Rapid PCR detection of Salmonella in horse faecal samples

Veterinary Microbiology 79 (2001) 63±74

Rapid PCR detection of Salmonella in horse faecal samples P. Amavisit, G.F. Browning, D. Lightfoot, S. Church, G.A. Anderson, K.G. Whithear, P.F. Markham* Faculty of Veterinary Science, The University of Melbourne, Parkville, Vic. 3010, Australia Received 24 February 2000; accepted 12 September 2000

Abstract A rapid polymerase chain reaction (PCR) assay was developed for detecting Salmonella in faeces of horses and assessed on samples from horses admitted to a veterinary hospital. Direct detection was achieved by ampli®cation of part of ompC after extraction of DNA from faeces using a spin column method to reduce the amount of inhibitory substances in samples. An internal positive control was included to detect false negative results. While the sensitivity of the PCR assay was less than culture when assessed on faeces inoculated with Salmonella, its sensitivity on faecal samples obtained from horses was much greater than culture. Salmonella DNA was detected in 40% of faecal samples using the PCR assay while Salmonella were cultured from only 2% of the samples. The PCR assay has potential for use in either routine diagnosis or for detection of the carrier status in animals. # 2001 Elsevier Science B.V. All rights reserved. Keywords: DNA extraction; Salmonella sp.; Horse; Faeces; Internal positive control

1. Introduction Most Salmonella serovars are potential pathogens and isolation from clinical specimens is time consuming. The rapid detection of members of this genus is particularly useful in both public and animal health. In horses, salmonellosis can cause asymptomatic infection or serious clinical disease. Equine salmonellosis outbreaks occur from time to time, especially in places where many horses are brought together, such as veterinary hospitals and large studs (Powell et al., 1988; Pare et al., 1996; Tillotson et al., *

Corresponding author. Tel.: ‡61-3-83447368; fax: ‡61-3-83447374. E-mail address: [email protected] (P.F. Markham). 0378-1135/01/$ ± see front matter # 2001 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 1 3 5 ( 0 0 ) 0 0 3 4 0 - 0

64

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

1997). A major problem in controlling outbreaks is identifying animals when they become infected. Bacterial culture of faecal samples from carriers or subclinically infected horses may be negative because of dilution of the organism, loss of viability during transportation and storage of samples, treatment of the animals with antimicrobials, or because the organism is shed intermittently (Carter et al., 1986; Hird et al., 1986a,b; Tillotson et al., 1997). To properly screen for infected horses, frequent sample collection and the more sensitive identi®cation methods are needed. PCR is an extremely sensitive test, able to amplify picogram quantities of DNA. The target gene chosen for detection of Salmonella in this study was ompC. The ompC gene encodes an outer membrane protein which is one of the major structural proteins of Salmonella. Although the PCR assay is sensitive, it may be susceptible to false negative results when applied to clinical samples. This may be due to a variety of inhibitory substances such as bilirubin and chelating agents (Widjojoatmodjo et al., 1992). To overcome the problem of false negative reactions, several approaches have been used including extraction of DNA from clinical samples (Wilde et al., 1990; Widjojoatmodjo et al., 1992; Kongmuang et al., 1994) and the inclusion of an internal positive control (IPC) (Chadwick et al., 1998; Garcia et al., 1998). Extraction methods using lysozyme, proteinase K and phenol±chloroform±isoamyl alcohol are time consuming, whilst methods using silica beads or glass particles to bind with DNA are more rapid (Boom et al., 1990). A commercial DNA extraction kit using a silica matrix combined with a spin column method was used in this study. The aim of this study was to develop rapid extraction methods and a PCR assay to amplify a region of Salmonella ompC gene directly from horse faecal samples. An IPC was incorporated to enable detection of false negative results and the sensitivity of the assay was then assessed in faecal samples that had been inoculated with Salmonella and also in faecal samples from horses admitted to a veterinary hospital. 2. Materials and methods 2.1. Sample preparation Faecal samples were collected from horses entering a veterinary hospital at the time of admission and approximately every 3 days afterwards. Each sample was processed for both PCR and culture on the day it was received. For microbiological testing horse faeces was plated directly onto XLD and MacConkey agar and also enriched by inoculation into selenite broth prior to plating (Quinn et al., 1994). All non-lactose fermenting colonies isolated on MacConkey agar were tested biochemically using triple sugar iron agar, urea, indole and mannitol fermentation tests and serotyped using somatic and ¯agella antisera. Samples were prepared for PCR using two different procedures, A and B. For procedure A, 1 g of fresh horse faeces was diluted in 10 ml of sterile distilled H2O and centrifuged at 1000g for 3 min and a 1 ml sample of supernatant boiled for 3 min and stored at ÿ208C for DNA extraction at the same time as procedure B. For procedure B, 1 g of the faeces was incubated in 10 ml of selenite broth at 378C for 18 h, a 1 ml sample

