Rapid upregulation of the hippocampal connexins 36 and 45 mRNA levels during memory consolidation

Behavioural Brain Research 320 (2017) 85–90

Contents lists available at ScienceDirect

Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr

Research report

Rapid upregulation of the hippocampal connexins 36 and 45 mRNA levels during memory consolidation Siamak Beheshti a,∗ , Reyhaneh Zeinali a , Abolghasem Esmaeili b a b

Division of Animal Sciences, Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran Division of Cellular and Molecular Biology, Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran

h i g h l i g h t s • Gap junction channels coupling is required for cognitive processes. • Cx36 and Cx45 mRNAs upregulated in the hippocampus during memory consolidation. • Hippocampal electrical synapses are crucial for memory encoding.

a r t i c l e

i n f o

Article history: Received 5 September 2016 Received in revised form 25 November 2016 Accepted 28 November 2016 Available online 29 November 2016 Keywords: Hippocampus Memory consolidation Gap junctions Connexin Passive avoidance task

a b s t r a c t Gap junction channels are implicated in learning and memory process. However, their role on each of the particular stages of memory formation has been studied less. In this study, the time profile of the expression levels of hippocampal connexins 36 and 45 (Cx36 and Cx45) mRNAs was measured during memory consolidation, in a passive avoidance paradigm. Totally 30 adult male rats were distributed into 5 groups of each 6. At different times profiles (30 min, 3, 6 and 24 h) following training, rats were decapitated and their hippocampi were immediately removed and frozen in liquid nitrogen. Total RNA was extracted and cDNA was synthesized, using oligo-dt primers. A quantitative real-time PCR was used to measure the levels of each of Cx36 and Cx45 mRNAs. Both connexins showed a rapid upregulation (30 min) at the transcriptional level, which declined in later times and reached to the control level at 24 h. The rapid up-regulation of Cx36 and Cx45 mRNAs might be accompanied with increasing intercellular coupling via gap junction channels and neuronal oscillatory activities required for memory consolidation. The results highlight the role of gap junctional coupling between hippocampal neurons during memory consolidation in the physiological conditions. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Gap junctions are composed of intercellular channels gathered together in a gap junction plaque. They are expressed throughout the nervous system and in various cells including astrocytes, oligodendrocytes and neurons [1]. The major proteins that form gap junctions are termed connexins (Cxs). Different Cx subtypes have been identified in the vertebrate CNS, which are defined by their molecular mass (in kilo Daltons) [2]. In the adult brain, neurons form gap junctions with other neurons, but not with astrocytes. Nevertheless, some studies reported significant neuron-glia coupling in a few brain areas [3]. Gap junction channels connecting

∗ Corresponding author. E-mail addresses: [email protected], [email protected] (S. Beheshti). http://dx.doi.org/10.1016/j.bbr.2016.11.048 0166-4328/© 2016 Elsevier B.V. All rights reserved.

neurons are also called electrical synapses. These synapses connect soma-to-soma, soma-to-dendrite, dendrite-to-dendrite or axonto-axon. There are possibly five different connexins (Cx26, Cx30.2, Cx31.1, Cx36 and Cx45) that are expressed in neurons of the brain [4]. Cx36 and Cx45 are more abundant than other neuronal connexins in the brain [6] and play important roles in physiological conditions in the central nervous system [7–13]. There is growing body of evidence indicating the role of brain gap junctions in physiological conditions, including memory formation [10,12,14–20]. However, the role of intercellular coupling via gap junctions for learning and memory is not well known. Earlier studies using behavioral genetics and behavioral pharmacology approaches have investigated the impact of gap junctions on learning and memory [9,10,12,16,19,21–23]. Different neuronal and astrocytic connexin-deficient rodents were used for behavioral correlates of learning and memory. Cx43deficient mice showed a steeper learning course in the water maze

