCTCAC GCGGAGTGTGAAATCAGCA CGAGAGGCTCAGTCCCGAAGG CTCTCGGCGCCATTGCTAGCTAC GTCGCAGTAATGTCTGAAGAC GCTGGCTTGCCATCCAGCGCTCC
NZE1 ORE12
anchored AAG : anchored CT : anchored TG : bec 01 : bec 05 : bec 08 : TUB10bec : TUB11bec : MF4151p2 : MF4152p8 :
L C
Table 1. Primer sequences (5h to 3h).
ALP3 BRZ1 CAN3 FRA1 GUA1 MIN11 NEB1 NEB6 NEB8
1076
2072 bp 1500 bp
600 bp
100 bp
under Forestry Commission Permit PH 5\4 and PCR-amplified using anchored primers containing either AAG, CT or TG repeat sequences (see anchored primers in Table 1). The 3h end of each primer was complementary to a common fungal repetitive sequence (Groppe et al. 1995) whilst the 5h end provided a degenerate anchor sequence to avoid slippage. The rationale behind this design was that if the primer annealed to two close and inverted simple sequence repeats, then the region between them, which may also contain repetitive sequences, would be amplified. Amplification reactions (25 µl) contained 1iPCR buffer (Gibco BRL), 1n5 m MgCl , 0n2 m # dNTPs, 50 pmol primer, 3 U Taq DNA polymerase (Gibco BRL) and 30 ng genomic DNA. Cycling conditions (in a Corbett FTS-960 Thermal Cycler) were : 3 min at 94 mC ; 5 cycles of 93 m for 30 s, 59 m for 30 s and 72 m for 30 s ; 35 cycles of 93 m for 30 s, 57 m for 30 sec and 72 m for 30 s ; 72 m for 2 min. Products were visualized on a 1n5 % TBE buffer agarose gel. Selected PCR products were purified using a Qiagen gel extraction and purification kit, ligated into a pGEM2-T vector and transformed into E. coli XL-1 (Bullock, Fernandez & Short 1987). Plasmids were purified (Qiagen plasmid purification system) and sequenced using an ABI Prism Dye Terminator cycle sequencing ready reaction kit (Perkin–Elmer) and an ABI 377 automated sequencer. PCR products containing repeated sequences were selected ; specific primers were designed to these products, flanking the repeated sequence(s) (Tables 1 and 2) and those primers were then tested with the twelve D. pini isolates. Amplification reactions contained the same concentrations of reagents used previously except with 10 pmol specific primer added to the 50 pmol 5h anchored primer and 0n75 U Taq DNA polymerase (Gibco BRL). Cycling parameters were as before except for annealing temperatures of 60 m for the first 5 cycles and 58 m for the subsequent 35 cycles. PCR products were separated on a 6 % denaturing polyacrylamide gel (LongRangerTM, FMC) and visualized by silver staining (Love et al. 1990). RESULTS AND DISCUSSION Amplification of the twelve Dothistroma pini isolates using anchored primers gave distinct ‘ RAPD-type ’ DNA profiles ; an example with the anchored TG primer is shown (Fig. 1). Reproducible profiles were seen in replicate tests, although variation in the intensity of some products was observed. With all three anchored primers (–TG, –CT and –AAG), most of the USA strains (MIN11, NEB1, NEB6 and NEB8) could be
Fig. 1. PCR amplification products from Dothistroma pini isolates obtained using the anchored TG primer. Lanes are marked with the D. pini isolate name, L (Gibco BRL 100 bp ladder) or C (control with no DNA template). Bands A and B are examples of PCR products selected for cloning and sequence analysis.