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

65

was centrifuged as described above and supernatant was removed, boiled for 3 min and subjected to the DNA extraction process. 2.2. Extraction of DNA from faeces The DNA from faecal samples prepared from procedures A and B was extracted using a multi-spin column method (Sykes et al., 1998). The multi-spin method was optimised before testing clinical samples by using different volumes of faecal samples at 0.5, 1, 1.5 and 2 g and repeating the washing step. Brie¯y, a 50 ml sample was mixed vigorously with 450 ml of buffer RLT (Qiagen, Hilden, Germany) containing 1% 2-mercaptoethanol and then centrifuged at 2000g for 3 min. A 300 ml volume of the lysate supernatant was gently mixed with 300 ml of 70% ethanol and 15 ml of Qiaex II silica beads (Qiagen). The mixture was added to a multi-spin column (Axygen, Union City, CA) and incubated at room temperature for 5 min. The column was placed into a 2 ml microfuge tube and centrifuged at 10 000g for 30 s. After discarding the ¯ow-through, the column containing the Qiaex beads was washed once by adding 500 ml of buffer RLT followed by 5 min incubation and then centrifugation at 10 000g for 30 s. The washing step was repeated twice with 500 ml of buffer RPE (Qiagen). The ®nal washing step was followed by centrifugation for 1.5 min at 16 000g to dry the column. Bound DNA was eluted by adding 30 ml of sterile distilled H2O and incubating for 5 min at room temperature followed by centrifugation for 1 min at 10 000g. A 5 ml sample of eluted DNA was used as template for PCR. 2.3. Development of an internal positive control for the PCR The primer pair S18 and S19 HindIII (Table 1) were used to amplify a 159 bp sequence from the ompC gene of S. Heidelberg. Approximately 20 ng of puri®ed PCR product was ligated to the plasmid vector pGEM-T (Promega, Madison, WI) following the manufacturer's instructions and then used to transform electrocompetent Escherichia coli DH5a cells. Plasmid DNA from the transformant obtained (pC5) was digested with restriction endonuclease HindIII and ligated to a puri®ed 315 bp fragment released from a HindIII digested plasmid containing Mycoplasma synoviae DNA. The ligation mixture was used to transform E. coli DH5a. The E. coli colonies containing recombinant pC5 with a 315 bp HindIII insert (IPC plasmid) were isolated. The IPC plasmid DNA was extracted using the Midi Preparation Plasmid Puri®cation kit (Qiagen) (Fig. 1) and yielded a 474 bp fragment (159 ‡ 315 bp) after ampli®cation. Table 1 Sequence and orientation of PCR oligonucleotide primers Name

Orientation sequence (50 ±30 )

S18 S19 S19HindIIIa

Forward ACCGCTAACGCTCGCCTGTAT Reverse AGAGGTGGACGGGTTGCTGCCGTT Reverse AGAGGTGGACGGGTTGCTGCCGTTAAAGCTTCCAA

a

HindIII restriction site is given in italics.

66

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

Fig. 1. Construction of an IPC. The primers S18 and S19 HindIII were used to amplify a 159 bp fragment with an internal HindIII cleavage site (H). A 319 bp HindIII fragment was ligated into the HindIII site to produce a 474 bp product when ampli®ed using primers S18 and S19.

