- Email: [email protected]
Rapid multiplex single nucleotide polymorphism genotyping based on single base extension reactions and color-coded beads
JOURNAL OFBIOSCIENCE 368-370. 2002
Rapid Multiplex Single Nucleotide Polymorphism Genotyping Based on Single Base Extension Reactions and Color-Coded Beads NAOKO FUJIMURA,‘,* YOSHINOBU KOHAJXA,‘,**KAZUNORI OKANO,* MASAFUMI YOHDA,’ ANDHIDEKI KAMBARA’ Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-l 6 Nakacho, Koganei, Tokyo 184-0012, Japan’ and Hitachi Ltd., Central Research Laboratory, I-280 Higashi-Koigakubo, Kokubunji, Tokyo 185-8601, Japan’ Received 20 June 2002/Accepted 30 August 2002
A Single nucleotide polymorphism (SNP) typing method using color-coded beads is promising because it is easy to use and inexpensive. However, the present protocols are not suitable for clinical and diagnostic applications because they need centrifugation for bead-washing. Here, we developed a simplified protocol without a bead-washing procedure that enables SNP typing of PCR amplified fragments in only 30 min. [Key words: SNF’genotyping, color-coded beads, single base extension, DNA diagnosis] Huge amounts of mutation and polymorphism data have been accumulated through genome projects of humans and other biologically important species (1, 2). Single nucleotide polymorphisms (SNPs) are the most frequent polymorphism found. They are expected to be diagnosis markers for a number of diseases and drug responses. Many SNP typing methods, including the TaqMan assay (3), Invader assay (4), molecular beacon (5), PCR and electrophoresis (6), mass spectrometry (7), pyro-sequencing (S), bioluminometric assay coupled with modified primer extension reactions (BAMPER) (9), DNA chip (lo), and bead technology (1 l-l 3), have been developed. For a clinical and diagnostic SNP analysis, a rapid, easyto-use, and inexpensive SNP typing method should be selected. In addition, it should be suitable for automation. Thus, labor-intensive methods would no longer be used for such purposes. Among the SNP typing methods listed above, methods based on color-coded beads are ideal for bedside SNP typing because they enable easy-to-use and inexpensive multiplex typing. However, the present protocols require bead-washing procedures using a centrifuge, which is not suitable for rapid and automated SNP detection. Moreover, it takes 5 h to perform one assay form PCR amplified DNA fragment, which is too long for a bedside diagnosis. In our study, we developed a rapid and simplified SNP typing method using single base extension (SBE) reactions and color-coded beads. The beads are microspheres with two fluorescent dyes and are incorporated in different amounts to indicate the bead codes. After mixing the probeconjugated beads and the sample, the mixture was analyzed in the fluoro-cytometer, Luminex 100 system (Luminex, Austin, TX, USA). The system is equipped with two lasers and detects three different fluorescences, two from the bead
itself and one from fluorescent labeled targets captured on the bead surfaces. The SNP typing method using single base extension reactions and this color-coded bead system is illustrated in Fig. 1. After a PCR amplification of the genomic regions including SNP sites, single base extension reactions from specific primers for SNPs sites were performed on the PCR products in the presence of one ddNTP-biotin conjugate and three other ddNTPs. A specific primer was composed of a complementary sequence of a 5’ side of a SNP site and an indextag sequence unique to the combination of each site and the species ddNTP-biotin conjugate. In Fig. 1, a single base extension reaction with a ddATP-biotin is illustrated as an example. Biotin is incorporated with a specific primer only in the T SNP site, and not with the other base species at the SNP site. In other reaction tubes, single base reactions with other ddNTP-biotin conjugates were also performed with specific primers having different tag sequences (not in Fig. m
PCR amplification
SBE using
ddNTP- biotin ,,A
Hybridization with tag DNA on beads
2:/i ‘I
Fluorescence detection using fluoro-cytometer
I \‘\‘
FIG. 1. Outline of SNPs detection beads and a fluoro-cytometer.