86

S. Beheshti et al. / Behavioural Brain Research 320 (2017) 85–90

[22]. The deletion of the Cx31.1 coding DNA in the mouse led to impaired one-trial object recognition at all delays tested [19]. Conditional neuronal Cx45-deficient mice showed impaired one-trial object recognition after delays of 10, 30 and 60 min [12]. Cx36deficient mice exhibited one-trial object recognition after retention intervals of 45 and 90 min, but not at a delay of 15 min between the sample and the test trial [20]. Also, Cx36-deficient mice showed impaired behavioral habituation and rewarded spatial alternation behavior in the Y-maze [10,20]. However, spatial learning in the water maze was shown to be unaffected by the Cx36 knockout in the mouse [10]. The behavioral relevance of gap junctions has also been studied in a few pharmacological studies using gap junction uncouplers. For example, intraperitoneal or dorsal hippocampal injection of carbenoxolone or mefloquine in rats impaired acquisition and consolidation of contextual fear memory and accelerated its extinction without having a detrimental effect on the acquisition and expression of cued fear [14]. Also, the bilateral infusion of carbenoxolone into the hippocampus of rats impaired memory performance in a water maze [16] and memory consolidation in the passive avoidance task (PAT) [23]. Meanwhile, blocking the hippocampal CA1 area gap junction channels by carbenoxolone disrupted morphine state-dependent learning [17]. Intercellular coupling via gap junction channels can increase in two ways. One way is the rise in the number of open channels at a given time. The other way is to increase the number of gap junction channels at a gap junction plaque, which can be done via increased expression of connexin family of proteins. Therefore, if the gap junction channels are involved in memory processing, the expression of connexins might upregulate and thereby increase the number of gap junction channels at a gap junction plaque and the intercellular communication between neuronal cells in the brain areas responsible for memory formation. Memory formation consists of several phases, including acquisition, consolidation, retention and retrieval, which have different mechanisms [25]. The hippocampus, which is the main component of the limbic system, plays a crucial role in governing learning and memory [26]. It is involved in the consolidation of memory in the passive avoidance task [27]. It is well known that there is a wide network of gap junction communication between different cell types within the hippocampus [5]. Though the results of most researches have indicated a relationship between gap junctions and memory formation [12,14,17,19,20,23], there are not any reports indicating the expression levels of any of the connexins during each of the particular stages of memory formation. The aim of the present study was to evaluate the time profile of two neuronal connexins, Cx36 and Cx45 mRNA expression levels in the hippocampus, during the process of memory consolidation.

2. Materials and methods 2.1. Animals Totally 30 three months old naive male Wistar rats weighing 230–280 g were obtained from the breeding colony of Department of Biology, University of Isfahan and randomly distributed into 5 groups of 6 each. Rats were housed four per cage in a temperature (24 ◦ C) controlled room that was maintained on a 12:12 light cycle (light on at 07:00 A.M.). Rats had unrestricted access to food and water in their home cage. The animals were handled evenly and habituated with the experimenter and were placed in the test room, 30 min before the experiment. All experiments were carried out in accordance with the guide for the care and use of laboratory animals (USA National Institute of Health publication No. 80-23, revised