2.4. DNA ampli®cation The oligonucleotide primers S18 and S19 (Table 1) were based on the DNA sequence of the ompC of Salmonella sp. and were ®rst described by Kwang et al. (1996), who showed that they could amplify product from 40 Salmonella serovars but not from 24 other bacterial species, including E. coli, K. pneumoniae, S. sonnei and P. multocida. The PCR product corresponded to base positions 1076±1234 bp of S. Typhi ompC gene (GenBank Accession Number M31424). The PCR ampli®cation was performed in 50 ml of a solution containing 11Taq DNA polymerase buffer (Roche Diagnostics, Mannheim, Germany), 1.5 mM MgCl2, 50 mM of each dNTP, 0.4 mM of each primer, 1 U of Taq DNA polymerase (Roche Diagnostics), 5 ml of the DNA template and 1±2 pg of IPC plasmid. The PCR conditions were optimised to yield clearly visible PCR products of 159 and 474 bp. The conditions for the PCR were an initial incubation at 968C for 3 min and 10 cycles of 958C for 30 s, 568C for 30 s and 728C for 15 s, followed by 25 cycles of 958C for 30 s, 568C for 30 s and 728C for 30 s, with a ®nal extension at 728C for 3 min using a Hybaid OmniGene thermocycler (Hybaid, Middlesex, UK). For samples which yielded multiple bands from either procedure A or B, the PCR was repeated using a higher annealing temperature of 598C. 2.5. Sensitivity of PCR in faecal samples Faecal samples from two horses were cultured for Salmonella and subjected to PCR and found to be negative by both methods. One gram of horse faeces was mixed with 10 ml of sterile distilled water and the mixture centrifuged at 1000g for three minutes, and 400 ml samples of the supernatant mixed with 100 ml of tenfold serial dilutions of known numbers of Salmonella cells (from 106 to 100 viable cells). The sensitivity of the PCR was determined using each of the procedures for DNA preparation described above. A 50 ml volume of the mixture was subjected to DNA extraction following procedure A and another 100 ml of the mixture was incubated in enrichment broth for 6, 12 or 18 h to optimise the incubation period and followed by DNA extraction (procedure B).

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

67

2.6. Veri®cation of identity of PCR product ampli®ed from faecal samples 2.6.1. Southern transfer The reaction products from 10 faecal samples that yielded multiple bands by PCR were examined by Southern blot hybridisation to establish whether these bands included the expected product. The PCR products were separated in a 0.8% agarose gel and capillary transferred onto positively charged nylon membrane (Hybond-N‡, Amersham Pharmacia Biotech, Buckinghamshire, England) as described by Sambrook et al. (1989). Radioactive probes were prepared using pC5 DNA labelled with ‰a-32 PŠdCTP using a random primed labelling kit (Roche Diagnostics) and puri®ed using Bio-Spin 6 chromatography columns (BioRad, Hercules, CA) following the manufacturers' instructions. The nylon membrane was incubated with prehybridisation solution (0.5 M Na2HPO4 (pH 7.2), 7% (w/v) sodium dodecyl sulphate (SDS), 1% (w/v) bovine serum albumin and 1 mM EDTA) at 558C for 4 h. The radiolabelled probe was added and hybridised overnight, the blot washed three times for 15 min each in 0.51SSC (11SSC: 150 mM NaCl, 15 mM sodium citrate), 0.1% SDS and then subjected to autoradiography. 2.6.2. DNA sequencing of the PCR product The nucleotide sequences of the PCR product obtained from three faecal samples were determined using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer Applied Biosystems, Foster City, CA) and the oligonucleotide primers S18 and S19 to encompass the entire DNA sequence of the product. The sequencing reaction was performed using 25 cycles of 968C for 30 s, 508C for 15 s and 608C for 4 min. The extension products were puri®ed, their sequences were determined using a Perkin-Elmer 373A Stretch DNA Sequencer and analysed using GeneWorks nucleic acid and protein sequence analysis software (Oxford Molecular Group). 2.7. Statistical analysis The adjusted McNemar's w2-test (Eliasziw and Donner, 1991) was used to compare the proportion of positive results and detectability (proportion of valid results) of the two sample preparation methods. A valid result excluded samples which had an inhibited PCR result. 3. Results 3.1. Sensitivity of the PCR for detection of Salmonella in faeces Using the multi-spin DNA extraction technique, the ompC PCR was able to detect 100 Salmonella organisms in 50 ml of prepared faecal solution (Fig. 2). The sensitivity of the PCR was increased by incubating the samples in selective enrichment media for 6±18 h before the multi-spin DNA extraction, with an 18 h incubation in selenite broth the most sensitive, enabling detection of 5 cfu/50 ml of the original sample.