* Corresponding author. e-mail: [email protected] phone: +81-(0)42-323-l 111 fax: +81-(0)42-327-7833 368
method using color-coded
NOTES
VOL. 94.2002
1). Then, all SBE products were mixed with color-coded beads conjugated with tag DNAs complementary to corresponding index-tag sequences. Before staining the products, the beads were washed using the centrifuge to remove excess ddNTP-biotin and other reagents. Then, the products on the beads were mixed with streptavidin-phycoerythrin conjugate. After incubation for staining, the bead mixture was analyzed using fluoro-cytometer. By identifying a bead and its fluorescence intensity on the surface, the SNP types were specified. The method using single base extension reactions and color-coded beads was first reported by Chen et al. (1 l), and the illustrated method was reported by Ye et al. (13). Although this method is powerful, it is rather laborintensive and time-consuming for clinical and diagnosis applications. The bead-washing procedure to remove ddNTP-biotin before staining them with dye seemed not to be necessary. But without the bead-washing procedure, fluorescence intensity greatly decreased by about one-twenty fifths times to nearly equal the background fluorescence intensity. Because the bead-washing procedure gave sufficient signals for detection, the amount of single base extension products captured on the beads must have been enough. The problem was likely to be caused by excess free ddNTP-biotin conjugate. Probably, the streptavidin-phycoerythrin conjugates were captured by free ddNTP-biotin conjugates and not enough was left for staining the products captured on beads. Adding more streptavidin-phycoerythrin conjugates would induce adsorption to the channel of the fluoro-cytometer. Thus, we tried to decrease the amount of ddNTP-biotin conjugate in the reaction mixture to reduce losing the streptavidin-phycoerythrin conjugates. The relation between the amount of ddNTP-biotin conjugate and observed fluorescent intensity on the fluoro-cytometer without the bead-washing procedure was investigated using two DNA polymerases, Tuq polymerase and Therm0 Sequenase (Amersham Pharmacia Biotech, Buckinghamshire, UK). The results are shown in Fig. 2. For both
5 0.6 .E s = 0.6 k? z :: z 0.4 s iF
"0
2
4
6
ddATP-biotin
6
10
(pmcal)
FIG 2. Fluorescent measurements of SBE products without washing beads. SBE reactions were performed against T SNP site, and ddATP-biotin conjugates were incorporated. Products on beads were stained with 1 pmol streptavidin-PE. Therm0 Sequenase (circles) and Taq DNA polymerase (squares) were used.
369
the DNA polymerase, the fluorescence intensity reached its maximum when the ddNTP-biotion was 1 pmol and when the amount of streptavidin-phycoerythrin conjugate was kept to 1 pmol. In other words, the maximum signal was observed when the ratio of ddNTP-biotion and streptavidinphycoerythrin was 1: 1. We interpreted this phenomenon as showing that as the amount of ddNTP-biotin increased, the amount of single base extension products increased, and thus the fluorescence intensity increased. But when the amount of free ddNTP-biotin increased more than the amount of streptavidin-phycoerythrin, not enough streptavidin-phycoerythrin remained to stain the products. The difference between two polymerases reflected the efficiency of incorporating ddNTP-biotin conjugates. To obtain the highest fluorescence intensity, we chose Therm0 Sequenase as a DNA polymerase and set the ratio of the total number of the ddNTP-biotin and streptavidin-phycoerythrin conjugates in the hybridization mixture to 1: 1. In this condition, the bead-washing process could be omitted. Next, we reduced the total assay time for clinical and diagnostic usage by optimizing each step. To minimize the reaction time for a single base extension, a capillary thermal cycler (Light Cycler; Roche, Basel, Switzerland) was used. The capillary thermal cycler reduced the reaction time by about one-sixths, from 150 to 25 min without any decrease in the quality of the data. The total reaction time was also reduced. And, we minimized the time needed for the hybridization and staining procedures. As for convention, these processes were done without shaking and took about 1 h each. To reduce the time, a temperature controlled tube shaker was used and the time dependency of these processes was tested. For the hybridization, the fluorescence intensity reached a plateau in 1 min, and for the staining, the fluorescence intensity reached a plateau in 5 min. The reaction times were reduced by about one-sixtieths and one-twelfths, respectively. As a consequence of the above modifications, a rapid SNP typing method without a centrifuge was developed. The total time for the typing was reduced to about 30 min after PCR amplification of genomic region of SNP. For the single base extension reaction, a 5-pl reaction mixture contained 0.3 ng of each PCR product, 2 units of Therm0 Sequenase, 1 pl of a 5x reaction buffer, 0.5 pl of one of the four 5 uM ddNTP-biotins (NEN, Boston, MA, USA), 0.5 pl each of the other three 5 pM ddNTP (Amersham Pharmacia Biotech), and 0.5 pmol of each specific primer. The specific primers with index-tag sequences were designed as described in the work by Chen et al. (11). The reactions were carried out on a Light Cycler (Roche) for 35 cycles at 94°C for 10 s, 55’C for 10 s, and 72°C for 5 s. Tag DNA conjugated color-coded beads were prepared as follows. 2.5 x lo5 of multi-analyte carboxylated microspheres (Luminex), 50 pl of 2-morpholinoethanesulfonicacid (MES) buffer, 0.2 pl of 1 mM oligonucleotide with 3’-thiol modification and 0.5 pl of 10 mg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) were mixed. After incubating at room temperature for 30 min, 0.5 ul of 10 mg/ml EDC was added and incubated again. Beads were washed using 0.02% Tween 20 and 0.1% SDS sequentially and then dispersed in 50 pl of 0.1 mM MES buffer. For hybridizing single base
370
FUJIMURA ET AL.
