Rapid molecular detection of Lujo virus RNA

G Model VIRMET 12311 1–4

ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

1

Short communication

2

Rapid molecular detection of Lujo virus RNA

4

Barry Atkinson ∗ , John Chamberlain, Stuart D. Dowall, Nicola Cook, Christine Bruce, Roger Hewson

5

Microbiology Services Division, Public Health England, Porton Down, Salisbury SP4 0JG, UK

3

Q1

6

a b s t r a c t

7 8 9 10 11 12

Article history: Received 10 December 2012 Received in revised form 9 September 2013 Accepted 20 September 2013 Available online xxx

13 14 15 16 17 18

Keywords: Lujo Arenavirus RT-PCR-real-time RT-PCR Diagnostic assay

Lujo virus is an emerging arenavirus circulating in Southern Africa. Although to date there has only been a single outbreak of the novel haemorrhagic disease resulting from human infection with this virus, the case-fatality rate of exposed individuals, including nosocomial transmission, was 80%. The ability to identify viral haemorrhagic fevers accurately, especially those capable of nosocomial transmission, is of critical importance. Timely identification of these diseases allow medical professionals to isolate patients and implement barrier nursing techniques in order to prevent onward transmission of the virus. While rapid diagnostic methods are published for most viral haemorrhagic fevers, at present there are no such virus specific protocols for Lujo haemorrhagic fever. This report details the first set of diagnostic molecular assays designed to identify Lujo viral RNA rapidly, and demonstrates the potential functionality of these assays for use in the clinical setting. Although these assays have been designed and validated against a solitary isolate of Lujo virus, this represents the entirety of strains detected to date, and offer quick, cheap and easy methods for use in diagnostic laboratories. © 2013 Published by Elsevier B.V.

Lujo virus (LUJV) is the causative agent of an emerging haemorrhagic disease: Lujo haemorrhagic fever (LHF). The virus is classified within the Arenavirus genus of the family Arenavirdae. 21 Viruses classified within the Arenavirus genus can be divided 22 into two distinct groups based on their antigenic properties; an 23 Old World lineage comprising viruses belonging to the Lassa24 Lymphocytic Choriomeningitis serocomplex, and a New World 25 lineage comprising viruses belonging to the Tacaribe serocomplex 26 (Bowen et al., 1997). To date, 24 species of arenavirus have been 27 recognised by the International Committee for Virus Taxonomy, 28 with several putative species pending taxonomic classifica29 tion into this genus (King, 2011). Nine arenaviruses have been 30 associated with human disease: six classified within the New 31 World serocomplex (Junin virus-JUNV, Machupo virus-MACV, 32 Guanarito virus-GTOV, Sabia virus-SABV, Chapare virus-CHPV 33 and Whitewater Arroyo virus-WWAV), and three classified 34 with the Old World serocomplex (Lassa virus-LASV, Lympho35 cytic Choriomeningitis virus-LCMV, and Lujo virus-LUJV). LASV, 36 JUNV, MACV and GTOV have been responsible for several large 37 38Q2 outbreaks of severe haemorrhagic fever (Peters, 2002); SABV, WWA, CHPV and LUJV have been associated with solitary or 39 sporadic outbreaks of haemorrhagic fever (CDC, 2000; Coimbra 40 et al., 1994; Delgado et al., 2008; Paweska et al., 2009); while 41 LCMV is a widely distributed, typically mild/asymptomatic 42 19 20

∗ Corresponding author. Tel.: +44 01980 612951. E-mail address: [email protected] (B. Atkinson).