distinguished from other isolates by the unique banding patterns obtained. However, variations in product intensity mean that these ‘ RAPD-type ’ profiles are not suitable for a robust DNA typing system. Faint banding or smearing in the negative control was observed for all three 5h anchored primers. In all cases this was not reproducible and did not correlate with fragments observed in the amplification of the isolates. Amplification of products in the negative control (no DNA template) reaction is very common in RAPD–PCR (Pan et al. 1997). PCR products unique to an isolate or group of isolates were identified. For example, amplification of isolate BRZ1 with the anchored-TG primer produced a distinctive product of approximately 1n0 kb (band A) ; likewise FRA1 produced a 0n9 kb product (band B) that was not present in all isolates (Fig. 1). Potentially informative microsatellite loci were identified by selecting anchored-PCR products from gels on the basis of their consistent amplification from several isolates or their apparent uniqueness to an individual isolate. Fourteen such PCR products were purified, cloned and sequenced. Nine of the cloned microsatellite loci were chosen for further assessment on the basis of the size of the microsatellite repeat or the number of repetitive sequences present. For each of these a locus-specific primer was designed to one part of the sequence so that a PCR product of approximately 100–300 bp in length would be obtained when used in conjunction with the anchored primer. Annealing temperatures were optimised to generate single PCR products. Negative controls (no DNA template) were free from bands or smearing in each case. Two of the loci were discarded as they consistently presented multiple bands or gave non-reproducible products. However, since repeated sequences are often found in the middle of the PCR products as well as at the original priming sites, it should be possible to ‘ rescue ’ loci such as these by replacing the anchored primer with another locus-specific primer. The remaining loci were screened in all twelve fungal isolates. Four loci were non-polymorphic in this test, suggesting that the appearance of polymorphisms in the initial anchored-primer PCR can be misleading. The three remaining
R. J. Ganley and R. E. Bradshaw
1077
Table 2. Polymorphic microsatellite loci for Dothistroma pini. Allelesb Repeated sequencea
3h primer
1
2
3
MB1
Anchored TG
bec01
164
142
138
MB5
Anchored TG
bec05
293
285
N
MB8 DBC2 TUB1
Anchored CT MF4152p8 TUB10bec
(TG) , CTTGGGT ' (GGA) TGGGTTC # (GTACG) , (GA) % % (G) (TG) , (GAT) ( ) (GTT) (GAT)(GTT) # # (CT) ,(CT) ' $ (CTC) (ACT) % & (G) (ATC)(T)
bec08 MF4151p2 TUB11bec
212 169 135
N 164 133
158
'
*
4
N
200 bp 164 bp
Isolate locus MB1 MB5 MB8 DBC2 TUB1
N ZE BR Z G UA A LP CA N FR A O RE SL V M IN N EB 1 N EB 6 N EB 8
SLV1
ORE12
NZE1
NEB1 NEB6 NEB8
MIN11
CAN3 FRA1 GUA1
A comma (,) between sequences indicates a gap containing non-repetitive sequence. Alleles in sample of 12 isolates tested, given as size of PCR product (base pairs) or no amplification product (N). Only DBC2 had four alleles.
L C
b
5h primer
ALP3 BRZ1
a
Locus
138 bp
Alleles 1 2 3 4
Fig. 3. Distinguishing between Dothistroma pini isolates using five microsatellite loci. See Table 2 for details of alleles. Fig. 2. Microsatellite length variation between Dothistroma pini isolates at locus MB1 shown on a silver-stained polyacrylamide gel. Lanes marked as in Fig. 1.