J. BIOSCI.BIOENG.,
were selected to cover all four patterns of ddNTP-biotin incorporation for the demonstration. The specific primers for single base extension reactions used in this experiment are listed in Table 1. The results are shown in Fig. 3. For each SNP site, only a signal from a specific ddNTP-biotin was significantly large while the signals &om the three other ddNTP-biotins were almost negligible. The SNP multiplex typing was clearly successful. REFERENCES 1. Wang, D. G., Fan, J.B., Siao, C. J., Berno, A., Young, P.,
Sapoisky, R., Ghandour, G., Perkins, N., Winchester, E., Spencer, J., et al.: Large-scale identification, mapping, and
genotypingof single-nucleotidepolymorphismsin the human genome. Science, 280, 1077-1082 (1998). SKOlS(T) 20766(C) HAN2O(G)
VET7(A)
SNP Sites
FIG. 3. SNP typing with optimized procedure against 4 sites. They are all sites in exon 6 region of p53 and T, C, G, or A represents its genotype. For all cases of homo patterns, selectivity of base was high enough for SNP typing. TABLE 1. Sequences of specific primers for 4 SNP sites in exon 6 of p53 SNPs site
Primer seqences (5'~3')
For ddATP-biotinincorporation SK019 20766
TACATATCACMCGTGCGTGGAGGCTCATAGGGCACCACCACACT TTATGGTGATCAGTCAACCACCAGGTTCATCCAAATACTCCACACG
Han20
CACMGGAGGTCAGACCAGATTGAACCACTCGGATAAGATGCTGA
Vet1 GCTCACMTMTTGCATGAGTTGCCCTCATAGGGCACCACCACAC For ddGTP-biotinincorporation SK019
CCTCATGTCMCGMGMCAGAACCTCATAGGGCACCACCACACT
20766 Han20
AGACACCTTATGTTCTATACATGCCGTCATCCAAATACTCCACACG
GCCACAGATMTATTCACATCGTGTCCACTCGGATMGATGCTGA Vet7 CMCATCATCACGCAGAGCATCATTCTCATAGGGCACCACCACAC For ddCTP-biotinincorporation SK019 ATTGAAGCCTGCCGTCGGAGACTMTCATAGGGCACCACCACACT 20766 TCCATGCGCTTGCTCTTCATCTAGCGTCATCCAAATACTCCACACG Han20 ACACATACGATTCTGCGMCTTCAACCACTCGGATMGATGCTGA Vet7 GCATCAGCTMCTCCTTCGTGTATTCTCATAGGGCACCACCACAC For ddTTP-biotinincorporation SK019 AGACTGCGTGTTGGCTCTGTCACAGTCATAGGGCACCACCACACT 20766
GCCTTACATACATCTGTCGGTTGTAGTCATCCAAATACTCCACACG
Han20 Vet7
ACATCMTGTCTCTGACCGTTCCGCCTCATAGGGCACCACCACAC
TTACAGGATGTGCTCMCAGACGTTCCACTCGGATAAGATGCTGA
extension products and tagging DNA on beads, 10 ~1 of a hybridization reaction mixture containing 2 ~1 of single base extension reaction products, 1000 each of corresponding tagDNA-conjugated color-coded beads, 5 ~1 of 0.1% SDS-5 M tetramethylammonium chloride (TMAC)-3 mM EDTA-75 mM Tris-HCI buffer was denatured at 94°C for 1 min and hybridized at .55’C!for another minute. For staining the incorporated ddNTP-biotin, 0.5 ~1 of a I-mg/ml streptavidinphycoerythrin conjugate was added and incubated at room temperature for 5 min. The ratio of the total number of ddNTP-biotin and streptavidin-phycoerythrin was 1: 1. This solution was analyzed using Luminex 100. Through this optimized procedure, SNP genotypings of four SNPs in exon 6 of ~53 were performed. These sites