pathogen associated with meningitis and neurological complications in immunocompromised patients (Barton and Hyndman, 2000). A solitary case of naturally acquired LHF has been recorded; the infection of a Zambian travel agent in September 2008 (Paweska et al., 2009). The exact route of infection of this case is yet to be Q3 determined, however other pathogenic viruses classified within the genus are associated with exposure to aerosolised virus-infected excreta from small mammals, or by direct contact of infectious material through abraded skin (Charrel et al., 2008; Emonet et al., 2011). This patient was medically evacuated to South Africa, where associated treatment resulted in three cases of secondary transmission, and one case of tertiary transmission. Four of these five confirmed cases of LHF were fatal (Briese et al., 2009; Paweska et al., 2009). To date, the molecular identification of LUJV has been achieved through next generation sequencing. This report describes both RTPCR and real-time RT-PCR methods designed for direct and specific identification of LUJV RNA in the clinical setting. An RT-PCR assay for the direct detection of LUJV RNA was designed against the two complete S segment sequences on Genbank; NC 012776.1 and FJ952384.1; both sequences were derived from the original outbreak and are identical. A set of primers was designed to detect the coding sequence for the glycoprotein (GP) of LUJV (Table 1). PCR amplification was performed using SuperScript® III One-Step RT-PCR System with Platinum Taq (Life Technologies, Carlsbad, USA). The final mastermix (20 ␮L) comprised 12.5 ␮L of 2× Reaction Mix, 4.5 ␮L of PCR-grade water,

0166-0934/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.jviromet.2013.09.006

Please cite this article in press as: Atkinson, B., et al., Rapid molecular detection of Lujo virus RNA. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.09.006

43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70

ARTICLE IN PRESS

G Model VIRMET 12311 1–4

B. Atkinson et al. / Journal of Virological Methods xxx (2013) xxx–xxx

2 Table 1 Primers and probes for the detection of LUJV RNA. Assay type

Target

Primer name

Primer sequence

Amplicon size

Described

Real-time

LUJV GP

This report

LUJV GP

566 bp

This report

RT-PCR

Old World Arenavirus

TGTTGGCTGGTTAGTAATGG CTTTCTTTAGCATCTCGGTCAG FAM-TTTATCTGCCTCATCTTCCATATCATG-BHQ1 ATGACAAGAACTGCACTGGTC CTTTCTTTAGCATCTCGGTCAG AGAATYAGTGAAAGGGARAGYAAYTC CACATCATTGGTCCCCATTTACTRTGATC

100 bp

RT-PCR

Lujo GP S1046F Lujo GP S1145R Lujo GP S1120P Lujo GP S579R Lujo GP S1145F OW arenavirus F OW arenavirus R

395 bp

Vieth et al. (2007) a

a Primers altered from original report to create 2 degenerate primers in place of 5 non-degenerate primers. RT-PCR kit, mastermix volumes and cycling conditions altered to fit format of Lujo specific assay.

1 ␮L of each primer (at 10 ␮M working concentration), and 1 ␮L SuperScript® III RT/Platinum® Taq Mix. 5 ␮L of template was added 73 to give a final reaction volume of 25 ␮L. The cycling conditions used 74 were 50 ◦ C for 15 min, 95 ◦ C for 2 min, followed by 45 cycles of 75 95 ◦ C for 15 s, 55 ◦ C for 30 s, and 68 ◦ C for 45 s, with a final exten76 sion step of 68 ◦ C for 7 min. Fig. 1 shows successful amplification of 77 LUJV viral RNA using this assay produces a single band of 566 bp; 78 no amplification occurred with viral RNA from LASV, LCMV, Mobala 79 virus (MOBV) or Mopeia virus (MOPV). Viral RNA for Ippy virus was 80 not available for testing, however, the lack of primer homology to 81 published sequence information for this virus (Genbank accession 82 NC 007905.1) suggests no amplification will occur. 83 In addition to this LUJV specific RT-PCR assay, a published Pan 84 Old World arenavirus RT-PCR assay (Vieth et al., 2007) was utilised 85 for the detection of LUJV viral RNA in combination with other Old 86 World arenaviruses. The primers for this assay were altered from 87 the original publication with the five original primers reduced to 88 a single forward primer and single reverse primer by introduc89 ing degenerate bases to provide coverage of all original sequences 90 (Table 1). The RT-PCR kit and cycling conditions were also altered, 91 and are identical to those documented above for the LUJV specific 92Q4 RT-PCR assay. Figs. 2 and 3 show the effectiveness of this assay in 93 detecting viral RNA from the Old World arenaviruses LUJV, LASV, 94 LCMV, MOBV and MOPV. 95 Confirmatory sequence analysis of positive bands from both 96 assays was achieved using the same primers used for PCR amplifi97 cation. Briefly, the band of interest was excised from 2% agarose 98 gel and purified using QIAquick Gel Extraction Kit (Qiagen, 99 Venlo, Netherlands) according to the manufacturer’s instructions. 100 Nucleotide labelling was carried out using Big Dye® Terminator 101 v3.1 Cycle Sequencing Kit (Life Technologies) in conjunction with 102 the primers used for PCR amplification. Unincorporated dye ter103 minators were removed using DyeEx 2.0 Spin Kit (Qiagen), and 71 72