loci (MB1, MB5 and MB8) were informative, each having at least two alleles in the group of isolates tested. Microsatellite locus MB1 was successfully amplified in all twelve isolates and showed three detectable polymorphisms (Fig. 2). Loci MB5 and MB8 were only amplified in six or seven of the 12 isolates, respectively. However, the reproducible absence of products provided an additional allele (Table 2). Two further microsatellite loci were obtained serendipitously from non-coding regions adjacent to regions of the D. pini genome that have been sequenced in our laboratory for another project currently in progress. A computer search was made through our in-house sequence database for repeated sequences and two locus-specific primers designed to flank each repeated site. When these were tested with the twelve isolates, loci TUB1 and DBC2 were both polymorphic. TUB1 is adjacent to the beta-tubulin gene whilst DBC2 is in a region thought to contain genes for dothistromin biosynthesis. These are listed in Table 2 along with the loci derived from anchored primer PCR. Fig. 3 illustrates how the five microsatellite loci can be used to distinguish between all isolates with the exception of those from Nebraska (NEB1, 6, 8). The number of microsatellite loci tested is too small to support any speculations about the relatedness or otherwise of this small collection of isolates. PCR products from microsatellite loci can be visualised in several ways. Because of the additional effort and expense of polyacrylamide gels, a 4 % NuSieve2GTG2agarose gel was tried but found to have insufficient resolution to distinguish between all alleles (results not shown). For polyacrylamide
gels the use of silver staining, rather than radioactive labelling, provided relatively safe and simple visualisation of PCR products. However, as can be seen in Figure 2, simplicity is gained at the cost of clarity due to a background haze in the silver-stained gels. The collection of microsatellite data can be automated using a standard ABI Prism automated sequencer (Moon et al. 1999) and this would be a good option for routine DNA profiling. The anchored primer technique was recently used to identify microsatellite repeats in the common ash Fraxinus excelsior (Brachet et al. 1999) but to our knowledge this is the first description of its use with fungi. This technique offers a relatively simple and rapid way to identify polymorphic loci for detecting genetic differences between fungi. A C K N O W L E D G E M E N TS This work was supported by the Massey University Agricultural Research Fund and the British Council. Paul Dyer (Nottingham University) is thanked for his assistance with housing and maintaining the Dothistroma pini strain collection, as is Paula Jones for critical reading of the manuscript.
REFERENCES Brachet, S., Jubier, M. F., Richard, M., Jung-Muller, B. & Frascaria-Lacoste, N. (1999) Rapid identification of microsatellite loci using 5h anchored PCR in the common ash Fraxinus excelsior. Molecular Ecology 8 : 160–163. Bradshaw, R. E., Ganley, R. J., Jones, W. T. & Dyer, P. (2000) High levels of dothistromin toxin produced by the forest pathogen Dothistroma pini. Mycological Research 104 : 325–332. Bullock, W. O., Fernandez, J. M. & Short, J. M. (1987) XL-1 Blue : a high efficiency plasmid transforming recA Escherichia coli strain with ßgalactosidase selection. Biotechniques 5 : 376–378. Chou, C. K. S. (1991) Perspectives of disease threat in large-scale Pinus radiata monoculture : the New Zealand experience. European Journal of Forest Pathology 21 : 71–81.
Microsatellites for Dothistroma pini Fisher, P. J., Gardner, R. C. & Richardson, T. E. (1996) Single locus microsatellites isolated using 5h anchored PCR. Nucleic Acids Research 24 : 4369–4371. Gibson, I. A. S. (1972) Dothistroma blight of Pinus radiata. Annual Review of Phytopathology 10 : 51–72. Groppe, K., Sanders, I., Wiemken, A. & Boller, T. (1995) A microsatellite marker for studying the ecology and diversity of fungal endophytes (EpichloeW spp.) in grasses. Applied and Environmental Microbiology 61 : 3943–3949. Hirst, P., Richardson, T. E., Carson, S. D. & Bradshaw, R. E. (1999) Dothistroma pini genetic diversity is low in New Zealand. New Zealand Journal of Forestry Science 29 : 459–472. Love, J. M., Knight, A. M., McAleer, M. A. & Todd, J. A. (1990) Towards construction of a high resolution map of the mouse genome using PCR analysed microsatellites. Nucleic Acids Research 18 : 4123–4130.
1078 Moon, C. D., Tapper, B. A. & Scott, D. B. (1999) Identification of EpichloeW endophytes In Planta using a microsatellite based PCR fingerprinting assay with automated analysis. Applied and Environmental Microbiology 65 : 1268–1279. Pan, Y. -B., Burner, D. M., Ehrlich, K. C., Grisham, M. P. & Wei, Q. (1997) Analysis of primer-derived, nonspecific amplification products in RAPDPCR. Biotechniques 22 : 1071–1077. Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeau, M. (1995) AFLP : a new technique for DNA fingerprinting. Nucleic Acids Research 23 : 4407–4414. Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A. & Tingey, S. V. (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18 : 6531–6535. Corresponding Editor : S. J. Assinder
1075
Rapid identification of polymorphic microsatellite loci in a forest pathogen, Dothistroma pini, using anchored PCR
Rebecca J. GANLEY1 and Rosie E. BRADSHAW2* " Department of Forest Resources, University of Idaho, Moscow, ID 83844-1133, USA. # Institute of Molecular BioSciences, Massey University, Private Bag 11222, Palmerston North, New Zealand. E-mail : R.E.Bradshaw!massey.ac.nz Received 14 November 2000 ; accepted 16 May 2001.