68

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

Fig. 2. PCR sensitivity test on a 10-fold dilution series of S. Heidelberg (106±100 cells). Sizes of the 474 bp IPC PCR product and the 159 bp Salmonella ompC PCR product are indicated by arrows. The negative control is labelled negative. The molecular size standard was pUC18 digested with HaeIII (lane 1).

The multi-spin method was optimised to decrease the amount of inhibitory substances by repeating each washing step twice more and increasing the incubation time before elution to 10 min. During the development of the multi-spin method, it was also found that increasing the amount of faecal sample from 1 to 2 g in 10 ml of distilled H2O led to inhibition of the PCR. This was probably due to the increased amounts of inhibitory substances present in the larger sample volume. Use of PCR with the multi-spin extraction method on three samples while fresh and after they had been frozen established that the same results were obtained for samples kept at ÿ208C for at least 3 weeks. However, faecal samples stored for longer periods did not yield consistent results. Twelve PCR assays from either procedure A or B that yielded multiple bands were tested again by increasing annealing temperature from 56 to 598C to increase the speci®city of the PCR. However, at the higher annealing temperature the intensity of the expected PCR products were reduced. 3.2. Application of the PCR in a clinical setting As shown in Table 2, 96 faecal samples were tested, of which 66 yielded valid results with both procedures A and B (either positive or negative by PCR). Thirteen samples inhibited the assay using procedure A and 19 inhibited the assay using procedure B (2 samples inhibited the assay in both procedures). Of the 66 valid results, 21 samples were positive using both procedures, 22 samples were negative using both procedures, 9 samples were positive using procedure A only and 14 samples were positive with procedure B only. Of the 44 PCR positive samples only 2 samples were positive by culture, but all PCR negative samples were also negative by culture. The proportion of samples in which Salmonellae were detected was 38.5% (37 96) using ) using procedure B. The proportion of samples in which procedure A and 40.6% (39 96 2 ). The isolates were identi®ed as S. Salmonellae were detected using culture was 2% (96 Anatum and S. Singapore.

Table 2 PCR results from horse faecal samples using procedures A and Ba Sample date 29/9/1998 30/9/1998 16/10/1998 18/10/1998 20/10/1998 22/10/1998 19/10/1998 21/10/1998 23/10/1998 20/10/1998 22/10/1998 18/10/1998 20/10/1998 22/10/1998 21/10/1998 22/10/1998 23/10/1998 9/11/1998 11/11/1998 13/11/1998 9/11/1998 11/11/1998 13/11/1998 9/11/1998 11/11/1998 13/11/1998 9/11/1998 11/11/1998 13/11/1998 22/11/1998 25/11/1998 27/11/1998 22/11/1998 25/11/1998 23/11/1998 26/11/1998 24/11/1998 27/11/1998 30/11/1998 27/11/1998 30/11/1998 30/11/1998 3/12/1998 19/1/1999 21/1/1999 25/1/1999 27/1/1999 2/2/1999 5/2/1999 9/11/1998 11/11/1998

Nameb A1 A2 B1 B2 B3 B4 C1 C2 C3 D1 D2 E1 E2 E3 F1 F2 F3 G1 G2 G3 H1 H2 H3 I1 I2 I3 J1 J2 J3 K1 K2 K3 L1 L2 M1 M2 N1 N2 N3 O1 O2 P1 P2 Q1 Q2 Q3 Q4 Q5 Q6 R1 R2

