- Email: [email protected]
Rapid identification of Prototheca zopfii by nested polymerase chain reaction based on the nuclear small subunit ribosomal DNA
56
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
that the Tunisian families are likely linked to the previously identified critical 15q22–15q24 interval. For families PPK3 and PPK4, no other cases could be investigated. Nevertheless, it is noteworthy that the two patients belonging to these families shared a common haplotype between markers D15S534 and D15S650. Parametric multipoint linkage analysis gave the maximum cumulative lod score value of 5.33 for marker D15S650. These results support genetic linkage of the PPK-families to the tested critical interval on 15q22–15q24. It is noteworthy that in family PPK2, individuals IV-1 and IV-2 born to a consanguineous marriage were homozygous for the interval between microsatellite markers D15S213 and D15S988; this segment is likely inherited from a common ancestor. As their mother III-2 was healthy, this suggests that the disease locus should be distal to marker D15S988. In the present study, we provide confirmatory evidence for the location of the punctate PPK in 15q22–15q24 although the precise gene interval should be reconsidered when compared to the study of Gao et al. that suggested that the disease is proximal to D15S988, based on recombinant healthy individuals [5]. To our knowledge, this is the first report of Buschke–Fischer– Brauer’s disease in North African families.
[5] Gao M, Yang S, Li M, Yan KL, Jiang YX, Cui Y, et al. Refined localization of a punctate palmoplantar keratoderma gene to a 5.06-cM region at 15q22.2– 15q22.31. Br J Dermatol 2005;152:874–8. [6] Emmert S, Ku¨ster W, Hennies HC, Zutt M, Haenssle H, Kretschmer L, et al. 47 patients in 14 families with the rare genodermatosis keratosis punctata palmoplantaris Buschke–Fischer–Brauer. Eur J Dermatol 2003;13: 16–20. [7] Al-Mutairi N, Joshi A, Nour-Eldin O. Punctate palmoplantar keratoderma (Buschke–Fischer–Brauer disease) with psoriasis: a rare association showing excellent response to acitretin. J Drugs Dermatol 2005;4: 627–34. [8] Erkek E, Erdogan S, Tuncez F, Kurtipek GS, Bagci Y, Ozoguz P, et al. Type I hereditary punctate keratoderma associated with widespread lentigo simplex and successfully treated with low-dose oral acitretin. Arch Dermatol 2006;142:1076–7. [9] Charfeddine C, Mokni M, Ben Mousli R, Elkares R, Bouchlaka C, Boubaker S, et al. A novel missense mutation in the gene encoding SLURP-1 in patients with Mal de Meleda from northern Tunisia. Br J Dermatol 2003;149:1108–15.
Mbarka Bchetniaa,b Cherine Charfeddinea Selma Kassarb,c Imen Hanchid Haifa Tounsi-Guettitic Ahmed Rebaie Amel Dhahri-Ben Osmand Christian Kubischf Sonia Abdelhaka,* Samir Boubakerc Mourad Moknib,d
Acknowledgements We are especially grateful to the patients and their family members for their interest and cooperation in this study. This work was supported by the Tunisian Ministry of Higher Education and Scientific Research (Research Unit on ‘‘Molecular Investigation of Genetic Orphan Disorders’’ UR 26/04 and Research Unit on ‘‘Hereditary Keratinisation Disorders’’ UR 24/04) and the Ministry of Health. References [1] Stanimirovic A, Kansky A, Basta-Juzbasic A, Skerlev M, Beck T. Hereditary palmoplantar keratoderma, type papulosa, in Croatia. J Am Acad Dermatol 1993;29:435–7. [2] Stevens HP, Kelsell DP, Leigh IM, Ostlere LS, MacDermot KD, Rustin MH. Punctate palmoplantar keratoderma and malignancy in a four-generation family. Br J Dermatol 1996;134:720–6. [3] Martinez-Mir A, Zlotogorski A, Londono D, Gordon D, Grunn A, Uribe E, et al. Identification of a locus for type I punctate palmoplantar keratoderma on chromosome 15q22–q24. J Med Genet 2003;40:872–8. [4] Zhang XJ, Li M, Gao TW, He PP, Wei SC, Liu JB, et al. Identification of a locus for punctate palmoplantar keratodermas at chromosome 8q24.13–8q24.21. J Invest Dermatol 2004;122:1121–5.
a
‘‘Molecular Investigation of Genetic Orphan Diseases’’ Research Unit, Institut Pasteur de Tunis, Tunis, Tunisia b ‘‘Hereditary Keratinization Disorders’’ Research Unit, Hoˆpital La Rabta de Tunis, Tunis, Tunisia c Pathology Department, Institut Pasteur de Tunis, Tunis, Tunisia d Dermatology Department, Hoˆpital La Rabta, Tunis, Tunisia e Bioinformatic department, Centre de Biotechnologie de Sfax, Sfax, Tunisia f Institute of Human Genetics, University Hospital Cologne, Germany
*Corresponding author at: Institut Pasteur de
Tunis, BP 74, 13 Place, Pasteur, 1002 Tunis, Belve´de`re, Tunisia. Tel.: +216 71 849110; fax: +216 71 791833 E-mail addresses: [email protected]; [email protected] (S. Abdelhak)
doi:10.1016/j.jdermsci.2008.11.008
Letter to the editor Rapid identification of Prototheca zopfii by nested polymerase chain reaction based on the nuclear small subunit ribosomal DNA
A R T I C L E I N F O
Keywords: Prototheca zopfii; Protothecosis; Nested PCR; Nuclear small subunit ribosomal DNA
The genus of achlorophyllous unicellular algae, Prototheca was first described in 1894 by Kru¨ger [1,2], and shown to have a similar life cycle to algae from the genus Chlorella. P. zopfii and P. wickerhamii has been reported as a pathogen involved in refractory subcutaneous disease and systemic infection in humans
and in animals [2–4]. Especially, P. zopfii causes bovine mastitis and canine fatal systemic infection, which have recently become major worldwide problems [4,5]. Recently, the incidences of P. zopfii infection have been increasing rapidly in both cattle and humans [2–5]. Therefore, a system to effectively and rapidly identify the pathogen in infected cattle or humans is necessary. P. wickerhamii is another pathogen belonging to this genus, and P. wickerhamii infections are relatively easily treated with antifungal agents, especially amphotericin B. However, the prognosis of subcutaneous infection with P. zopfii is poor, even though this alga is sensitive to azoles in vitro [2]. One reason for this is the difficulty in identifying the alga and thus in selection of effective antifungal agents. Here, the specific nested PCR system was evaluated with reference strains from Japanese culture collections and isolates from bovine mastitis. To our knowledge, this is the first report of a molecular identification system for this pathogenic alga.