1996) and were approved by the graduate studies committee of the Department of Biology, University of Isfahan. The experiments were performed between 9 A.M. and 13 P.M. 2.2. Passive avoidance task A step-through passive avoidance apparatus (Tajhiz Gostar Co, Iran, 2013) with two opaque white and black chambers was used in the behavioral experiments. The white chamber was illuminated by a lamp. The two distinct chambers, each with the interior dimensions of 30 × 25 × 25 cm3 were separated by a sliding door of 8 × 25 cm2 . The floors of both chambers were made of stainless steel rods with 3 mm diameter and 1 cm space between the rods. The experiments were performed in a silent room. Each rat was placed in the white chamber of the PAT apparatus facing the sliding door. After 5 s the door was raised. When the animal stepped into the dark chamber with all four paws, the door was closed and the rat remained there for 20 s. Then the animal was removed to be placed in a temporary cage (habituation training). Thirty min later, the rat was again placed in the white chamber for 5 s, then the door was raised to let the animal enter the dark chamber and following entrance, the door was closed, but this time a controlled electrical shock of 0.3 mA lasting for 1 s was delivered. After 20 s, the rat was placed into the temporary cage (acquisition training). 2 min later, the same testing procedure was repeated. When the rat remained in the white compartment for a 2-min time period, the training was terminated. The control group was treated the same as the test groups, but did not receive any foot-shock. After completion of the training session, rats were decapitated at different time profiles (30 min, 3, 6 and 24 h after training) and their hippocampi were immediately removed and frozen in liquid nitrogen, then stored in a −70 ◦ C freezer. 2.3. Gene expression assay 2.3.1. Tissue preparation The frozen hippocampal samples were pulverized completely and mixed with 200 ␮L chilled phosphate-buffered saline (in mmol/L: 137 NaCl, 2.7 KCl, 4.3 Na2HPO4.7H2O, and 1.4 KH2PO4), vortexed for 30 s and then divided into aliquots [28]. 2.3.2. RNA extraction Total cellular RNA was isolated from the hippocampus using RNX-PLUS reagent (SinaClon, Iran). The RNA was treated with 1 U RNase-free DNase I (Thermo Fisher Scientific Inc, United States) to avoid DNA contamination. The integrity of the RNA samples was determined using denaturing agarose gel electrophoresis. The concentration and purity of the RNAs were determined by spectrophotometry (Eppendorf, Germany). The mean absorbance ratio at 260/280 nm was 1.7 ± 0.2 and at 260/230 nm was 1.8 ± 0.1. 2.3.3. Complementary DNA (cDNA) synthesis The reverse transcription reaction was performed with a cDNA synthesis kit (Takara, Japan) using Oligo-dT primer, MULV reverse transcriptase and 500 ng total RNA as template, according to the manufacturer s instructions. 2.3.4. Real-time PCR and comparative threshold cycle method Cx36 and Cx45 were chosen as target genes and GAPDH was used as an internal reference gene. All primers were designed using the NCBI primer design tool (Table 1). The specificity of the primers for their target sequences was checked on the NCBI website (www. ncbi.nlm.nih.gov/blast). The SYBR Green I real-time PCR assay was carried out in a final reaction volume of 10 ␮L with 5 ␮L SYBR Green I Master mix (Takara, Japan), 100 nmol/L forward and reverse primers and 10 ng cDNA. Thermal cycling was performed on the ABI

S. Beheshti et al. / Behavioural Brain Research 320 (2017) 85–90

87

Table 1 Primers used for real-time PCR. Target

Forward primer 5 → 3

Reverse primer 5 → 3

Amplicon (bp)

Cx36 Cx45 GAPDH

GCCGGTACTCGACTGTCTTC GTTAACAGGGCAAACCAATTCCA CAGGGCTGCCTTCTCTTGTG

ATCTTCTCGCTTGCTCCCAC AGATGGACTCTCCTCCTACCG GATGGTGATGGGTTTCCCGT

107 158 172

Stepone (Applied Biosystems, Foster City, CA) using the following cycling conditions: 30 s at 95 ◦ C as the first denaturation step, followed by 40 cycles at 95 ◦ C for 5 s and 53.1 ◦ C for 30 s. The extent of gene expression was calculated using comparative threshold cycles. The mean threshold cycle (mCT) was obtained from duplicate amplifications during the exponential phase of amplification. The geometrical mean of the reference gene CT values was subtracted from the mCT value of the target genes to obtain CT. The CT value for each sample was calculated from the corresponding CT values: CT = CT(testsample) − CT(controlsample). The calculated CT was rehabilitated to a ratio using the formula (Ratio = 2−CT ). Dissociation curve analysis was performed for each amplification reaction to detect any primer dimers or non-specific PCR products. Before using the comparative threshold cycle method, the amplification efficiency of each gene was determined from the standard curve drawn by plotting the logarithmic input amount of cDNA versus the corresponding CT values [29]. 3. Results 3.1. Behavioral experiments Each rat learned the task by just one foot-shock. One-way ANOVA indicated no significant difference between the initial latencies in the habituation (data not shown) or acquisition training sessions (Fig. 1). 3.2. Expression levels of hippocampal Cx36 and Cx45 mRNAs during memory consolidation Melting curve analysis for the Cx36, Cx45 and GAPDH gene fragments revealed a unique PCR product in each reaction. Melting temperatures of 84 ◦ C for GAPDH and 85 ◦ C for Cx36 and Cx45 were obtained. Mean threshold cycles of 22.45 for GAPDH, 28.92 for Cx36, and 28.03 for Cx45 were obtained. One-way ANOVA followed by post-hoc comparison indicated a significant increase in the expression of hippocampal Cx36 mRNA levels at 0.5 h following initiation of the process of memory consolidation (Fig. 2 (A); P < 0.01). At 3 and 6 h time points, there was also an upregulation in the expression of Cx36, but there were no statistical significances. The expression level of Cx36 mRNA reached to the basal level at the 24 h time point. One-way ANOVA followed by post-hoc comparison also indicated a significant increase in the expression of hippocampal Cx45 mRNA levels at 0.5 h following initiation of the process of memory consolidation (Fig. 2(B); P < 0.05). The expression levels of Cx45 reached to the basal levels at 3, 6 and 24 h time points. 4. Discussion The results of the present study revealed that during memory consolidation in a passive avoidance paradigm, a rapid upregulation of Cx36 and Cx45 mRNAs level occurs in the hippocampus, which declines to the control level by 24 h after training.