A microsatellite-based DNA profiling system was developed that can be used to distinguish genetically diverse isolates of a forest pathogen, Dothistroma pini. All isolates of this pathogen identified in New Zealand so far appear to be isogenic and the disease is kept under control by aerial applications of copper fungicide. Although New Zealand has strict importation controls in place, the possibility of genetically diverse isolates of D. pini being introduced from other countries poses a severe biosecurity threat to forest health. Therefore a DNA-based monitoring system was developed. Two informative microsatellite loci were found serendipitously in D. pini sequence data available in our laboratory. Further microsatellite loci were obtained using a rapid 5h-anchored PCR amplification technique. For each informative locus identified, specific primers were designed to flank the repeated sequence and subsequently used to generate DNA profiles for the D. pini strains. The profiles obtained from five microsatellite loci were sufficient to distinguish most isolates tested. The anchored primer technique provides an efficient tool for the identification of polymorphic loci that can be used to screen for genetic differences between fungi.
INTRODUCTION Dothistroma pini causes needle blight of pine trees and consequent loss of growth in commercial forests (Gibson 1972). The motivation for developing a DNA profiling test for this species was to provide a tool for screening and prognosis of infected pine forests in New Zealand. There appears to be only one isogenic strain of D. pini in New Zealand at present (Hirst et al. 1999) and the disease is kept in check by aerial applications of copper fungicide. However the introduction of diversity into the gene pool by introducing overseas strains into New Zealand could potentially have serious economic consequences for the forest industry (Chou 1991). Our observation that some D. pini isolates from other countries produce significantly more of the phytotoxin dothistromin in culture compared to New Zealand isolates (Bradshaw, Ganley & Jones 2000) prompted efforts to develop a screening system. Mycologists have an increasingly wide choice of tools with which to detect specific pathogens, diagnose disease and measure diversity within a species. DNA-based methods, particularly those involving PCR, provide some of the most powerful, sensitive and discriminatory tools currently available. Therefore a DNA-based monitoring system for D. pini was developed as a tool to help maintain New Zealand’s high standard of biosecurity. * Corresponding author.
There are disadvantages to many of the PCR-based methods currently used for fungal typing. For example, although RAPD–PCR (Williams et al. 1990) has high resolution and is simple to carry out it requires exquisite control to achieve robustness. AFLPs (Vos et al. 1995) are also very informative but require careful optimisation of conditions for restriction enzyme activity, ligation of adapters and PCR. Microsatellites (also known as short tandem repeats) are tandemly repeated copies of a short nucleotide sequence that have been used for PCR-based DNA typing of fungi (Groppe et al. 1995, Moon, Tapper & Scott 1999). The main disadvantage of this method is the time and effort required to identify informative microsatellite loci ; screening of a genomic library is often required. We describe here a rapid technique to identify microsatellite loci in fungi, based on a method described for pine trees (Fisher, Gardner & Richardson 1996) involving anchored PCR primers. MATERIALS AND METHODS A representative set of Dothistroma pini isolates from eight countries was used in this study : ALP3 (Germany), BRZ1 (Brazil), CAN3 (Canada), FRA1 (France), GUA1 (Guatemala), MIN11 (Minnesota, USA), NEB1, NEB6, NEB8 (Nebraska, USA), NZE1 (New Zealand), ORE12 (Oregon, USA), SLV1 (Slovakia) as detailed in Bradshaw et al. (2000). DNA was extracted in the UK using a Nucleon PhytoPure Plant DNA extraction kit. Purified DNA was imported into New Zealand
Microsatellites for Dothistroma pini
SLV1 L
KKYNSSHAAGAAGAAGAAGAAG KKVRVRVCTCTCTCTCTCT KKVRVRVTGTGTGTGTGTG GGCACGTTGTACTGTAGCTCCA GCATCGGCTCTACACGCTCAC GCGGAGTGTGAAATCAGCA CGAGAGGCTCAGTCCCGAAGG CTCTCGGCGCCATTGCTAGCTAC GTCGCAGTAATGTCTGAAGAC GCTGGCTTGCCATCCAGCGCTCC
NZE1 ORE12
anchored AAG : anchored CT : anchored TG : bec 01 : bec 05 : bec 08 : TUB10bec : TUB11bec : MF4151p2 : MF4152p8 :
L C
Table 1. Primer sequences (5h to 3h).