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
57
Table 1 Origin and distribution of Prototheca and yeast-like organism strains. Species
No. of isolates
Origin
Total strains
Reference strains
10
10a
Prototheca wickerhamii Prototheca stagnora Candida albicans Candida tropicalis Candida glabrata Candida krusei Chlorella vulgaris Yeast-like organism
4 1 1 1 1 1 1 50
a
4 1a 1b 1b 1b 1b 1c
Total
70
20
Prototheca zopfii
a b c d
Clinical isolates JCM8556, JCM8557, JCM9346, JCM9349, JCM9350, JCM9351, JCM9353, JCM9354, JCM9400, JCM9646 JCM9348, JCM9643, JCM9644, JCM9645 JCM9641 TIMM10234 TIMM750 TIMM90030 TIMM6258 CK-22 NA1, NA3, NA4, NA5, NA6, NA7, NA8, NA9, NA10, NA11, NA12, NA13, NA14, NA15, NA16, NA17, NA18, NA19, NA20, NA21, NA22, NA23, NA24, NA25, NA26, NA27, NA28, NA29, NA30, NA31, NA32, NA33, NA34, NA35, NA51, NA52, NA53, NA55, NA56, NA61, NA62, NA63, NA64, NA65, NA66, NA67, NA68, NA69, NA70, NA71, NA72
50d
50
Japan Collection of Microorganisms (JCM; RIKEN BioResource Center, Wako, Saitama, Japan). Teikyo University Institute of Medical Mycology (TIMM; Tokyo, Japan). Raw Chlorella. V12TM (Chlorella Industry Co., Ltd, Tokyo, Japan). Livestock Medical Center, Aichi Prefectural Federation of Agricultural Mutual Aid Association (NA; Aichi, Japan).
Table 2 Assimilation patterns of reference strains of Prototheca and 50 clinical isolates. Species
Prototheca zopfii Prototheca wickerhamii Prototheca stagnora Yeast-like organism
No. of isolates
Carbohydrates
Reference strains
Clinical isolates
Glucose
Galactose
D(-)Fructose
1-Propanol
Trehalose
Sucrose
Ethanol
Glycerol
10 4 1 0
0 0 0 50
+ + + +
+ +
+ + + +
+ +
+
+ +
+ + + +
+, positive assimilation; , negative assimilation; ; weakly positive assimilation.
The 20 reference strains used in this study consisted of 8 species from 3 genera, and fifty clinical yeast-like isolates from bovine mastitis were used as clinical isolates (Table 1). All clinical strains of yeast-like organisms were isolated from milk samples from cows with mastitis in Aichi, Japan. CHROMagar Candida medium (CaC; CHROMagar, Paris, France) which is commonly used as culture medium for pathogenic yeasts was used for initial isolation from milk samples and incubated at 37 8C for 2 days [6]. Colony features of all Prototheca strains on CaC, were not compatible with any pathogenic yeast. However, it was difficult to distinguish P. zopfii from other Prototheca spp. based on their colony morphology [6]. All reference strains and clinical isolates except Chlorella were subcultured on Yeast and Mould agar (Oxoid, Basingstoke, UK) at 25 8C for 5 days. Moreover, the assimilation tests of all standard strains of Prototheca and clinical isolates were carried out with reference to the method of Pore [1], and 8 carbohydrates were tested. All of the reference strains of P. zopfii and fifty clinical isolates (100%; 60/60) were identified as P. zopfii by the assimilation test Table 2. Chlorella vulgaris was directly processed for DNA extraction. DNAs were extracted from the 20 reference strains with a Gen Toru Kun for yeast kit (Takara Bio Co., Otsu, Shiga, Japan). The DNA samples were stored at–20 8C until use. DNA templates from fifty clinical isolates were extracted rapidly as follows: A small amount of a colony was picked up with a toothpick and put into 1 ml of saline (0.9% Nacl). The colony was suspended, boiled for 10 min and then centrifuged at 10,000 g for 2 min, and the supernatant was then used as the template for PCR. The oligonucleotides used in the present study were designed based on comparisons with the sequences of small subunit ribosomal DNAs (SSU rDNA) in the DDBJ/EMBL/GenBank data bases [7,8]. The designed primers were shown in Table 3. This
nested PCR assay method was previously reported by Yoshida et al. [9]. Amplified PCR product from P. zopfii JCM9646 with O18SF1 and O18SR1 primers was ligated into the TA cloning plasmid vector pCR 2.1 (Invitrogen., Tokyo, Japan). The product was introduced into Escherichia coli DH5a (Nippon Gene, Tokyo, Japan). After propagation and purification of the plasmid, the concentration (copies ml1) was calculated from the A260 and the molecular mass of the plasmid. In addition, the sensitivity of the nested PCR assay was examined using serial dilutions of this plasmid solution (5– 5 106 copies per tube) with duplicate samples. The specificity of the P. zopfii-specific nested PCR system for reference strains were examined. Fig. 1 (a) shows first and nested PCR products amplified with universal primers, O18SF1/O18SR1 and P. zopfii-specific primers, 18PZF1/18PZR1, respectively. DNA was successfully amplified from all reference strains using the universal primers. However, only P. zopfii DNA was detected with the nested P. zopfii-specific primers. In addition, no amplicons were produced from DNAs of either species by nested PCR. Common PCR with P. zopfii-specific primers also successfully identified P. zopfii strains (data not shown). The results of nested PCR analysis obtained from Table 3 Primers and their nucleotide sequences used in this study. Primer