Cx36 expressing neurons exist in all the regions of the hippocampal formation, including the entorhinal cortex. Cx36 is expressed in the GABAergic interneurons found in the various layers of CA1 , CA3 and dentate gyrus, while the principal pyramidal cells express Cx36 only in the CA3 region [30]. The role of Cx36 containing gap junction channels has been studied in the hippocampus. It was observed that long-term potentiation in the hippocampal CA1 area was impaired in Cx36 knockout mice slices [9] and Cx36 uncouplers disrupt rhythmic activity in the hippocampal CA3 subfield. In Cx36-deficient mice electrical coupling between subpopulations of neurons in the dentate gyrus and CA3 region of the hippocampus was impaired [31]. In the hippocampus, coordination of cell firings mediated by gap junction channels generates oscillations of different frequencies [31–34]. There are increasing number of evidences representing that gamma, theta and high frequency oscillatory activities in the brain are involved in various stages of memory process including consolidation [35]. Inhibitory interneurons play a central role in synchronizing neuronal activity and regulating network oscillations in the brain. It is thought that neuronal coupling via Cx36 gap junction channels is responsible for the synchronous oscillatory activity. Synchronous activity of inhibitory networks in the visual cortex was changed after elimination of Cx36 [36]. Also, in connexin 36-deficient mice, high-frequency network oscillations (ripples) was reduced in hippocampal slices [37]. During hippocampal ripples, a powerful synchronization connects the neuronal networks of the hippocampus to that of neocortex. This connection was proposed to be involved in memory consolidation [38]. It was indicated that gamma oscillations connect the CA1 area of the hippocampus with the central area of the entorhinal cortex and this connection was involved in memory consolidation [24]. In this regard, Cx36 knocked out, decreased the power of gamma frequency oscillations significantly [34]. Beside these data, studies have found that blockade of Cx36 channels impaired learning and memory processes [14]. Researchers have observed that Cx36 knockout mice displayed impaired short-term spatial memory, but showed normal spatial reference memory [10]. The Cx36 deficient mice also displayed impaired one-trial object-place recognition [21]. During memory formation, Ca2+ signaling have a crucial role [39]. Prolonged increases in intracellular calcium levels in neurons can activate protein kinases and gene transcription factors, such as Ca2+ /calmodulin-dependent protein kinase II (CaMKII), CaMKIV and protein kinase C (PKC), which in turn can change the excitability and morphology of synapses located on that neuron, like the changes seen after the induction of synaptic long-term potentiation [40]. CaMKII levels are increased during the early phase of memory formation in the passive avoidance paradigm [41] and blockade of CaMKII substantially impairs memory formation [42]. Interestingly, Cx36 deficiency in the mouse resulted in reduced CaMKII levels in the striatum [21]. Therefore, the increased expression of Cx36 might lead to increased levels of CaMKII, which in turn would contribute to early phases of memory consolidation process. On the other hand, it was reported that electrical synapses can undergo activity-dependent synaptic potentiation and that CaMKII plays a central role in modulating junctional coupling. CaMKII interacted with and phosphorylated Cx36 and mediated channel gating in inferior olive neuronal cells [43]. It seems that during memory for-