2. Lindblad-Toh, K., Winchester, E., Daly, M. J., Wang,
D. G., Hirschhorn, J. N., Laviolette, J. P., ArdIie, K., Reich, D. E., Robinson, E., SkIar, P., et al.: Large-scale discovery and genotyping of single-nucleotide polymorphisms in the mouse. Nat. Genet., 24,381-386 (2000). 3. Whitcombe, D., Brownie, J., GiIIard, FLL., McKechnie, D., Theaker, J., Newton, C. R, and Little, S.: A homogeneous fluorescence assay for PCR amplicons: its application to real-time, single-tube genotyping. Clin. Chem., 44, 918-923 (1998). 4. Lyamichev, V., Mast, A. L., Hall, J. G., Prudent, J. R,
Kaiser, M. W., Takova, T., Kwiatkowski, R W., Sander, T. J., Arrunda, M., Arco, D. A., et al.: Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes. Nat. Biotechnol..
17,292-296 (i999).
-
5. ‘@agi, S., Brau, D. P., and Krammer, F. R: Multicolor molecular beacons for allele discrimination. Nat. Biotechnol..
16,49-53 (1998). 6. See, D., Kanazin, V., Talbert, II., and Blake, T.: Electrophoretic detection of single-nucleotide polymorphisms. Biotechniques, 28,710-716 (2000). 7. Sauer, S., Lechner, D., Berlin, K., Lehrach, H., Escary, J. L., Fox, N., and Gut, I. G.: A novel procedure for efflcient genotyping of single nucleotide polymorphisms. Nucleic Acids Res., 28, El3 (2000). 8. Nyren, P., Karamohamed, S., and Ronaghi, M.: Detection of single-base changes using a bioluminometric primer extension assay. Anal. Biochem., 244,367-373 (1997). 9. Zhou, G., Kamahori, M., Okanq, K., Chuan, G., Harada, K., and Kambara, II.: Quantitative detection of single nucleotide polymorphisms for a pooled sample by a bioluminometric assay coupled with modified primer extension reactions (BAMPER). Nucleic Acids Res., 29, E93 (2001). 10. Fan, J. B., Chen, X., Halushka, M. K., Beruo, A., Haung,
X., Ryder, T., Lipshutz, R J., Lockhart, D. J., and Chakravarti, A.: Parallel genotyping of human SNPs using generic high-density oligonucleotide Res., 10,853-860 (2000).
tag arrays.
Genome
11. Chen J., Iannone, M. A., Li, M. S., Taylor, J. D., Rivers, P.,
Nelson, A. J., Slentz-Kesler, K. A., Roses, A., and Weiner, M. P.: A microsphere-based assay for multiplexed single nucleotide polymorphism analysis using single base chain extension. Genome Res., 10, 549-557 (2000). 12. Iannone, M. A., Taylor, J. D., Chen, J., Li, M. S., Rivers,
P., Slentz-Kesler, K. A., and Weiner, M. P.: Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry. Cytometry, 39, 131-140 (2000). 13. Ye, E, Li, M. S., Taylor, J. D., Nguyen, Q., Colton, H. M., Casey, W. M., Wagner, M., Weiner, M. P., and Chen, J.: Fluorescent microsphere-based readout technology for multiplex human single nucleotide polymorphism analysis and bacterial identification. Hum. Mutat., 17, 305-316 (2001).