Fig. 1. Agarose gel electrophoresis image of the Lujo specific RT-PCR assay. Positive amplification of LUJV RNA produces a band of 566 base pairs. No amplification is evident for other confirmed Old World arenaviruses. Lanes 1 and 8–100 bp ladder; Lane 2 – Lujo viral RNA; Lane 3 – Lassa GA391 viral RNA; Lane 4 – LCMV Armstrong viral RNA; Lane 5 – Mobala viral RNA; Lane 6 – Mopeia viral RNA; and Lane 7 – no template control.

sequenced using the 3130xl sequencer platform (Life Technologies) all in accordance with the manufacturer’s instructions. A real-time RT-PCR for the detection of LUJV GP was also designed (Table 1). This assay incorporates a single hydrolysis probe to provide real-time reporting of amplification. This probe was designed with a 5 6-carboxifluorescein (FAM) fluorophore and a 3 Black Hole Quencher 1 (BHQ1) quencher to maximise potential sensitivity by reducing background fluorescence (Yang et al., 2009).

Fig. 2. Agarose gel electrophoresis image of the Pan Old World arenavirus RT-PCR assay. Positive amplification of arenavirus RNA produces a band of 395 base pairs. Lanes 1 and 8–100 bp ladder; Lane 2 – Lujo viral RNA; Lane 3 – Lassa GA391 viral RNA; Lane 4 – LCMV Armstrong viral RNA; Lane 5 – Mobala viral RNA; Lane 6 – Mopeia viral RNA; and Lane 7 – no template control.

Fig. 3. Real-time RT-PCR data utilising the novel Lujo real-time RT-PCR assay against confirmed Old World arenaviruses; only the sample for Lujo viral RNA produced a positive amplification reaction.

Please cite this article in press as: Atkinson, B., et al., Rapid molecular detection of Lujo virus RNA. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.09.006

104 105 106 107 108 109 110 111

G Model VIRMET 12311 1–4

ARTICLE IN PRESS B. Atkinson et al. / Journal of Virological Methods xxx (2013) xxx–xxx