88

S. Beheshti et al. / Behavioural Brain Research 320 (2017) 85–90

20 18

Initial Latency (sec)

16 14 12 10 8 6 4 2 0

Control

0.5 h

3h

6h

24 h

Fig. 1. The initial latency for entering the dark compartment in the acquisition training session. Data are expressed as means ± S.E.M (n = 6).

mation there is a reciprocal interaction between these two proteins, which requires special attention. Cx45 protein expression has been detected in various neurons in the mouse brain. Cx45-positive pyramidal cells have been identified in neocortex and perirhinal cortex, hippocampus (regions CA1 –CA3 ) and thalamus [44]. Furthermore, Cx45 is expressed in neurons of the olfactory bulb [45] and in subpopulations of neurons in the olivocerebellar system [46,47]. Cx45 is not expressed in oligodendrocytes or astrocytes [44]. The pyramidal neurons of the hippocampus (except for CA3 ) do not express Cx36, but are electrically coupled. Therefore, it is thought that these neurons are coupled by means of Cx45 containing gap junction channels [48]. There are some reports regarding the role of Cx45 gap junctions in the nervous system. Conditional neuron-specific Cx45-deficient mice showed normal general excitability, synaptic short-term plasticity and spontaneous high-frequency oscillations in the hippocampus. However, stimulation of hippocampal slices in these mice with kainite, induced decreases in amplitudes of gamma-oscillation in the CA3 , but not in the CA1 subfield. The neuron-directed deletion of Cx45 also impaired one-trial novel object recognition [12]. We do not address whether a change in Cx36 and Cx45 mRNAs result in a change in functional coupling. Some studies have shown that the expression of connexins at mRNA and protein levels might not correlate. Amphetamine (AMPH) withdrawal produced region-specific and time-dependent changes in Cx36 expression in rat brain. Cx36 mRNA was significantly increased in the nucleus accumbens after 7 days of withdrawal following 30 days of AMPH, which did not result in significant changes in Cx36 protein. Meanwhile, no significant changes in Cx36 mRNA were seen in the prefrontal cortex of animals receiving AMPH treatment, but Cx36 protein levels decreased significantly [49]. Conversely, some other studies have shown a correlated change in connexins mRNA and protein expression levels. Cx36 expression at both mRNA and protein level was upregulated during acquisition of focal seizures [50]. Also, a decreased expression of Cx43 was accompanied by a reduction in intercellular communication via gap junction channels [51]. Therefore, it seems improbable, that coupling would be unaltered. Although connexins are membrane proteins, it was indicated that their expression levels could change rapidly. A single evoked after-discharge produced a rapid (3 h post-stimulation), timedependent decrease in Cx36 protein expression in adult rat dorsal hippocampus [52]. Hence, we studied the time profile of Cx36 and Cx45 mRNA expression levels from an early time point of

30 min–24 h. The results indicated an early upregulation of hippocampal Cx36 and Cx45 mRNA levels. Nevertheless, we did not determine in which hippocampal cells, the expression levels of Cx36 and Cx45 have upregulated. Some studies have suggested that these connexins do not express in glial cells [44,53,54] and are expressed mainly in interneurons [55]. So the upregulation might be kept to hippocampal neurons. On the other hand, our results do not show whether the Cx36 and Cx45 upregulation occur in all the hippocampal regions or it is confined to a specific subfield. It can be proposed that the increase in Cx36 and Cx45 containing gap junction channels between CA3 pyramidal neurons or GABAergic interneurons has elevated their capability to synchronize, the process needed to memory consolidation. Further experiments using in situ hybridization are necessary to provide concise data regarding the level of expression in different hippocampal regions during memory consolidation. Recently, we indicated that gating of the hippocampal CA1 area gap junction channels is crucial for memory consolidation in the passive avoidance task [23]. Accordingly, we hypothesize that a rapid up-regulation of Cx36 and Cx45 mRNAs might be accompanied by similar upregulation in related protein levels, which together with the increased percentage of opened gap junction channels would affect intercellular coupling via gap junction channels and neuronal oscillatory activities required for memory consolidation. Further studies, including western blotting and dye-coupling, as well as field potential recordings are required to examine the hypothesis. Our study represents a different approach to study the involvement of gap junctions in memory. While the majority of previous studies performed to assess the role of gap junctions in memory, were done by using connexin-deficient animals or by blocking the gap junction channels, we have investigated the expression levels of Cx36 and Cx45 in naïve rats during the process of memory consolidation. It seems that beside the change in the number of open channels of the electrical synapses, the number of these channels rises to increase the intercellular communication required for memory consolidation. This study adds to the accumulating evidence supporting a role for neuronal gap junction channels in the physiological conditions of the nervous system. 5. Conclusions In conclusion, our results indicated a rapid upregulation in the mRNA levels of Cx36 and Cx45 in the rat hippocampus during the process of memory consolidation in a passive avoidance