Rapid Multiplex Single Nucleotide Polymorphism Genotyping Based on Single Base Extension Reactions and Color-Coded Beads NAOKO FUJIMURA,‘,* YOSHINOBU KOHAJXA,‘,**KAZUNORI OKANO,* MASAFUMI YOHDA,’ ANDHIDEKI KAMBARA’ Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-l 6 Nakacho, Koganei, Tokyo 184-0012, Japan’ and Hitachi Ltd., Central Research Laboratory, I-280 Higashi-Koigakubo, Kokubunji, Tokyo 185-8601, Japan’ Received 20 June 2002/Accepted 30 August 2002
A Single nucleotide polymorphism (SNP) typing method using color-coded beads is promising because it is easy to use and inexpensive. However, the present protocols are not suitable for clinical and diagnostic applications because they need centrifugation for bead-washing. Here, we developed a simplified protocol without a bead-washing procedure that enables SNP typing of PCR amplified fragments in only 30 min. [Key words: SNF’genotyping, color-coded beads, single base extension, DNA diagnosis] Huge amounts of mutation and polymorphism data have been accumulated through genome projects of humans and other biologically important species (1, 2). Single nucleotide polymorphisms (SNPs) are the most frequent polymorphism found. They are expected to be diagnosis markers for a number of diseases and drug responses. Many SNP typing methods, including the TaqMan assay (3), Invader assay (4), molecular beacon (5), PCR and electrophoresis (6), mass spectrometry (7), pyro-sequencing (S), bioluminometric assay coupled with modified primer extension reactions (BAMPER) (9), DNA chip (lo), and bead technology (1 l-l 3), have been developed. For a clinical and diagnostic SNP analysis, a rapid, easyto-use, and inexpensive SNP typing method should be selected. In addition, it should be suitable for automation. Thus, labor-intensive methods would no longer be used for such purposes. Among the SNP typing methods listed above, methods based on color-coded beads are ideal for bedside SNP typing because they enable easy-to-use and inexpensive multiplex typing. However, the present protocols require bead-washing procedures using a centrifuge, which is not suitable for rapid and automated SNP detection. Moreover, it takes 5 h to perform one assay form PCR amplified DNA fragment, which is too long for a bedside diagnosis. In our study, we developed a rapid and simplified SNP typing method using single base extension (SBE) reactions and color-coded beads. The beads are microspheres with two fluorescent dyes and are incorporated in different amounts to indicate the bead codes. After mixing the probeconjugated beads and the sample, the mixture was analyzed in the fluoro-cytometer, Luminex 100 system (Luminex, Austin, TX, USA). The system is equipped with two lasers and detects three different fluorescences, two from the bead
itself and one from fluorescent labeled targets captured on the bead surfaces. The SNP typing method using single base extension reactions and this color-coded bead system is illustrated in Fig. 1. After a PCR amplification of the genomic regions including SNP sites, single base extension reactions from specific primers for SNPs sites were performed on the PCR products in the presence of one ddNTP-biotin conjugate and three other ddNTPs. A specific primer was composed of a complementary sequence of a 5’ side of a SNP site and an indextag sequence unique to the combination of each site and the species ddNTP-biotin conjugate. In Fig. 1, a single base extension reaction with a ddATP-biotin is illustrated as an example. Biotin is incorporated with a specific primer only in the T SNP site, and not with the other base species at the SNP site. In other reaction tubes, single base reactions with other ddNTP-biotin conjugates were also performed with specific primers having different tag sequences (not in Fig. m
PCR amplification
SBE using
ddNTP- biotin ,,A
Hybridization with tag DNA on beads
2:/i ‘I
Fluorescence detection using fluoro-cytometer
I \‘\‘
FIG. 1. Outline of SNPs detection beads and a fluoro-cytometer.