Nucleotide sequence (50 -30 )
Universal primer O18SF1 TACCACATCCAAGAAAGGCA O18SR1 CCTTGGCAAATGCTTTCGCA
Primer pair (F/R) Expected size (bp)
O18SF1/O18SR1
551
P. zopfii-specific primer 18PZF1 ACAATACGTAGCGATGCCGAACT 18PZF1/18PZR1 18PZR1 GCCAGCCAGAGGACGCCGAA
233
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
58
Fig. 1. 1.0% Agarose gel electrophoresis showing photographic image. (a) Specificity of the nested PCR system. Gel electrophoresis images of PCR using universal primers (A) and P. zopfii-specific primers (B). M, DNA molecular weight marker; (1) C. vulgaris; (2)–(11) P. zopfii; (12)–(15) P. wickerhamii; (16) P. stagnora; (17) C. albicans; (18) C. tropicalis; (19) C. glabrata; (20) C. krusei. (b) Sensitivity of the nested PCR system. Gel electrophoresis images of PCR using universal primers (A) and P. zopfii-specific primers (B). M, DNA molecular weight marker; (1,2) 5 106; (3,4) 5 105; (5,6) 5 104; (7,8) 5 103; (9,10) 5 102; (11,12) 5 10; (13,14) 5; and (15,16) 0 copies of plasmid template.
reference strains and clinical isolates were identical, as summarized in Table 4. All yeast-like organisms isolated from milk were consistent with those of the assimilation tests, identifying as P. zopfii. As sensitivity, 5 102 copies (plasmid/tube) of template were detected by first PCR and 5 10 copies (plasmid/tube) were detected by nested PCR (Fig. 1 (b)). No whole genome sequence has yet been reported in Prototheca species. However, Hordeum vulgare (barley) is a representative green plant and its ribosomal DNA complex copy number is known to be approximately 1000 and the Trebouxiophyceae [10], the class to which Prototheca belongs, is closely related to green plants [2]. Calculation from the copy number, lower detection limit of the nested PCR may be equivalent to less than one cell of P. zopfii.
This system enabled us to identify the species accurately and directly from cultured colonies with high sensitivity in 3.5 h, even in the case of isolates with atypical phenotypic features that precluded identification based on morphology. The nested PCR system reported here requires less than 1 day to identify the algae, as reported previously [9]. On the other hand, conventional identification requires 3–7 days for the initial culture and a further 1 week for the assimilation pattern test. Based on the high specificity and sensitivity, the system reported here may be able to directly detect P. zopfii in milk or clinical specimens. Further experiments regarding molecular diagnosis of protothecosis are currently underway in our laboratory.
Table 4 Results of PCR analysis with O18SF1/SR1 and 18PZF1/R1 primers for reference strains and 50 clinical isolates. Species
Origin
PCR with primer pair O18SF1/O18SR1 (First, PCR)
Prototheca zopfii Prototheca wickerhamii Prototheca stagnora Candida albicans Candida tropicalis Candida glabrata Candida krusei Chlorella vulgaris Yeast-like organism Total
Reference strains
Clinical isolates
18PZF1/18PZR1 (nested PCR)
Positive
Negative
Positive
Negative
10 1 1 1 1 1 1 1 50
0 0 0 0 0 0 0 0 0
10 0 0 0 0 0 0 0 50
0 1 1 1 1 1 1 1 0
67
0
60
7
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
Acknowledgments We are grateful to Dr. Takaaki Itou, Livestock Medical Center, Aichi Prefectural Federation of Agricultural Mutual Aid Association, for the kind gift of clinical isolates, and to Dr. Motofumi Suzuki, RIKEN BioResource Center, Wako, Saitama, Japan, for kindly providing the Prototheca reference strains. We thank Dr. Rui Kano for critical discussion, Dr. Takafumi Osumi for technical assistance with assimilation pattern testing, Department of Pathobiology, School of Veterinary Medicine, Nihon University, Fujisawa Kanagawa, Japan.
59
[8] Ueno R, Urano N, Suzuki M. Phylogeny of the non-photosynthetic green microalgal genus Prototheca (Trebouxiophyceae, Chlorophyta) and related taxa inferred from SSU and LSU ribosomal DNA partial sequence data. FEMS Microbiol Lett 2003;223:275–80. [9] Yoshida E, Makimura K, Mirhendi H, Kaneko T, Hiruma M, Kasai T, et al. Rapid identification of Trichophyton tonsurans by specific PCR based on DNA sequences of nuclear ribosomal internal spacer (ITS) 1 region. J Dermatol Sci 2006;42:225–30. [10] Zhang QF, Saqhai Maroof MA, Allard RW. Effects on adaptedness of variations in ribosomal DNA copy number in populations of wild barley (Hordeum vulgare spp. spontaneum). Proc Natl Acad Sci USA 1990;87:8741–5.