S. Beheshti et al. / Behavioural Brain Research 320 (2017) 85–90

(A)

20

89

**

18

Relative expression

16 14 12 10 8 6 4 2 0

Control

(B)

6

0.5 h

3h

6h

24 h

*

Relative Expression

5 4 3 2 1 0

Control

0.5 h

3h

6h

24 h

Fig. 2. Expression of Cx36 (A) and Cx45 (B) genes in the hippocampus of rats at different times (0.5, 3, 6 and 24 h) following training session in the passive avoidance task. Connexins mRNA levels were normalized to that of GAPDH mRNA. Data are expressed as means ± S.E.M (n = 6). Each polymerase chain reaction was performed in duplicate to increase the reliability of the measurements. *: P < 0.05; **: P < 0.01.

paradigm. It is suggested that this rapid upregulation would result in the increased oscillatory activity of the hippocampus, required for memory consolidation. The outcomes emphasize the role of neuronal gap junction channels on memory encoding and show that the electrical synapses of the hippocampus might also have a crucial role in this process. Acknowledgment This work was supported by grant no 9832/93 from the ViceChancellorships for Research and Technology, University of Isfahan. References [1] E. Dere, A. Zlomuzica, The role of gap junctions in the brain in health and disease, Neurosci. Biobehav. Rev. 36 (1) (2012) 206–217. [2] A. Salameh, S. Dhein, Pharmacology of gap junctions. New pharmacological targets for treatment of arrhythmia, seizure and cancer? Biochim. Biophys. Acta 1719 (1–2) (2005) 36–58. [3] V. Alvarez-Maubecin, F. Garcia-Hernandez, J.T. Williams, E.J. Van Bockstaele, Functional coupling between neurons and glia, J. Neurosci. 20 (11) (2000) 4091–4098. [4] A. Zlomuzica, S. Binder, E. Dere, Chapter 1 – Gap Junctions in the Brain, Gap Junctions in the Brain, Academic Press, San Diego, 2013, pp. 3–17. [5] G. Sohl, S. Maxeiner, K. Willecke, Expression and functions of neuronal gap junctions, Nat. Rev. Neurosci. 6 (3) (2005) 191–200.