112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177

The real-time RT-PCR assay was developed and validated using the LightCycler 2.0 and LightCycler 480 platforms (both Roche Diagnostics, Basel, Switzerland), the 7500 Fast platform (Life Technologies) and utilising the SuperScript® III Platinum One-step qRT-PCR kit (Life Technologies). The final mastermix (15 ␮L) comprised 10 ␮L of 2× Reaction Mix, 1.7 ␮L of PCR-grade water, 1 ␮L of each primer (both at 18 ␮M working concentration), 0.5 ␮L of probe (at 25 ␮M working concentration) and 0.8 ␮L of SuperScript® III enzyme mix. 5 ␮L of template RNA was added to the mastermix in order to give a final reaction volume of 20 ␮L. The cycling conditions used were 50 ◦ C for 10 min, 95 ◦ C for 2 min, followed by 45 cycles of 95 ◦ C for 10 s and 60 ◦ C for 40 s (with quantitation analysis of fluorescence performed at the end of each 60 ◦ C step), and a final cooling step of 40 ◦ C for 30 s. LUJV derived from the original 2008 outbreak was used to provide viral nucleic acid for the development and validation of this assay. The virus was cultured in vitro using Vero E6 cells and L15 medium supplemented with 2% serum. Virus propagation was performed under high containment (Containment Level 4) conditions. Infectious virus was inactivated using AVL buffer (Qiagen) and viral RNA was purified using the QIAamp viral RNA mini kit (Qiagen) in accordance with the manufacturer’s instructions. The limit of detection for the real-time RT-PCR assay was determined using a quantitated RNA oligonuclotide mimicking the real-time RT-PCR amplicon (Integrated DNA Technologies, Coralville, USA); the lowest dilution at which 100% of replicates were detected was 50 copies per reaction. In-run analysis (7500 software version 2.0.6 – Life Technologies) determined the R2 value to be 0.996 with a slope of −3.466 and a Y-intercept of 42.76. This limit of detection was approximately one log more sensitive than the RT-PCR assays (data not shown). RNA purified from a broad spectrum of typed viral pathogens was run against this real-time RT-PCR assay to demonstrate specificity (Table 2); no false positives were detected. This panel included several viruses from the Arenaviridae family to demonstrate specificity to LUJV RNA, as well as other viruses that have the ability to cause haemorrhagic fevers in humans. From a clinical viewpoint, LHF should be considered for any seriously ill patient returning from a country in Southern African, especially Zambia, displaying symptoms of headache, fever, malaise, fatigue, diarrhoea, vomiting, chest pain, pharyngitis, rash, myalgia and/or facial swelling. The later stages of disease are associated with severe deterioration in renal, neurological, circulatory and pulmonary functions (Paweska et al., 2009). While haemorrhagic manifestations are often a key clinical indicator, they are not always present; in the 2008 outbreak a morbilliform rash that was present on the face and trunk of all three Caucasian patients was absent in both African patients (Paweska et al., 2009). In order to provide a comprehensive evaluation against pathogens with a similar clinical presentation to LHF, it is recommended to also test for other viral haemorrhagic fevers known to circulate in this region. This may include diseases such as CrimeanCongo haemorrhagic fever, Lassa fever, yellow fever, West Nile fever, chikungunya, Rift Valley fever, Ebola haemorrhagic fever and Marburg haemorrhagic fever. Validated assays for the detection of these pathogens have been reported, and should be considered for differential diagnosis when testing suspected cases for LHF (Atkinson et al., 2012; Demby et al., 1994; Drosten et al., 2002; Edwards et al., 2007; Hadfield et al., 2001; Trombley et al., 2010). Various clinical samples are suitable for the molecular detection of viral haemorrhagic fevers (Drosten et al., 2003), and the identification of Old World arenavirus RNA was made from blood and liver samples during the LHF outbreak (Paweska et al., 2009). The ability to detect high consequence human pathogens rapidly and accurately, especially those capable of nosocomial transmission, is of critical importance. Although to date there has only been a single outbreak of LHF, the disease had a high case fatality rate

3

Table 2 Viral RNA species tested to ensure no cross-reactivity with other human pathogens. Viral RNA obtained from the HPA Rare and imported pathogens unit; 5 ␮L of sample used at standard dilution for positive control material in diagnostic testing. Genus

Virus

Strain

Alphavirus

Chikungunya Eastern Equine Encephalitis Mayaro O’nyong-nyong Sindbis Venezuelan Equine Encephalitis Western Equine Encephalitis

S27 H178/99

Arenavirus

Junin Lassa Machupo LCMV Mobala Mopeia

XJ GA391 AA288-77 Armstrong CAR M-152

Filovirus

Ebola Marburg

Boniface Hartz

Flavivirus

Dengue (serotypes 1–4) Japanese Encephalitis Louping Ill Omsk St Louis Encephalitis Tick-Borne Encephalitis West Nile Yellow Fever Kyasanur Forest Disease

Hawaii, New Guninea, H87, TC25 Nakayama LI/ADRA/1 3384 H109/92 Neudoerfl NY-99 17D India 1961