Masanobu Onozakia,b Koichi Makimurab,* Atsuhiko Hasegawab
References a
[1] Pore RS. Prototheca, a yeast-like alga. In: Kurtzman CP, Fell JW, editors. The Yeast, A Taxonomic Study. 4th edn, Amsterdam: Elsevier Science; 1998. p. 881–7. [2] Cornelia Lass-Flo¨rl. Astrid mayr: human protothecosis. Cin Mycrobiol Rev 2007;20:230–42. [3] Leimann BC, Monteiro PC, Laze´ra, Lazera M, Candanoza ER. Wanke B Protothecosis Med Mycol 2004;42:95–106. [4] Ikeda T. Ghoma M: protothecosis in animals. Vet Darmatol Japan 2002;8:23–32. [5] Bueno VF, de Mesquita AJ, Neves RB, de Souza MA, Ribero AR, Nicolau ES, et al. Epidemiological and clinical aspects of the first outbreak of bovine mastitis caused by Prototheca zopfii in Goia´s State, Brazil. Mycopathologia 2006;161: 141–5. [6] Casal M, Linares MJ, Solı´s F, Rodrı´guez FC. Appearance of colonies of Prototheca on CHROMagar Candida medium. Mycopathologia 1997;137:79–82. [7] Mo¨ller A, Truyen U. Roesler U: Prototheca zopfii genotype 2—The causative agent of bovine protothecal mastitis? Vet Microbiol 2007;120:370–4. Short communication.
Kanto Chemical Co., Inc., Marusan Bldg. 11-5, Nihonbashi Honcho, 3-Chome, Chuo-ku, Tokyo 103-0023, Japan b Teikyo University Institute of Medical Mycology, 359 Otsuka, Hachioji, Tokyo 192-0395, Japan *Corresponding author. Tel.: +81 426 78 3256; fax: +81 426 78 256 E-mail address: [email protected] (K. Makimura) 28 April 2008 doi:10.1016/j.jdermsci.2008.10.009
Letter to the Editor Desmosome splitting is a primary ultrastructural change in the acantholysis of pemphigus To the Editor, Pemphigus comprises a group of autoimmune blistering diseases affecting the skin and/or mucous membranes [1]. The blister formation in pemphigus has been elucidated markedly and shown to be caused by autoantibodies against desmoglein 1 (Dsg 1) and desmoglein 3 (Dsg 3) [2]. On the other hand, morphological studies using electron microscope on pemphigus were performed in 1960s [3–5], when little was known about their underlying molecular pathophysiology. Now the changes of desmosomekeratin cytoskeleton have come to the central point of discussion as the cause of acantholysis, it is necessary and timely to reevaluate the ultrastructural changes in pemphigus, particularly focusing to the changes of desmosomes and cytoskeletal structures. Two mucocutaneous type pemphigus vulgaris (PV) cases, one mucosal-dominant PV case, and two pemphigus foliaceus (PF) cases (Table 1) were analyzed in this study. Skin biopsies were taken from the new blister on the skin or buccal mucous membrane. By light microscopy, acantholysis was clearly observed in all five cases and, in addition, spongiosis with lymphocytic infiltration was seen near the blister in two PV cases. By observing the acantholytic area by electron microscopy, half-split desmosomes were seen on the cell surface in all cases (Fig. 1A). In the acantholytic keratinocytes with fully developed blisters, keratin condensation around the cell nucleus resulted in the total disappearance of tonofilaments at cell periphery (Fig. 1B). We could not find any difference in the ultrastructural features between mucocutaneous type PV and mucosal-dominant type PV. In addition, we observed no differences in desmosomal change between PV and PF at high magnification.
The close chronological relationship between keratin retraction and half-split desmosome formation required further clarification. When focusing on apical cell surface of a basal cell in the very edge of a blister in PV, several stages of the half-split desmosomes were recognized (Fig. 1C–G). Where plasma membranes of basal and suprabasal cells were observed nearby, an initial stage of half-split desmosome was seen located on the protruded cell membrane with a thick and dense attachment plaque and abundant keratin filament insertion (Fig. 1D). As the cell detached, the keratin insertion decreased (Fig. 1E and F) and finally attachment plaque disappeared (Fig. 1G). These data imply that keratin retraction occurs after desmosomal split. By observing the spongiotic area seen in two PV cases, enlargement of the extracellular space was seen in the epidermis, which could be regarded as shrinking of keratinocytes. Lymphocytic infiltration within the epidermis was almost always seen. No desmosomal split or keratin retraction was observed in the shrunken cells. Instead, desmosomes were observed between philopodial projections spanning two neighboring keratinocytes into a widened intercellular space (Fig. 1H). All these findings of spongiotic area were similar to those reported in allergic contact dermatitis caused by DNCB treatment in the normal human skin [6] and may not be specific to pemphigus. From these results, we would like to stress three messages. First, there was no significant difference between PV and PF in terms of desmosomal split and keratin retraction. The difference of autoantibody profile is not crucial for the morphology of each desmosomal split. Second, desmosomal split always precede keratin retraction in vivo. Mu¨ller et al. [7] have indicated that autoantibody binding can induce keratin retraction independently to cell separation using cultured mouse keratinocytes. We have reported using immuno-electron microscopy on a PV model mouse that desmosomes on the apical surface of basal cells showed splits without keratin retraction and those on the lateral side showed
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
that the Tunisian families are likely linked to the previously identified critical 15q22–15q24 interval. For families PPK3 and PPK4, no other cases could be investigated. Nevertheless, it is noteworthy that the two patients belonging to these families shared a common haplotype between markers D15S534 and D15S650. Parametric multipoint linkage analysis gave the maximum cumulative lod score value of 5.33 for marker D15S650. These results support genetic linkage of the PPK-families to the tested critical interval on 15q22–15q24. It is noteworthy that in family PPK2, individuals IV-1 and IV-2 born to a consanguineous marriage were homozygous for the interval between microsatellite markers D15S213 and D15S988; this segment is likely inherited from a common ancestor. As their mother III-2 was healthy, this suggests that the disease locus should be distal to marker D15S988. In the present study, we provide confirmatory evidence for the location of the punctate PPK in 15q22–15q24 although the precise gene interval should be reconsidered when compared to the study of Gao et al. that suggested that the disease is proximal to D15S988, based on recombinant healthy individuals [5]. To our knowledge, this is the first report of Buschke–Fischer– Brauer’s disease in North African families.