[6] S.G. Hormuzdi, M.A. Filippov, G. Mitropoulou, H. Monyer, R. Bruzzone, Electrical synapses: a dynamic signaling system that shapes the activity of neuronal networks, Biochim. et Biophys. Acta (BBA) – Biomembr. 1662 (1–2) (2004) 113–137. [7] P. Bolte, R. Herrling, B. Dorgau, K. Schultz, A. Feigenspan, R. Weiler, K. Dedek, U. Janssen-Bienhold, Expression and localization of connexins in the outer retina of the mouse, J. Mol. Neurosci. 58 (2) (2016) 178–192. [8] M.E. Rubio, J.I. Nagy, Connexin36 expression in major centers of the auditory system in the CNS of mouse and rat: evidence for neurons forming purely electrical synapses and morphologically mixed synapses, Neuroscience 303 (2015) 604–629. [9] Y. Wang, A.B. Belousov, Deletion of neuronal gap junction protein connexin 36 impairs hippocampal LTP, Neurosci. Lett. 502 (1) (2011) 30–32. [10] K. Allen, E.C. Fuchs, H. Jaschonek, D.M. Bannerman, H. Monyer, Gap junctions between interneurons are required for normal spatial coding in the hippocampus and short-term spatial memory, J. Neurosci. 31 (17) (2011) 6542–6552. [11] D.W. Allison, R.S. Wilcox, K.L. Ellefsen, C.E. Askew, D.M. Hansen, J.D. Wilcox, S.S. Sandoval, D.L. Eggett, Y. Yanagawa, S.C. Steffensen, Mefloquine effects on ventral tegmental area dopamine and GABA neuron inhibition: a physiologic role for connexin-36 gap junctions, Synapse (New York N.Y.) 65 (8) (2011) 804–813. [12] A. Zlomuzica, S. Reichinnek, S. Maxeiner, M. Both, E. May, P. Worsdorfer, A. Draguhn, K. Willecke, E. Dere, Deletion of connexin45 in mouse neurons disrupts one-trial object recognition and alters kainate-induced gamma-oscillations in the hippocampus, Physiol. Behav. 101 (2) (2010) 245–253. [13] K. Khodosevich, A. Zuccotti, M.M. Kreuzberg, C. Le Magueresse, M. Frank, K. Willecke, H. Monyer, Connexin45 modulates the proliferation of

90

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24] [25] [26]

[27]

[28]

[29]

[30] [31]

[32]

[33]

S. Beheshti et al. / Behavioural Brain Research 320 (2017) 85–90 transit-amplifying precursor cells in the mouse subventricular zone, Proc. Natl. Acad. Sci. U. S. A. 109 (49) (2012) 20107–20112. S. Bissiere, M. Zelikowsky, R. Ponnusamy, N.S. Jacobs, H.T. Blair, M.S. Fanselow, Electrical synapses control hippocampal contributions to fear learning and memory, Science (New York N.Y.) 331 (6013) (2011) 87–91. A.N. Chepkova, O.A. Sergeeva, H.L. Haas, Carbenoxolone impairs LTP and blocks NMDA receptors in murine hippocampus, Neuropharmacology 55 (2) (2008) 139–147. H. Hosseinzadeh, M.N. Asl, S. Parvardeh, S.M. Tagi Mansouri, The effects of carbenoxolone on spatial learning in the Morris water maze task in rats, Medi. Sci. Monit. 11 (3) (2005) Br88–Br94. S. Beheshti, S.A. Hosseini, M. Noorbakhshnia, M. Eivani, Role of hippocampal CA1 area gap junction channels on morphine state-dependent learning, Eur. J. Pharmacol. 745 (2014) 196–200. C.L. Wu, M.F. Shih, J.S. Lai, H.T. Yang, G.C. Turner, L. Chen, A.S. Chiang, Heterotypic gap junctions between two neurons in the drosophila brain are critical for memory, Curr. Biol. 21 (10) (2011) 848–854. E. Dere, Q. Zheng-Fischhöfer, D. Viggiano, U.A. Gironi Carnevale, L.A. Ruocco, A. Zlomuzica, M. Schnichels, K. Willecke, J.P. Huston, A.G. Sadile, Connexin 31.1 deficiency in the mouse impairs object memory and modulates open-field exploration, acetylcholine esterase levels in the striatum, and cAMP response element-binding protein levels in the striatum and piriform cortex, Neuroscience 153 (2) (2008) 396–405. C. Frisch, M.A. De Souza-Silva, G. Sohl, M. Guldenagel, K. Willecke, J.P. Huston, E. Dere, Stimulus complexity dependent memory impairment and changes in motor performance after deletion of the neuronal gap junction protein connexin36 in mice, Behav. Brain Res. 157 (1) (2005) 177–185. A. Zlomuzica, D. Viggiano, J. Degen, S. Binder, L.A. Ruocco, A.G. Sadile, K. Willecke, J.P. Huston, E. Dere, Behavioral alterations and changes in Ca2+ /calmodulin kinase II levels in the striatum of connexin36 deficient mice, Behav. Brain Res. 226 (1) (2012) 293–300. C. Frisch, M. Theis, M.A. De Souza Silva, E. Dere, G. Sohl, B. Teubner, K. Namestkova, K. Willecke, J.P. Huston, Mice with astrocyte-directed inactivation of connexin43 exhibit increased exploratory behaviour, impaired motor capacities, and changes in brain acetylcholine levels, Eur. J. Neurosci. 18 (8) (2003) 2313–2318. S. Beheshti, M. Eivani, J. Moshtaghian, Gap junctions of the hippocampal CA1 area are crucial for memory consolidation, Physiol. Pharmacol. 19 (3) (2015) 177–184. L.L. Colgin, E.I. Moser, Gamma oscillations in the hippocampus, Physiology (Bethesda) 25 (5) (2010) 319–329. T. Abel, K.M. Lattal, Molecular mechanisms of memory acquisition, consolidation and retrieval, Curr. Opin. Neurobiol. 11 (2) (2001) 180–187. S. Zola-Morgan, L.R. Squire, D.G. Amaral, Human amnesia and the medial temporal region: enduring memory impairment following a bilateral lesion limited to field CA1 of the hippocampus, J. Neurosci. 6 (10) (1986) 2950–2967. C.A. Lorenzini, E. Baldi, C. Bucherelli, B. Sacchetti, G. Tassoni, Role of dorsal hippocampus in acquisition, consolidation and retrieval of rat’s passive avoidance response: a tetrodotoxin functional inactivation study, Brain Res. 730 (1–2) (1996) 32–39. B. Akbarpour, M. Sayyah, V. Babapour, R. Mahdian, S. Beheshti, A.R. Kamyab, Expression of connexin 30 and connexin 32 in hippocampus of rat during epileptogenesis in a kindling model of epilepsy, Neurosci. Bull. 28 (6) (2012) 729–736. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) Method, Methods (San Diego Calif.) 25 (4) (2001) 402–408. D.F. Condorelli, N. Belluardo, A. Trovato-Salinaro, G. Mudo, Expression of Cx36 in mammalian neurons, Brain Res. Rev. 32 (1) (2000) 72–85. S.G. Hormuzdi, I. Pais, F.E. LeBeau, S.K. Towers, A. Rozov, E.H. Buhl, M.A. Whittington, H. Monyer, Impaired electrical signaling disrupts gamma frequency oscillations in connexin 36-deficient mice, Neuron 31 (3) (2001) 487–495. J. Konopacki, T. Kowalczyk, H. Golebiewski, Electrical coupling underlies theta oscillations recorded in hippocampal formation slices, Brain Res. 1019 (1–2) (2004) 270–274. A. Draguhn, R.D. Traub, D. Schmitz, J.G. Jefferys, Electrical coupling underlies high-frequency oscillations in the hippocampus in vitro, Nature 394 (6689) (1998) 189–192.