Hantavirus

Dobrava Hantaan Puumala Seoul Sin Nombre

Dobrava-Belgrade 76/118 CG18/20 R22 HN107

Henipavirus

Hendra Nipah

Australian prototype Malaysian prototype

Nairovirus Orthobunyavirus Orthopoxvirus

CCHF Oropouche Vaccina

Baghdad-12 #27 13/01/1961 vTF7-3

Phlebovirus

Rift Valley Fever Sandfly Fever Virus (Naples) Sandfly Fever Virus (Sicilian) Toscana

ZH 501 H22/92

TC652 SG 650 EGAR 339 H12/93 H160/99

H58/00 RRV

(80%), and resulted in onward transmission to four individuals in the healthcare setting. The molecular assays described in this report provide the ability to directly detect LUJV viral RNA that can be transferred into any diagnostic laboratory. Disclosure statement This report contains work commissioned by the National Institute for Health Research. The views expressed are those of the authors and not necessarily those of the NHS, the National Institute for Health Research or the Department of Health. Conflict of interest The authors declare no conflicts of interest. Role of the funding source The sponsors of this work had no role in the design, implementation or interpretation data achieved through this study.

Please cite this article in press as: Atkinson, B., et al., Rapid molecular detection of Lujo virus RNA. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.09.006

178 179 180 181

182

183 184 185 186

187

188

189

190

G Model VIRMET 12311 1–4

191 Q5

192

193

ARTICLE IN PRESS B. Atkinson et al. / Journal of Virological Methods xxx (2013) xxx–xxx

4

Uncited reference Oldstone (2002). Acknowledgment

196

The authors would like to acknowledge the assistance of the Centres for Disease Control and Prevention for providing the Lujo virus used in this report.

197

References

194 195

198 199 200 Q6 201 202 203 204 205 206 207 208 209 Q7 210 211 212 213 214 215 216 217 218 219 220 221 222

Atkinson, B., Chamberlain, J., Logue, C.H., Cook, N., Bruce, C., Dowall, S.D., Hewson, R., 2012. Development of a real-time RT-PCR assay for the detection of CrimeanCongo hemorrhagic fever virus. Vector Borne Zoonotic Dis. (Larchmont, N.Y.). Barton, L.L., Hyndman, N.J., 2000. Lymphocytic choriomeningitis virus: reemerging central nervous system pathogen. Pediatrics 105, E35. Bowen, M.D., Peters, C.J., Nichol, S.T., 1997. Phylogenetic analysis of the Arenaviridae: patterns of virus evolution and evidence for cospeciation between arenaviruses and their rodent hosts. Mol. Phylogenet. Evol. 8, 301–316. Briese, T., Paweska, J.T., McMullan, L.K., Hutchison, S.K., Street, C., Palacios, G., Khristova, M.L., Weyer, J., Swanepoel, R., Egholm, M., Nichol, S.T., Lipkin, W.I., 2009. Genetic detection and characterization of Lujo virus, a new hemorrhagic feverassociated Arenavirus from Southern Africa. PLoS Pathog 5. CDc, 2000. Fatal illnesses associated with a new world arenavirus – California, 1999–2000. MMWR Morb. Mortal. Wkly. Rep. 49, 709–711. Charrel, R.N., de Lamballerie, X., Emonet, S., 2008. Phylogeny of the genus Arenavirus. Curr. Opin. Microbiol. 11, 362–368. Coimbra, T.L.M., Nassar, E.S., Burattini, M.N., de Souza, L.T.M., Ferreira, I.B., Rocco, I.M., Travassos da Rosa, A.P.A., Vasconcelos, P.F.C., Pinheiro, F.P., LeDuc, J.W., Rico-Hesse, R., Gonzalez, J.-P., Jahrling, P.B., Tesh, R.B., 1994. New arenavirus isolated in Brazil. Lancet 343, 391–392. ˜ C.G., Vargas, J., Delgado, S., Erickson, B.R., Agudo, R., Blair, P.J., Vallejo, E., Albarino, Comer, J.A., Rollin, P.E., Ksiazek, T.G., Olson, J.G., Nichol, S.T., 2008. Chapare virus, a newly discovered arenavirus isolated from a fatal hemorrhagic fever case in Bolivia. PLoS Pathog. 4, e1000047. Demby, A.H., Chamberlain, J., Brown, D.W., Clegg, C.S., 1994. Early diagnosis of Lassa fever by reverse transcription-PCR. J. Clin. Microbiol. 32, 2898–2903.