Procedure A c

‡ ‡ IP IP ‡ ‡ ‡ IP ‡ ‡ ‡ IP IP ‡ ÿ IP ÿ ‡ ÿ ÿ ÿ ‡ ‡ ‡ ÿ ‡ ‡ ‡ IP ÿ ÿ ÿ ÿ ÿ ÿ ÿ ‡ ÿ ÿ ÿ ‡ ÿ ÿ ‡ IP ÿ IP ÿ ‡ ‡ ‡

Procedure B IPd ‡ ÿe ÿ ÿ ‡ ‡ ‡ ‡ ‡ ‡ ÿ ‡ ‡ IP ÿ ÿ ÿ ‡ ÿ ‡ ‡ ‡ ÿ ‡ ‡ ÿ ÿ ÿ IP ‡ ‡ ÿ ‡ IP ÿ IP ÿ ÿ ÿ ‡ ‡ ‡ IP ‡ IP IP ÿ IP ÿ IP

70

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

Table 2 (Continued ) Sample date

Nameb

Procedure A

Procedure B

10/11/1998 12/11/1998 10/11/1998 12/11/1998 18/11/1998 10/11/1998 12/11/1998 1011/1998 13/11/1998 18/11/1998 11/11/1998 13/11/1998 18/11/1998 21/11/1998 13/11/1998 18/11/1998 18/11/1998 21/11/1998 23/11/1998 21/11/1998 23/11/1998 26/11/1998 21/11/1998 23/11/1998 22/11/1998 25/11/1998 27/11/1998 30/11/1998 18/1/1999 20/1/1999 18/1/1999 20/1/1999 1/2/1999 3/2/1999 5/2/1999 17/2/1999 19/2/1999 22/2/1999 25/2/1999 15/3/1999 17/3/1999 19/3/1999 19/3/1999 22/3/1999 24/3/1999

S1 S2 T1 T2 T3 U1 U2 V1 V2 V3 W1 W2 W3 W4 X1 X2 Y1 Y2 Y3 Z1 Z2 Z3 AA 1 AA 2 BB 1 BB 2 BB 3 BB 4 CC 1 CC 2 DD 1 DD 2 EE 1 EE 2 EE 3 FF 1 FF 2 FF 3 FF 4 GG 1 GG 2 GG 3 HH 1 HH 2 HH 3

‡ ÿ ‡ ÿ ÿ ‡ ÿ ÿ ÿ ÿ ÿ ÿ ‡ ‡ ÿ ÿ ÿ ‡ ÿ IP ÿ ÿ IP ÿ ‡ IP ÿ ‡ ‡ ‡ ‡ ‡ ÿ ÿ ÿ ÿ ÿ ÿ IP ÿ ÿ ÿ ‡ ‡ ‡

‡ ‡ ‡ IP ÿ ‡ ‡ ‡ ÿ ÿ ‡ ÿ ÿ IP ÿ ÿ IP ‡ IP ‡ IP ‡ ÿ ÿ ‡ IP ‡ ‡ ÿ ÿ IP ‡ IP ÿ IP ÿ ÿ ÿ ÿ ÿ ÿ ÿ ‡ ‡ ‡

a

Salmonella serovars Anatum and Singapore were isolated from samples E 2 and DD 1, respectively. Letters represent individual horses and number represent consecutive samples. c PCR positive detected. d Inhibited PCR. e No PCR product detected. b