ALP3 BRZ1 CAN3 FRA1 GUA1 MIN11 NEB1 NEB6 NEB8
1076
2072 bp 1500 bp
600 bp
100 bp
under Forestry Commission Permit PH 5\4 and PCR-amplified using anchored primers containing either AAG, CT or TG repeat sequences (see anchored primers in Table 1). The 3h end of each primer was complementary to a common fungal repetitive sequence (Groppe et al. 1995) whilst the 5h end provided a degenerate anchor sequence to avoid slippage. The rationale behind this design was that if the primer annealed to two close and inverted simple sequence repeats, then the region between them, which may also contain repetitive sequences, would be amplified. Amplification reactions (25 µl) contained 1iPCR buffer (Gibco BRL), 1n5 m MgCl , 0n2 m # dNTPs, 50 pmol primer, 3 U Taq DNA polymerase (Gibco BRL) and 30 ng genomic DNA. Cycling conditions (in a Corbett FTS-960 Thermal Cycler) were : 3 min at 94 mC ; 5 cycles of 93 m for 30 s, 59 m for 30 s and 72 m for 30 s ; 35 cycles of 93 m for 30 s, 57 m for 30 sec and 72 m for 30 s ; 72 m for 2 min. Products were visualized on a 1n5 % TBE buffer agarose gel. Selected PCR products were purified using a Qiagen gel extraction and purification kit, ligated into a pGEM2-T vector and transformed into E. coli XL-1 (Bullock, Fernandez & Short 1987). Plasmids were purified (Qiagen plasmid purification system) and sequenced using an ABI Prism Dye Terminator cycle sequencing ready reaction kit (Perkin–Elmer) and an ABI 377 automated sequencer. PCR products containing repeated sequences were selected ; specific primers were designed to these products, flanking the repeated sequence(s) (Tables 1 and 2) and those primers were then tested with the twelve D. pini isolates. Amplification reactions contained the same concentrations of reagents used previously except with 10 pmol specific primer added to the 50 pmol 5h anchored primer and 0n75 U Taq DNA polymerase (Gibco BRL). Cycling parameters were as before except for annealing temperatures of 60 m for the first 5 cycles and 58 m for the subsequent 35 cycles. PCR products were separated on a 6 % denaturing polyacrylamide gel (LongRangerTM, FMC) and visualized by silver staining (Love et al. 1990). RESULTS AND DISCUSSION Amplification of the twelve Dothistroma pini isolates using anchored primers gave distinct ‘ RAPD-type ’ DNA profiles ; an example with the anchored TG primer is shown (Fig. 1). Reproducible profiles were seen in replicate tests, although variation in the intensity of some products was observed. With all three anchored primers (–TG, –CT and –AAG), most of the USA strains (MIN11, NEB1, NEB6 and NEB8) could be
Fig. 1. PCR amplification products from Dothistroma pini isolates obtained using the anchored TG primer. Lanes are marked with the D. pini isolate name, L (Gibco BRL 100 bp ladder) or C (control with no DNA template). Bands A and B are examples of PCR products selected for cloning and sequence analysis.