[5] Gao M, Yang S, Li M, Yan KL, Jiang YX, Cui Y, et al. Refined localization of a punctate palmoplantar keratoderma gene to a 5.06-cM region at 15q22.2– 15q22.31. Br J Dermatol 2005;152:874–8. [6] Emmert S, Ku¨ster W, Hennies HC, Zutt M, Haenssle H, Kretschmer L, et al. 47 patients in 14 families with the rare genodermatosis keratosis punctata palmoplantaris Buschke–Fischer–Brauer. Eur J Dermatol 2003;13: 16–20. [7] Al-Mutairi N, Joshi A, Nour-Eldin O. Punctate palmoplantar keratoderma (Buschke–Fischer–Brauer disease) with psoriasis: a rare association showing excellent response to acitretin. J Drugs Dermatol 2005;4: 627–34. [8] Erkek E, Erdogan S, Tuncez F, Kurtipek GS, Bagci Y, Ozoguz P, et al. Type I hereditary punctate keratoderma associated with widespread lentigo simplex and successfully treated with low-dose oral acitretin. Arch Dermatol 2006;142:1076–7. [9] Charfeddine C, Mokni M, Ben Mousli R, Elkares R, Bouchlaka C, Boubaker S, et al. A novel missense mutation in the gene encoding SLURP-1 in patients with Mal de Meleda from northern Tunisia. Br J Dermatol 2003;149:1108–15.
Mbarka Bchetniaa,b Cherine Charfeddinea Selma Kassarb,c Imen Hanchid Haifa Tounsi-Guettitic Ahmed Rebaie Amel Dhahri-Ben Osmand Christian Kubischf Sonia Abdelhaka,* Samir Boubakerc Mourad Moknib,d
Acknowledgements We are especially grateful to the patients and their family members for their interest and cooperation in this study. This work was supported by the Tunisian Ministry of Higher Education and Scientific Research (Research Unit on ‘‘Molecular Investigation of Genetic Orphan Disorders’’ UR 26/04 and Research Unit on ‘‘Hereditary Keratinisation Disorders’’ UR 24/04) and the Ministry of Health. References [1] Stanimirovic A, Kansky A, Basta-Juzbasic A, Skerlev M, Beck T. Hereditary palmoplantar keratoderma, type papulosa, in Croatia. J Am Acad Dermatol 1993;29:435–7. [2] Stevens HP, Kelsell DP, Leigh IM, Ostlere LS, MacDermot KD, Rustin MH. Punctate palmoplantar keratoderma and malignancy in a four-generation family. Br J Dermatol 1996;134:720–6. [3] Martinez-Mir A, Zlotogorski A, Londono D, Gordon D, Grunn A, Uribe E, et al. Identification of a locus for type I punctate palmoplantar keratoderma on chromosome 15q22–q24. J Med Genet 2003;40:872–8. [4] Zhang XJ, Li M, Gao TW, He PP, Wei SC, Liu JB, et al. Identification of a locus for punctate palmoplantar keratodermas at chromosome 8q24.13–8q24.21. J Invest Dermatol 2004;122:1121–5.
a
‘‘Molecular Investigation of Genetic Orphan Diseases’’ Research Unit, Institut Pasteur de Tunis, Tunis, Tunisia b ‘‘Hereditary Keratinization Disorders’’ Research Unit, Hoˆpital La Rabta de Tunis, Tunis, Tunisia c Pathology Department, Institut Pasteur de Tunis, Tunis, Tunisia d Dermatology Department, Hoˆpital La Rabta, Tunis, Tunisia e Bioinformatic department, Centre de Biotechnologie de Sfax, Sfax, Tunisia f Institute of Human Genetics, University Hospital Cologne, Germany
*Corresponding author at: Institut Pasteur de
Tunis, BP 74, 13 Place, Pasteur, 1002 Tunis, Belve´de`re, Tunisia. Tel.: +216 71 849110; fax: +216 71 791833 E-mail addresses: [email protected]; [email protected] (S. Abdelhak)
doi:10.1016/j.jdermsci.2008.11.008
Letter to the editor Rapid identification of Prototheca zopfii by nested polymerase chain reaction based on the nuclear small subunit ribosomal DNA
A R T I C L E I N F O
Keywords: Prototheca zopfii; Protothecosis; Nested PCR; Nuclear small subunit ribosomal DNA
The genus of achlorophyllous unicellular algae, Prototheca was first described in 1894 by Kru¨ger [1,2], and shown to have a similar life cycle to algae from the genus Chlorella. P. zopfii and P. wickerhamii has been reported as a pathogen involved in refractory subcutaneous disease and systemic infection in humans
and in animals [2–4]. Especially, P. zopfii causes bovine mastitis and canine fatal systemic infection, which have recently become major worldwide problems [4,5]. Recently, the incidences of P. zopfii infection have been increasing rapidly in both cattle and humans [2–5]. Therefore, a system to effectively and rapidly identify the pathogen in infected cattle or humans is necessary. P. wickerhamii is another pathogen belonging to this genus, and P. wickerhamii infections are relatively easily treated with antifungal agents, especially amphotericin B. However, the prognosis of subcutaneous infection with P. zopfii is poor, even though this alga is sensitive to azoles in vitro [2]. One reason for this is the difficulty in identifying the alga and thus in selection of effective antifungal agents. Here, the specific nested PCR system was evaluated with reference strains from Japanese culture collections and isolates from bovine mastitis. To our knowledge, this is the first report of a molecular identification system for this pathogenic alga.