Drosten, C., Göttig, S., Schilling, S., Asper, M., Panning, M., Schmitz, H., Günther, S., 2002. Rapid detection and quantification of RNA of Ebola and Marburg viruses, Lassa virus, Crimean-Congo hemorrhagic fever virus, Rift valley fever virus, Dengue virus, and Yellow fever virus by real-time reverse transcription-PCR. J. Clin. Microbiol. 40, 2323–2330. Drosten, C., Kümmerer, B.M., Schmitz, H., Günther, S., 2003. Molecular diagnostics of viral hemorrhagic fevers. Antiviral Res. 57, 61–87. Edwards, C.J., Welch, S.R., Chamberlain, J., Hewson, R., Tolley, H., Cane, P.A., Lloyd, G., 2007. Molecular diagnosis and analysis of Chikungunya virus. J. Clin. Virol. 39, 271–275. Emonet, S.E., Urata, S., de la Torre, J.C., 2011. Arenavirus reverse genetics: new approaches for the investigation of Arenavirus biology and development of antiviral strategies. Virology 411, 416–425. Hadfield, T.L., Turell, M., Dempsey, M.P., David, J., Park, E.J., 2001. Detection of West Nile virus in mosquitoes by RT-PCR. Mol. Cell. Probes 15, 147–150. King, A., 2011. Virus Taxonomy: IXth Report of the International Committee on Q8 Taxonomy of Viruses. Elsevier. Oldstone, M.B.A. (Ed.), 2002. Arenaviruses: vol. 1: The Epidemiology, Molecular and Cell Biology of Arenaviruses. Springer-Verlag Berlin and Heidelberg GmbH & Co. K. Paweska, J.T., Sewlall, N.H., Ksiazek, T.G., Blumberg, L.H., Hale, M.J., Lipkin, W.I., Weyer, J., Nichol, S.T., Rollin, P.E., McMullan, L.K., Paddock, C.D., Briese, T., Mnyaluza, J., Dinh, T.-H., Mukonka, V., Ching, P., Duse, A., Richards, G., de Jong, G., Cohen, C., Ikalafeng, B., Mugero, C., Asomugha, C., Malotle, M.M., Nteo, D.M., Misiani, E., Swanepoel, R., Zaki, S.R., Teams, I., 2009. Nosocomial outbreak of novel Arenavirus infection, Southern Africa. Emerg. Infect. Dis. 15, 1598–1602. Trombley, A.R., Wachter, L., Garrison, J., Buckley-Beason, V.A., Jahrling, J., Hensley, L.E., Schoepp, R.J., Norwood, D.A., Goba, A., Fair, J.N., Kulesh, D.A., 2010. Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses. Am. J. Trop. Med. Hyg. 82, 954–960. Vieth, S., Drosten, C., Lenz, O., Vincent, M., Omilabu, S., Hass, M., Becker-Ziaja, B., ter Meulen, J., Nichol, S.T., Schmitz, H., Günther, S., 2007. RT-PCR assay for detection of Lassa virus and related Old World arenaviruses targeting the L gene. Trans. R. Soc. Trop. Med. Hyg. 101, 1253–1264. Yang, G.P., Erdman, D.D., Tondella, M.L., Fields, B.S., 2009. Evaluation of tetramethylrhodamine and black hole quencher 1 labeled probes and five commercial amplification mixes in TaqMan real-time RT-PCR assays for respiratory pathogens. J. Virol. Methods 162, 288–290.

Please cite this article in press as: Atkinson, B., et al., Rapid molecular detection of Lujo virus RNA. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.09.006

223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262