* Corresponding author. e-mail: [email protected] phone: +81-(0)42-323-l 111 fax: +81-(0)42-327-7833 368
method using color-coded
NOTES
VOL. 94.2002
1). Then, all SBE products were mixed with color-coded beads conjugated with tag DNAs complementary to corresponding index-tag sequences. Before staining the products, the beads were washed using the centrifuge to remove excess ddNTP-biotin and other reagents. Then, the products on the beads were mixed with streptavidin-phycoerythrin conjugate. After incubation for staining, the bead mixture was analyzed using fluoro-cytometer. By identifying a bead and its fluorescence intensity on the surface, the SNP types were specified. The method using single base extension reactions and color-coded beads was first reported by Chen et al. (1 l), and the illustrated method was reported by Ye et al. (13). Although this method is powerful, it is rather laborintensive and time-consuming for clinical and diagnosis applications. The bead-washing procedure to remove ddNTP-biotin before staining them with dye seemed not to be necessary. But without the bead-washing procedure, fluorescence intensity greatly decreased by about one-twenty fifths times to nearly equal the background fluorescence intensity. Because the bead-washing procedure gave sufficient signals for detection, the amount of single base extension products captured on the beads must have been enough. The problem was likely to be caused by excess free ddNTP-biotin conjugate. Probably, the streptavidin-phycoerythrin conjugates were captured by free ddNTP-biotin conjugates and not enough was left for staining the products captured on beads. Adding more streptavidin-phycoerythrin conjugates would induce adsorption to the channel of the fluoro-cytometer. Thus, we tried to decrease the amount of ddNTP-biotin conjugate in the reaction mixture to reduce losing the streptavidin-phycoerythrin conjugates. The relation between the amount of ddNTP-biotin conjugate and observed fluorescent intensity on the fluoro-cytometer without the bead-washing procedure was investigated using two DNA polymerases, Tuq polymerase and Therm0 Sequenase (Amersham Pharmacia Biotech, Buckinghamshire, UK). The results are shown in Fig. 2. For both
5 0.6 .E s = 0.6 k? z :: z 0.4 s iF
"0
2
4
6
ddATP-biotin
6
10
(pmcal)
FIG 2. Fluorescent measurements of SBE products without washing beads. SBE reactions were performed against T SNP site, and ddATP-biotin conjugates were incorporated. Products on beads were stained with 1 pmol streptavidin-PE. Therm0 Sequenase (circles) and Taq DNA polymerase (squares) were used.
369
the DNA polymerase, the fluorescence intensity reached its maximum when the ddNTP-biotion was 1 pmol and when the amount of streptavidin-phycoerythrin conjugate was kept to 1 pmol. In other words, the maximum signal was observed when the ratio of ddNTP-biotion and streptavidinphycoerythrin was 1: 1. We interpreted this phenomenon as showing that as the amount of ddNTP-biotin increased, the amount of single base extension products increased, and thus the fluorescence intensity increased. But when the amount of free ddNTP-biotin increased more than the amount of streptavidin-phycoerythrin, not enough streptavidin-phycoerythrin remained to stain the products. The difference between two polymerases reflected the efficiency of incorporating ddNTP-biotin conjugates. To obtain the highest fluorescence intensity, we chose Therm0 Sequenase as a DNA polymerase and set the ratio of the total number of the ddNTP-biotin and streptavidin-phycoerythrin conjugates in the hybridization mixture to 1: 1. In this condition, the bead-washing process could be omitted. Next, we reduced the total assay time for clinical and diagnostic usage by optimizing each step. To minimize the reaction time for a single base extension, a capillary thermal cycler (Light Cycler; Roche, Basel, Switzerland) was used. The capillary thermal cycler reduced the reaction time by about one-sixths, from 150 to 25 min without any decrease in the quality of the data. The total reaction time was also reduced. And, we minimized the time needed for the hybridization and staining procedures. As for convention, these processes were done without shaking and took about 1 h each. To reduce the time, a temperature controlled tube shaker was used and the time dependency of these processes was tested. For the hybridization, the fluorescence intensity reached a plateau in 1 min, and for the staining, the fluorescence intensity reached a plateau in 5 min. The reaction times were reduced by about one-sixtieths and one-twelfths, respectively. As a consequence of the above modifications, a rapid SNP typing method without a centrifuge was developed. The total time for the typing was reduced to about 30 min after PCR amplification of genomic region of SNP. For the single base extension reaction, a 5-pl reaction mixture contained 0.3 ng of each PCR product, 2 units of Therm0 Sequenase, 1 pl of a 5x reaction buffer, 0.5 pl of one of the four 5 uM ddNTP-biotins (NEN, Boston, MA, USA), 0.5 pl each of the other three 5 pM ddNTP (Amersham Pharmacia Biotech), and 0.5 pmol of each specific primer. The specific primers with index-tag sequences were designed as described in the work by Chen et al. (11). The reactions were carried out on a Light Cycler (Roche) for 35 cycles at 94°C for 10 s, 55’C for 10 s, and 72°C for 5 s. Tag DNA conjugated color-coded beads were prepared as follows. 2.5 x lo5 of multi-analyte carboxylated microspheres (Luminex), 50 pl of 2-morpholinoethanesulfonicacid (MES) buffer, 0.2 pl of 1 mM oligonucleotide with 3’-thiol modification and 0.5 pl of 10 mg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) were mixed. After incubating at room temperature for 30 min, 0.5 ul of 10 mg/ml EDC was added and incubated again. Beads were washed using 0.02% Tween 20 and 0.1% SDS sequentially and then dispersed in 50 pl of 0.1 mM MES buffer. For hybridizing single base
370
FUJIMURA ET AL.