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
57
Table 1 Origin and distribution of Prototheca and yeast-like organism strains. Species
No. of isolates
Origin
Total strains
Reference strains
10
10a
Prototheca wickerhamii Prototheca stagnora Candida albicans Candida tropicalis Candida glabrata Candida krusei Chlorella vulgaris Yeast-like organism
4 1 1 1 1 1 1 50
a
4 1a 1b 1b 1b 1b 1c
Total
70
20
Prototheca zopfii
a b c d
Clinical isolates JCM8556, JCM8557, JCM9346, JCM9349, JCM9350, JCM9351, JCM9353, JCM9354, JCM9400, JCM9646 JCM9348, JCM9643, JCM9644, JCM9645 JCM9641 TIMM10234 TIMM750 TIMM90030 TIMM6258 CK-22 NA1, NA3, NA4, NA5, NA6, NA7, NA8, NA9, NA10, NA11, NA12, NA13, NA14, NA15, NA16, NA17, NA18, NA19, NA20, NA21, NA22, NA23, NA24, NA25, NA26, NA27, NA28, NA29, NA30, NA31, NA32, NA33, NA34, NA35, NA51, NA52, NA53, NA55, NA56, NA61, NA62, NA63, NA64, NA65, NA66, NA67, NA68, NA69, NA70, NA71, NA72
50d
50
Japan Collection of Microorganisms (JCM; RIKEN BioResource Center, Wako, Saitama, Japan). Teikyo University Institute of Medical Mycology (TIMM; Tokyo, Japan). Raw Chlorella. V12TM (Chlorella Industry Co., Ltd, Tokyo, Japan). Livestock Medical Center, Aichi Prefectural Federation of Agricultural Mutual Aid Association (NA; Aichi, Japan).
Table 2 Assimilation patterns of reference strains of Prototheca and 50 clinical isolates. Species
Prototheca zopfii Prototheca wickerhamii Prototheca stagnora Yeast-like organism
No. of isolates
Carbohydrates
Reference strains
Clinical isolates
Glucose
Galactose
D(-)Fructose
1-Propanol
Trehalose
Sucrose
Ethanol
Glycerol
10 4 1 0
0 0 0 50
+ + + +
+ +
+ + + +
+ +
+
+ +
+ + + +
+, positive assimilation; , negative assimilation; ; weakly positive assimilation.
The 20 reference strains used in this study consisted of 8 species from 3 genera, and fifty clinical yeast-like isolates from bovine mastitis were used as clinical isolates (Table 1). All clinical strains of yeast-like organisms were isolated from milk samples from cows with mastitis in Aichi, Japan. CHROMagar Candida medium (CaC; CHROMagar, Paris, France) which is commonly used as culture medium for pathogenic yeasts was used for initial isolation from milk samples and incubated at 37 8C for 2 days [6]. Colony features of all Prototheca strains on CaC, were not compatible with any pathogenic yeast. However, it was difficult to distinguish P. zopfii from other Prototheca spp. based on their colony morphology [6]. All reference strains and clinical isolates except Chlorella were subcultured on Yeast and Mould agar (Oxoid, Basingstoke, UK) at 25 8C for 5 days. Moreover, the assimilation tests of all standard strains of Prototheca and clinical isolates were carried out with reference to the method of Pore [1], and 8 carbohydrates were tested. All of the reference strains of P. zopfii and fifty clinical isolates (100%; 60/60) were identified as P. zopfii by the assimilation test Table 2. Chlorella vulgaris was directly processed for DNA extraction. DNAs were extracted from the 20 reference strains with a Gen Toru Kun for yeast kit (Takara Bio Co., Otsu, Shiga, Japan). The DNA samples were stored at–20 8C until use. DNA templates from fifty clinical isolates were extracted rapidly as follows: A small amount of a colony was picked up with a toothpick and put into 1 ml of saline (0.9% Nacl). The colony was suspended, boiled for 10 min and then centrifuged at 10,000 g for 2 min, and the supernatant was then used as the template for PCR. The oligonucleotides used in the present study were designed based on comparisons with the sequences of small subunit ribosomal DNAs (SSU rDNA) in the DDBJ/EMBL/GenBank data bases [7,8]. The designed primers were shown in Table 3. This
nested PCR assay method was previously reported by Yoshida et al. [9]. Amplified PCR product from P. zopfii JCM9646 with O18SF1 and O18SR1 primers was ligated into the TA cloning plasmid vector pCR 2.1 (Invitrogen., Tokyo, Japan). The product was introduced into Escherichia coli DH5a (Nippon Gene, Tokyo, Japan). After propagation and purification of the plasmid, the concentration (copies ml1) was calculated from the A260 and the molecular mass of the plasmid. In addition, the sensitivity of the nested PCR assay was examined using serial dilutions of this plasmid solution (5– 5 106 copies per tube) with duplicate samples. The specificity of the P. zopfii-specific nested PCR system for reference strains were examined. Fig. 1 (a) shows first and nested PCR products amplified with universal primers, O18SF1/O18SR1 and P. zopfii-specific primers, 18PZF1/18PZR1, respectively. DNA was successfully amplified from all reference strains using the universal primers. However, only P. zopfii DNA was detected with the nested P. zopfii-specific primers. In addition, no amplicons were produced from DNAs of either species by nested PCR. Common PCR with P. zopfii-specific primers also successfully identified P. zopfii strains (data not shown). The results of nested PCR analysis obtained from Table 3 Primers and their nucleotide sequences used in this study. Primer