distinguished from other isolates by the unique banding patterns obtained. However, variations in product intensity mean that these ‘ RAPD-type ’ profiles are not suitable for a robust DNA typing system. Faint banding or smearing in the negative control was observed for all three 5h anchored primers. In all cases this was not reproducible and did not correlate with fragments observed in the amplification of the isolates. Amplification of products in the negative control (no DNA template) reaction is very common in RAPD–PCR (Pan et al. 1997). PCR products unique to an isolate or group of isolates were identified. For example, amplification of isolate BRZ1 with the anchored-TG primer produced a distinctive product of approximately 1n0 kb (band A) ; likewise FRA1 produced a 0n9 kb product (band B) that was not present in all isolates (Fig. 1). Potentially informative microsatellite loci were identified by selecting anchored-PCR products from gels on the basis of their consistent amplification from several isolates or their apparent uniqueness to an individual isolate. Fourteen such PCR products were purified, cloned and sequenced. Nine of the cloned microsatellite loci were chosen for further assessment on the basis of the size of the microsatellite repeat or the number of repetitive sequences present. For each of these a locus-specific primer was designed to one part of the sequence so that a PCR product of approximately 100–300 bp in length would be obtained when used in conjunction with the anchored primer. Annealing temperatures were optimised to generate single PCR products. Negative controls (no DNA template) were free from bands or smearing in each case. Two of the loci were discarded as they consistently presented multiple bands or gave non-reproducible products. However, since repeated sequences are often found in the middle of the PCR products as well as at the original priming sites, it should be possible to ‘ rescue ’ loci such as these by replacing the anchored primer with another locus-specific primer. The remaining loci were screened in all twelve fungal isolates. Four loci were non-polymorphic in this test, suggesting that the appearance of polymorphisms in the initial anchored-primer PCR can be misleading. The three remaining
R. J. Ganley and R. E. Bradshaw
1077
Table 2. Polymorphic microsatellite loci for Dothistroma pini. Allelesb Repeated sequencea
3h primer
1
2
3
MB1
Anchored TG
bec01
164
142
138
MB5
Anchored TG
bec05
293
285
N
MB8 DBC2 TUB1
Anchored CT MF4152p8 TUB10bec
(TG) , CTTGGGT ' (GGA) TGGGTTC # (GTACG) , (GA) % % (G) (TG) , (GAT) ( ) (GTT) (GAT)(GTT) # # (CT) ,(CT) ' $ (CTC) (ACT) % & (G) (ATC)(T)
bec08 MF4151p2 TUB11bec
212 169 135
N 164 133
158
'
*
4
N
200 bp 164 bp
Isolate locus MB1 MB5 MB8 DBC2 TUB1
N ZE BR Z G UA A LP CA N FR A O RE SL V M IN N EB 1 N EB 6 N EB 8
SLV1
ORE12
NZE1
NEB1 NEB6 NEB8
MIN11
CAN3 FRA1 GUA1
A comma (,) between sequences indicates a gap containing non-repetitive sequence. Alleles in sample of 12 isolates tested, given as size of PCR product (base pairs) or no amplification product (N). Only DBC2 had four alleles.
L C
b
5h primer
ALP3 BRZ1
a
Locus
138 bp
Alleles 1 2 3 4
Fig. 3. Distinguishing between Dothistroma pini isolates using five microsatellite loci. See Table 2 for details of alleles. Fig. 2. Microsatellite length variation between Dothistroma pini isolates at locus MB1 shown on a silver-stained polyacrylamide gel. Lanes marked as in Fig. 1.