J. BIOSCI.BIOENG.,
were selected to cover all four patterns of ddNTP-biotin incorporation for the demonstration. The specific primers for single base extension reactions used in this experiment are listed in Table 1. The results are shown in Fig. 3. For each SNP site, only a signal from a specific ddNTP-biotin was significantly large while the signals &om the three other ddNTP-biotins were almost negligible. The SNP multiplex typing was clearly successful. REFERENCES 1. Wang, D. G., Fan, J.B., Siao, C. J., Berno, A., Young, P.,
Sapoisky, R., Ghandour, G., Perkins, N., Winchester, E., Spencer, J., et al.: Large-scale identification, mapping, and
genotypingof single-nucleotidepolymorphismsin the human genome. Science, 280, 1077-1082 (1998). SKOlS(T) 20766(C) HAN2O(G)
VET7(A)
SNP Sites
FIG. 3. SNP typing with optimized procedure against 4 sites. They are all sites in exon 6 region of p53 and T, C, G, or A represents its genotype. For all cases of homo patterns, selectivity of base was high enough for SNP typing. TABLE 1. Sequences of specific primers for 4 SNP sites in exon 6 of p53 SNPs site
Primer seqences (5'~3')
For ddATP-biotinincorporation SK019 20766
TACATATCACMCGTGCGTGGAGGCTCATAGGGCACCACCACACT TTATGGTGATCAGTCAACCACCAGGTTCATCCAAATACTCCACACG
Han20
CACMGGAGGTCAGACCAGATTGAACCACTCGGATAAGATGCTGA
Vet1 GCTCACMTMTTGCATGAGTTGCCCTCATAGGGCACCACCACAC For ddGTP-biotinincorporation SK019
CCTCATGTCMCGMGMCAGAACCTCATAGGGCACCACCACACT
20766 Han20
AGACACCTTATGTTCTATACATGCCGTCATCCAAATACTCCACACG
GCCACAGATMTATTCACATCGTGTCCACTCGGATMGATGCTGA Vet7 CMCATCATCACGCAGAGCATCATTCTCATAGGGCACCACCACAC For ddCTP-biotinincorporation SK019 ATTGAAGCCTGCCGTCGGAGACTMTCATAGGGCACCACCACACT 20766 TCCATGCGCTTGCTCTTCATCTAGCGTCATCCAAATACTCCACACG Han20 ACACATACGATTCTGCGMCTTCAACCACTCGGATMGATGCTGA Vet7 GCATCAGCTMCTCCTTCGTGTATTCTCATAGGGCACCACCACAC For ddTTP-biotinincorporation SK019 AGACTGCGTGTTGGCTCTGTCACAGTCATAGGGCACCACCACACT 20766
GCCTTACATACATCTGTCGGTTGTAGTCATCCAAATACTCCACACG
Han20 Vet7
ACATCMTGTCTCTGACCGTTCCGCCTCATAGGGCACCACCACAC
TTACAGGATGTGCTCMCAGACGTTCCACTCGGATAAGATGCTGA
extension products and tagging DNA on beads, 10 ~1 of a hybridization reaction mixture containing 2 ~1 of single base extension reaction products, 1000 each of corresponding tagDNA-conjugated color-coded beads, 5 ~1 of 0.1% SDS-5 M tetramethylammonium chloride (TMAC)-3 mM EDTA-75 mM Tris-HCI buffer was denatured at 94°C for 1 min and hybridized at .55’C!for another minute. For staining the incorporated ddNTP-biotin, 0.5 ~1 of a I-mg/ml streptavidinphycoerythrin conjugate was added and incubated at room temperature for 5 min. The ratio of the total number of ddNTP-biotin and streptavidin-phycoerythrin was 1: 1. This solution was analyzed using Luminex 100. Through this optimized procedure, SNP genotypings of four SNPs in exon 6 of ~53 were performed. These sites