Nucleotide sequence (50 -30 )
Universal primer O18SF1 TACCACATCCAAGAAAGGCA O18SR1 CCTTGGCAAATGCTTTCGCA
Primer pair (F/R) Expected size (bp)
O18SF1/O18SR1
551
P. zopfii-specific primer 18PZF1 ACAATACGTAGCGATGCCGAACT 18PZF1/18PZR1 18PZR1 GCCAGCCAGAGGACGCCGAA
233
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
58
Fig. 1. 1.0% Agarose gel electrophoresis showing photographic image. (a) Specificity of the nested PCR system. Gel electrophoresis images of PCR using universal primers (A) and P. zopfii-specific primers (B). M, DNA molecular weight marker; (1) C. vulgaris; (2)–(11) P. zopfii; (12)–(15) P. wickerhamii; (16) P. stagnora; (17) C. albicans; (18) C. tropicalis; (19) C. glabrata; (20) C. krusei. (b) Sensitivity of the nested PCR system. Gel electrophoresis images of PCR using universal primers (A) and P. zopfii-specific primers (B). M, DNA molecular weight marker; (1,2) 5 106; (3,4) 5 105; (5,6) 5 104; (7,8) 5 103; (9,10) 5 102; (11,12) 5 10; (13,14) 5; and (15,16) 0 copies of plasmid template.
reference strains and clinical isolates were identical, as summarized in Table 4. All yeast-like organisms isolated from milk were consistent with those of the assimilation tests, identifying as P. zopfii. As sensitivity, 5 102 copies (plasmid/tube) of template were detected by first PCR and 5 10 copies (plasmid/tube) were detected by nested PCR (Fig. 1 (b)). No whole genome sequence has yet been reported in Prototheca species. However, Hordeum vulgare (barley) is a representative green plant and its ribosomal DNA complex copy number is known to be approximately 1000 and the Trebouxiophyceae [10], the class to which Prototheca belongs, is closely related to green plants [2]. Calculation from the copy number, lower detection limit of the nested PCR may be equivalent to less than one cell of P. zopfii.
This system enabled us to identify the species accurately and directly from cultured colonies with high sensitivity in 3.5 h, even in the case of isolates with atypical phenotypic features that precluded identification based on morphology. The nested PCR system reported here requires less than 1 day to identify the algae, as reported previously [9]. On the other hand, conventional identification requires 3–7 days for the initial culture and a further 1 week for the assimilation pattern test. Based on the high specificity and sensitivity, the system reported here may be able to directly detect P. zopfii in milk or clinical specimens. Further experiments regarding molecular diagnosis of protothecosis are currently underway in our laboratory.
Table 4 Results of PCR analysis with O18SF1/SR1 and 18PZF1/R1 primers for reference strains and 50 clinical isolates. Species
Origin
PCR with primer pair O18SF1/O18SR1 (First, PCR)
Prototheca zopfii Prototheca wickerhamii Prototheca stagnora Candida albicans Candida tropicalis Candida glabrata Candida krusei Chlorella vulgaris Yeast-like organism Total
Reference strains
Clinical isolates
18PZF1/18PZR1 (nested PCR)
Positive
Negative
Positive
Negative
10 1 1 1 1 1 1 1 50
0 0 0 0 0 0 0 0 0
10 0 0 0 0 0 0 0 50
0 1 1 1 1 1 1 1 0
67
0
60
7
Letters to the Editor / Journal of Dermatological Science 54 (2009) 43–63
Acknowledgments We are grateful to Dr. Takaaki Itou, Livestock Medical Center, Aichi Prefectural Federation of Agricultural Mutual Aid Association, for the kind gift of clinical isolates, and to Dr. Motofumi Suzuki, RIKEN BioResource Center, Wako, Saitama, Japan, for kindly providing the Prototheca reference strains. We thank Dr. Rui Kano for critical discussion, Dr. Takafumi Osumi for technical assistance with assimilation pattern testing, Department of Pathobiology, School of Veterinary Medicine, Nihon University, Fujisawa Kanagawa, Japan.
59
[8] Ueno R, Urano N, Suzuki M. Phylogeny of the non-photosynthetic green microalgal genus Prototheca (Trebouxiophyceae, Chlorophyta) and related taxa inferred from SSU and LSU ribosomal DNA partial sequence data. FEMS Microbiol Lett 2003;223:275–80. [9] Yoshida E, Makimura K, Mirhendi H, Kaneko T, Hiruma M, Kasai T, et al. Rapid identification of Trichophyton tonsurans by specific PCR based on DNA sequences of nuclear ribosomal internal spacer (ITS) 1 region. J Dermatol Sci 2006;42:225–30. [10] Zhang QF, Saqhai Maroof MA, Allard RW. Effects on adaptedness of variations in ribosomal DNA copy number in populations of wild barley (Hordeum vulgare spp. spontaneum). Proc Natl Acad Sci USA 1990;87:8741–5.