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

71

3.3. Statistical comparison of the two sample preparation methods The 66 valid results were analysed for differences between procedures A and B. The agreement between the tests was analysed and the proportion of positive results with the 35 two procedures were 30 66 and 66, respectively. The proportions of positive results were not found to be signi®cantly different (w2 adjusted ˆ 0:81, d:f: ˆ 1, P ˆ 0:37). The detectabilities of assays using the two procedures were also compared (83 96 with procedure with procedure B). The results showed there was no signi®cant difference in A and 77 96 detectability between the two procedures (w2 adjusted ˆ 1:32, d:f: ˆ 1, P ˆ 0:25). 3.4. Analysis of PCR products The autoradiograph of Southern blots washed at high stringency revealed the probe hybridised with bands of 159 and 474 bp, corresponding to the expected size of the PCR product and the IPC. In addition the PCR products from three positive faecal samples (I 2, U 1, and CC 1), and DNA from three Salmonella serovars, S. Heidelberg, S. Ohio and S. Bovismorbi®cans, were subjected to sequence analysis. The sequences of PCR products from all samples were identical to the DNA sequence of S. Typhi ompC (GenBank Accession Number M31424). 4. Discussion The results obtained from the application of PCR for detection of Salmonellae in a faecal suspension seeded with known number of organisms differed from those obtained using a series of faecal specimens collected from horses. The use of enrichment broth did not signi®cantly increase the detectability of Salmonella from faeces collected from horses carrying Salmonella but did signi®cantly increase the detection of Salmonella in faecal samples inoculated with viable Salmonellae. Selenite broth was the selective medium chosen for this study because unlike Rappaport±Vassilidis and tetrathionate media, it does not inhibit PCR (Stone et al., 1994), allowing its used for both cultural and PCR identi®cation. Selenite broth has also been widely used to investigate the shedding of Salmonella in faeces from horses (Ikeda et al., 1986; Begg et al., 1988; Powell et al., 1988; van Duijkeren et al., 1994; Parraga et al., 1997; Mainar-Jaime et al., 1998; House et al., 1999). Therefore the results of this study can be compared to results from a number of previous studies. The failure of incubation in enrichment broth to increase the sensitivity of the PCR and the small number of samples positive by microbiological culture implied that the organisms which were detected in the faeces may not have been viable or that the culture method was not sensitive enough for recovery of very low numbers of Salmonella. It may be that greater numbers of horses yield cultivable Salmonella if a more sensitive enrichment technique such as buffered peptone water is used for pre-enrichment (Waltman, 2000). Previous studies using cultural detection methods have reported that the prevalence of Salmonella shedders among horses admitted to veterinary hospitals ranges from 1.4 to 21% (Smith et al., 1978; Traub-Dargatz et al., 1990; van Duijkeren et al., 1994; Murray,

72

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

1996; House et al., 1999). Because of the limited sensitivity of culture, the prevalences of horses shedding Salmonellae have been estimated to be higher using more sensitive identi®cation methods (Smith, 1990). In a study using PCR to detect Salmonella in horse 26 ) of horses admitted to an faecal samples, Cohen et al. (1996) found that 17% (152 71 outpatient service and 65% (110) of hospitalised horses were shedding Salmonellae. The viability of the organisms shed was questioned due to the treatment of the horses with antimicrobials which may have retarded the growth of organisms in the animals and during the processing of the samples. Our study and that of Cohen et al. (1996) suggest that the proportion of horses which carry Salmonellae may be much higher than previously thought. However, these studies have not established the signi®cance of PCRpositive but culture-negative horses in contamination of the environment. In comparison to other extraction methods, the multi-spin extraction method was rapid and effective in decreasing the amount of inhibitory substances. The bene®ts of this extraction method included the use of less hazardous reagents than phenol±chloroform based methods, shorter processing times than methods using proteinase K or lysozyme and greater reliability than some more complicated methods which may be susceptible to contamination. PCR that produced unclear or multiple bands initially, may have resulted from less effective DNA puri®cation, as repetition of the extraction with longer incubations with buffer in the columns and further dilution of faecal samples decreased the number of bands. Increasing the annealing temperature to 598C also eliminated many of these bands but reduced the intensity of the PCR and the longer incubations increased the processing time. Therefore only samples which had unclear or multiple bands were tested at the higher annealing temperature with the extended extraction method. As DNA extraction can decrease the amount of inhibitory substances and selective enrichment can increase the number of viable Salmonella cells, combining both methods should be more effective in detecting Salmonella organisms. PCR is a very sensitive method for detection of bacteria, especially when they are at low concentrations or are not viable, as might be the case in samples from carrier animals without clinical signs (Rossen et al., 1991; Cohen et al., 1994, 1995). The speci®city of PCR products is always a potential area of concern so this work included a veri®cation that the DNA ampli®ed from faecal samples was from Salmonellae by sequencing PCR products. The results demonstrated its speci®city on different samples and using different procedures (A and B). This study has demonstrated the potential for a genus speci®c PCR in examining some aspects of the epidemiology of salmonellosis in horses. However, the further development of rapid and sensitive methods to detect Salmonella at the serovar level would enable more detailed epidemiological studies and more clearly show the signi®cance of culture negative carriers in the development of clinical disease.