2. Lindblad-Toh, K., Winchester, E., Daly, M. J., Wang,
D. G., Hirschhorn, J. N., Laviolette, J. P., ArdIie, K., Reich, D. E., Robinson, E., SkIar, P., et al.: Large-scale discovery and genotyping of single-nucleotide polymorphisms in the mouse. Nat. Genet., 24,381-386 (2000). 3. Whitcombe, D., Brownie, J., GiIIard, FLL., McKechnie, D., Theaker, J., Newton, C. R, and Little, S.: A homogeneous fluorescence assay for PCR amplicons: its application to real-time, single-tube genotyping. Clin. Chem., 44, 918-923 (1998). 4. Lyamichev, V., Mast, A. L., Hall, J. G., Prudent, J. R,
Kaiser, M. W., Takova, T., Kwiatkowski, R W., Sander, T. J., Arrunda, M., Arco, D. A., et al.: Polymorphism identification and quantitative detection of genomic DNA by invasive cleavage of oligonucleotide probes. Nat. Biotechnol..
17,292-296 (i999).
-
5. ‘@agi, S., Brau, D. P., and Krammer, F. R: Multicolor molecular beacons for allele discrimination. Nat. Biotechnol..
16,49-53 (1998). 6. See, D., Kanazin, V., Talbert, II., and Blake, T.: Electrophoretic detection of single-nucleotide polymorphisms. Biotechniques, 28,710-716 (2000). 7. Sauer, S., Lechner, D., Berlin, K., Lehrach, H., Escary, J. L., Fox, N., and Gut, I. G.: A novel procedure for efflcient genotyping of single nucleotide polymorphisms. Nucleic Acids Res., 28, El3 (2000). 8. Nyren, P., Karamohamed, S., and Ronaghi, M.: Detection of single-base changes using a bioluminometric primer extension assay. Anal. Biochem., 244,367-373 (1997). 9. Zhou, G., Kamahori, M., Okanq, K., Chuan, G., Harada, K., and Kambara, II.: Quantitative detection of single nucleotide polymorphisms for a pooled sample by a bioluminometric assay coupled with modified primer extension reactions (BAMPER). Nucleic Acids Res., 29, E93 (2001). 10. Fan, J. B., Chen, X., Halushka, M. K., Beruo, A., Haung,
X., Ryder, T., Lipshutz, R J., Lockhart, D. J., and Chakravarti, A.: Parallel genotyping of human SNPs using generic high-density oligonucleotide Res., 10,853-860 (2000).
tag arrays.
Genome
11. Chen J., Iannone, M. A., Li, M. S., Taylor, J. D., Rivers, P.,
Nelson, A. J., Slentz-Kesler, K. A., Roses, A., and Weiner, M. P.: A microsphere-based assay for multiplexed single nucleotide polymorphism analysis using single base chain extension. Genome Res., 10, 549-557 (2000). 12. Iannone, M. A., Taylor, J. D., Chen, J., Li, M. S., Rivers,
P., Slentz-Kesler, K. A., and Weiner, M. P.: Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry. Cytometry, 39, 131-140 (2000). 13. Ye, E, Li, M. S., Taylor, J. D., Nguyen, Q., Colton, H. M., Casey, W. M., Wagner, M., Weiner, M. P., and Chen, J.: Fluorescent microsphere-based readout technology for multiplex human single nucleotide polymorphism analysis and bacterial identification. Hum. Mutat., 17, 305-316 (2001).