loci (MB1, MB5 and MB8) were informative, each having at least two alleles in the group of isolates tested. Microsatellite locus MB1 was successfully amplified in all twelve isolates and showed three detectable polymorphisms (Fig. 2). Loci MB5 and MB8 were only amplified in six or seven of the 12 isolates, respectively. However, the reproducible absence of products provided an additional allele (Table 2). Two further microsatellite loci were obtained serendipitously from non-coding regions adjacent to regions of the D. pini genome that have been sequenced in our laboratory for another project currently in progress. A computer search was made through our in-house sequence database for repeated sequences and two locus-specific primers designed to flank each repeated site. When these were tested with the twelve isolates, loci TUB1 and DBC2 were both polymorphic. TUB1 is adjacent to the beta-tubulin gene whilst DBC2 is in a region thought to contain genes for dothistromin biosynthesis. These are listed in Table 2 along with the loci derived from anchored primer PCR. Fig. 3 illustrates how the five microsatellite loci can be used to distinguish between all isolates with the exception of those from Nebraska (NEB1, 6, 8). The number of microsatellite loci tested is too small to support any speculations about the relatedness or otherwise of this small collection of isolates. PCR products from microsatellite loci can be visualised in several ways. Because of the additional effort and expense of polyacrylamide gels, a 4 % NuSieve2GTG2agarose gel was tried but found to have insufficient resolution to distinguish between all alleles (results not shown). For polyacrylamide
gels the use of silver staining, rather than radioactive labelling, provided relatively safe and simple visualisation of PCR products. However, as can be seen in Figure 2, simplicity is gained at the cost of clarity due to a background haze in the silver-stained gels. The collection of microsatellite data can be automated using a standard ABI Prism automated sequencer (Moon et al. 1999) and this would be a good option for routine DNA profiling. The anchored primer technique was recently used to identify microsatellite repeats in the common ash Fraxinus excelsior (Brachet et al. 1999) but to our knowledge this is the first description of its use with fungi. This technique offers a relatively simple and rapid way to identify polymorphic loci for detecting genetic differences between fungi. A C K N O W L E D G E M E N TS This work was supported by the Massey University Agricultural Research Fund and the British Council. Paul Dyer (Nottingham University) is thanked for his assistance with housing and maintaining the Dothistroma pini strain collection, as is Paula Jones for critical reading of the manuscript.
REFERENCES Brachet, S., Jubier, M. F., Richard, M., Jung-Muller, B. & Frascaria-Lacoste, N. (1999) Rapid identification of microsatellite loci using 5h anchored PCR in the common ash Fraxinus excelsior. Molecular Ecology 8 : 160–163. Bradshaw, R. E., Ganley, R. J., Jones, W. T. & Dyer, P. (2000) High levels of dothistromin toxin produced by the forest pathogen Dothistroma pini. Mycological Research 104 : 325–332. Bullock, W. O., Fernandez, J. M. & Short, J. M. (1987) XL-1 Blue : a high efficiency plasmid transforming recA Escherichia coli strain with ßgalactosidase selection. Biotechniques 5 : 376–378. Chou, C. K. S. (1991) Perspectives of disease threat in large-scale Pinus radiata monoculture : the New Zealand experience. European Journal of Forest Pathology 21 : 71–81.
Microsatellites for Dothistroma pini Fisher, P. J., Gardner, R. C. & Richardson, T. E. (1996) Single locus microsatellites isolated using 5h anchored PCR. Nucleic Acids Research 24 : 4369–4371. Gibson, I. A. S. (1972) Dothistroma blight of Pinus radiata. Annual Review of Phytopathology 10 : 51–72. Groppe, K., Sanders, I., Wiemken, A. & Boller, T. (1995) A microsatellite marker for studying the ecology and diversity of fungal endophytes (EpichloeW spp.) in grasses. Applied and Environmental Microbiology 61 : 3943–3949. Hirst, P., Richardson, T. E., Carson, S. D. & Bradshaw, R. E. (1999) Dothistroma pini genetic diversity is low in New Zealand. New Zealand Journal of Forestry Science 29 : 459–472. Love, J. M., Knight, A. M., McAleer, M. A. & Todd, J. A. (1990) Towards construction of a high resolution map of the mouse genome using PCR analysed microsatellites. Nucleic Acids Research 18 : 4123–4130.
1078 Moon, C. D., Tapper, B. A. & Scott, D. B. (1999) Identification of EpichloeW endophytes In Planta using a microsatellite based PCR fingerprinting assay with automated analysis. Applied and Environmental Microbiology 65 : 1268–1279. Pan, Y. -B., Burner, D. M., Ehrlich, K. C., Grisham, M. P. & Wei, Q. (1997) Analysis of primer-derived, nonspecific amplification products in RAPDPCR. Biotechniques 22 : 1071–1077. Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeau, M. (1995) AFLP : a new technique for DNA fingerprinting. Nucleic Acids Research 23 : 4407–4414. Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A. & Tingey, S. V. (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18 : 6531–6535. Corresponding Editor : S. J. Assinder