References Begg, A.P., Johnston, K.G., Hutchins, D.R., Edwards, D.J., 1988. Some aspects of the epidemiology of equine salmonellosis. Aust. Vet. J. 65, 221±223.

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

73

Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., van der Noordaa, J., 1990. Rapid and simple method for puri®cation of nucleic acids. J. Clin. Microbiol. 28, 495±503. Carter, J.D., Hird, D.W., Farver, T.B., 1986. Salmonellosis in hospitalized horses: seasonality and case fatality rates. J. Am. Vet. Med. Assoc. 188, 163±167. Chadwick, N., Bruce, I., Davies, M., van Gemen, B., Schukkink, R., Khan, K., Pounder, R., Wake®eld, A., 1998. A sensitive and robust method for measles RNA detection. J. Virol. Meth. 70, 59±70. Cohen, N.D., Neibergs, H.L., Wallis, D.E., Simpson, R.B., McGruder, E.D., Hargis, B.M., 1994. Genus-speci®c detection of salmonellae in equine feces by use of the polymerase chain reaction. Am. J. Vet. Res. 55, 1049± 1054. Cohen, N.D., Wallis, D.E., Neibergs, H.L., Hargis, B.M., 1995. Detection of Salmonella enteritidis in equine feces using the polymerase chain reaction and genus-speci®c oligonucleotide primers. J. Vet. Diagn. Invest. 7, 219±222. Cohen, N.D., Martin, L.J., Simpson, R.B., Wallis, D.E., Neibergs, H.L., 1996. Comparison of polymerase chain reaction and microbiological culture for detection of salmonellae in equine feces and environmental samples. Am. J. Vet. Res. 57, 780±786. Eliasziw, M., Donner, A., 1991. Application of McNemar's test to non-independent matched pair data. Stat. Med. 10, 1981±1991. Garcia, L., Tercero, J.C., Legido, B., Ramos, J.A., Alemany, J., Sanz, M., 1998. Rapid detection of Actinobacillus actinomycetemcomitans, Prevotella intermedia and Porphyromonas gingivalis by multiplex PCR. J. Periodont. Res. 33, 59±64. Hird, D.W., Casebolt, D.B., Carter, J.D., Pappaioanou, M., Hjerpe, C.A., 1986a. Risk factors for salmonellosis in hospitalized horses. J. Am. Vet. Med. Assoc. 188, 173±177. Hird, D.W., Pappaioanou, M., Smith, B.P., 1986b. Case-control study of risk factors associated with isolation of Salmonella saintpaul in hospitalized horses. Am. J. Epidemiol. 120, 852±863. House, J.K., Mainar-Jaime, R.C., Smith, B.P., House, A., Kamiya, D.Y., 1999. Risk factors for nosocomial Salmonella infection among hospitalized horses. J. Am. Vet. Med. Assoc. 214, 1511±1516. Ikeda, J.S., Hirsh, D.C., Jang, S.S., Biberstein, E.L., 1986. Characteristics of salmonella isolated from animals at veterinary medical teaching hospital. Am. J. Vet. Res. 47, 232±235. Kongmuang, U., Luk, J.M.C., Lindberg, A.A., 1994. Comparison of three stool-processing methods for detection of Salmonella serogroups B, C2, and D by PCR. J. Clin. Microbiol. 32, 3072±3074. Kwang, J., Littledike, E.T., Keen, J.E., 1996. Use of the polymerase chain reaction for Salmonella detection. Lett. Appl. Microbiol. 22, 46±51. Mainar-Jaime, R.C., House, J.K., Smith, B.P., Hird, D.W., House, A.-M., Kamiya, D.Y., 1998. In¯uence of fecal shedding of Salmonella organisms on mortality in hospitalized horses. JAVMA 213, 1162±1166. Murray, M.J., 1996. Salmonellosis in horses. J. Am. Vet. Med. Assoc. 209, 558±560. Pare, J., Carpenter, T.E., Thurmond, M.C., 1996. Analysis of spatial and temporal clustering of horses with Salmonella krefeld in an intensive care unit of a veterinary hospital. J. Am. Vet. Med. Assoc. 209, 626±628. Parraga, M.E., Spier, S.J., Thurmond, M., Hirsh, D., 1997. A clinical trial of probiotic administration for prevention of Salmonella shedding in the postoperative period in horses with colic. J. Vet. Intern. Med. 11, 36±41. Powell, D.G., Donahue, M., Ferris, K., Osborne, M., Dwyer, R., 1988. An epidemiological investigation of equine salmonellosis in central Kentucky during 1985 and 1986. In: Powell, D.G. (Ed.), Equine Infectious Diseases V. Proceedings of the Fifth International Conference. University of Kentucky Press, Lexington, KY, pp. 231±235. Quinn, P.J., Carter, M.E., Marky, B.K., Carter, G.R., 1994. Clinical Veterinary Microbiology. Wolfe Publishing, London, pp. 209±236. Rossen, L., Holmstrom, K., Olsen, J.E., Rasmussen, O.F., 1991. A rapid polymerase chain reaction (PCR)-based assay for the identi®cation of Listeria monocytogenes in food samples. Int. J. Food Microbiol. 14, 145±152. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 9.34±9.35, 9.45±9.46. Smith, B.P., 1990. Salmonellosis: paranoia or reason to worry? Comp. Cont. Educ. Pract. Vet. 12, 1459±1461. Smith, B.P., Reina-Guerra, M., Hardy, A.J., 1978. Prevalence and epidemiology of equine salmonellosis. J. Am. Vet. Med. Assoc. 172, 353±356.