Masanobu Onozakia,b Koichi Makimurab,* Atsuhiko Hasegawab
References a
[1] Pore RS. Prototheca, a yeast-like alga. In: Kurtzman CP, Fell JW, editors. The Yeast, A Taxonomic Study. 4th edn, Amsterdam: Elsevier Science; 1998. p. 881–7. [2] Cornelia Lass-Flo¨rl. Astrid mayr: human protothecosis. Cin Mycrobiol Rev 2007;20:230–42. [3] Leimann BC, Monteiro PC, Laze´ra, Lazera M, Candanoza ER. Wanke B Protothecosis Med Mycol 2004;42:95–106. [4] Ikeda T. Ghoma M: protothecosis in animals. Vet Darmatol Japan 2002;8:23–32. [5] Bueno VF, de Mesquita AJ, Neves RB, de Souza MA, Ribero AR, Nicolau ES, et al. Epidemiological and clinical aspects of the first outbreak of bovine mastitis caused by Prototheca zopfii in Goia´s State, Brazil. Mycopathologia 2006;161: 141–5. [6] Casal M, Linares MJ, Solı´s F, Rodrı´guez FC. Appearance of colonies of Prototheca on CHROMagar Candida medium. Mycopathologia 1997;137:79–82. [7] Mo¨ller A, Truyen U. Roesler U: Prototheca zopfii genotype 2—The causative agent of bovine protothecal mastitis? Vet Microbiol 2007;120:370–4. Short communication.
Kanto Chemical Co., Inc., Marusan Bldg. 11-5, Nihonbashi Honcho, 3-Chome, Chuo-ku, Tokyo 103-0023, Japan b Teikyo University Institute of Medical Mycology, 359 Otsuka, Hachioji, Tokyo 192-0395, Japan *Corresponding author. Tel.: +81 426 78 3256; fax: +81 426 78 256 E-mail address: [email protected] (K. Makimura) 28 April 2008 doi:10.1016/j.jdermsci.2008.10.009
Letter to the Editor Desmosome splitting is a primary ultrastructural change in the acantholysis of pemphigus To the Editor, Pemphigus comprises a group of autoimmune blistering diseases affecting the skin and/or mucous membranes [1]. The blister formation in pemphigus has been elucidated markedly and shown to be caused by autoantibodies against desmoglein 1 (Dsg 1) and desmoglein 3 (Dsg 3) [2]. On the other hand, morphological studies using electron microscope on pemphigus were performed in 1960s [3–5], when little was known about their underlying molecular pathophysiology. Now the changes of desmosomekeratin cytoskeleton have come to the central point of discussion as the cause of acantholysis, it is necessary and timely to reevaluate the ultrastructural changes in pemphigus, particularly focusing to the changes of desmosomes and cytoskeletal structures. Two mucocutaneous type pemphigus vulgaris (PV) cases, one mucosal-dominant PV case, and two pemphigus foliaceus (PF) cases (Table 1) were analyzed in this study. Skin biopsies were taken from the new blister on the skin or buccal mucous membrane. By light microscopy, acantholysis was clearly observed in all five cases and, in addition, spongiosis with lymphocytic infiltration was seen near the blister in two PV cases. By observing the acantholytic area by electron microscopy, half-split desmosomes were seen on the cell surface in all cases (Fig. 1A). In the acantholytic keratinocytes with fully developed blisters, keratin condensation around the cell nucleus resulted in the total disappearance of tonofilaments at cell periphery (Fig. 1B). We could not find any difference in the ultrastructural features between mucocutaneous type PV and mucosal-dominant type PV. In addition, we observed no differences in desmosomal change between PV and PF at high magnification.
The close chronological relationship between keratin retraction and half-split desmosome formation required further clarification. When focusing on apical cell surface of a basal cell in the very edge of a blister in PV, several stages of the half-split desmosomes were recognized (Fig. 1C–G). Where plasma membranes of basal and suprabasal cells were observed nearby, an initial stage of half-split desmosome was seen located on the protruded cell membrane with a thick and dense attachment plaque and abundant keratin filament insertion (Fig. 1D). As the cell detached, the keratin insertion decreased (Fig. 1E and F) and finally attachment plaque disappeared (Fig. 1G). These data imply that keratin retraction occurs after desmosomal split. By observing the spongiotic area seen in two PV cases, enlargement of the extracellular space was seen in the epidermis, which could be regarded as shrinking of keratinocytes. Lymphocytic infiltration within the epidermis was almost always seen. No desmosomal split or keratin retraction was observed in the shrunken cells. Instead, desmosomes were observed between philopodial projections spanning two neighboring keratinocytes into a widened intercellular space (Fig. 1H). All these findings of spongiotic area were similar to those reported in allergic contact dermatitis caused by DNCB treatment in the normal human skin [6] and may not be specific to pemphigus. From these results, we would like to stress three messages. First, there was no significant difference between PV and PF in terms of desmosomal split and keratin retraction. The difference of autoantibody profile is not crucial for the morphology of each desmosomal split. Second, desmosomal split always precede keratin retraction in vivo. Mu¨ller et al. [7] have indicated that autoantibody binding can induce keratin retraction independently to cell separation using cultured mouse keratinocytes. We have reported using immuno-electron microscopy on a PV model mouse that desmosomes on the apical surface of basal cells showed splits without keratin retraction and those on the lateral side showed