74

P. Amavisit et al. / Veterinary Microbiology 79 (2001) 63±74

Stone, G.G., Oberst, R.D., Hays, M.P., McVey, S., Chengappa, M.M., 1994. Detection of Salmonella serovars from clinical samples by enrichment broth cultivation-PCR procedure. J. Clin. Microbiol. 32, 1742±1749. Sykes, J.E., Studdert, V.P., Browning, G.F., 1998. Detection and strain differentiation of feline calicivirus in conjuctival swabs by RT-PCR of the hypervariable region of the capsid protein gene. Arch. Virol. 143, 1321± 1334. Tillotson, K., Savage, C.J., Salman, M.D., Gentry, W.C.R., Rice, D., Fedorka, C.P.J., Hendrickson, D.A., Jones, R.L., Nelson, W., Traub-Dargatz, J.L., 1997. Outbreak of Salmonella infantis infection in a large animal veterinary teaching hospital. J. Am. Vet. Med. Assoc. 211, 1554±1557. Traub-Dargatz, J.L., Salman, M.D., Jones, R.L., 1990. Epidemiological study of salmonellae shedding in the feces of horses and potential risk factors for development of the infection in hospitalized horses. J. Am. Vet. Med. Assoc. 196, 1617±1622. van Duijkeren, E., van Oldruitenborgh, O.M.M.S., Houwers, D.J., van Leeuwen, W.J., Kalsbeek, H.C., 1994. Equine salmonellosis in a Dutch veterinary teaching hospital. Vet. Rec. 135, 248±250. Waltman, W.D., 2000. Methods for the cultural isolation of Salmonella. In: Wray, C., Wray, A. (Eds.), Salmonella in Domestic Animals. CAB International, Oxon, pp. 355±372. Widjojoatmodjo, M.N., Fluit, A.C., Torensma, R., Verdonk, G.P.H.T., Verhoef, J., 1992. The magnetic immunopolymerase chain reaction assay for direct detection of salmonellae in fecal samples. J. Clin. Microbiol. 30, 3195±3199. Wilde, J., Eiden, J., Yolken, R., 1990. Removal of inhibitory substances from human fecal specimens for detection of group A rotaviruses by reverse transcriptase and polymerase chain reactions. J. Clin. Microbiol. 28, 1300±1307.