[34] D.L. Buhl, K.D. Harris, S.G. Hormuzdi, H. Monyer, G. Buzsaki, Selective impairment of hippocampal gamma oscillations in connexin-36 knock-out mouse in vivo, J. Neurosci. 23 (3) (2003) 1013–1018. [35] E. Duzel, W.D. Penny, N. Burgess, Brain oscillations and memory, Curr. Opin. Neurobiol. 20 (2) (2010) 143–149. [36] F. Postma, C.-H. Liu, C. Dietsche, M. Khan, H.-K. Lee, D. Paul, P.O. Kanold, Electrical synapses formed by connexin36 regulate inhibition- and experience-dependent plasticity, Proc. Natl. Acad. Sci. U. S. A. 108 (33) (2011) 13770–13775. [37] N. Maier, M. Guldenagel, G. Sohl, H. Siegmund, K. Willecke, A. Draguhn, Reduction of high-frequency network oscillations (ripples) and pathological network discharges in hippocampal slices from connexin 36-deficient mice, J. Physiol. 541 (Pt 2) (2002) 521–528. [38] J.J. Chrobak, G. Buzsaki, High-frequency oscillations in the output networks of the hippocampal-entorhinal axis of the freely behaving rat, J. Neurosci. 16 (9) (1996) 3056–3066. [39] M.J. Berridge, Neuronal calcium signaling, Neuron 21 (1) (1998) 13–26. [40] S. Ben Achour, L. Pont-Lezica, C. Bechade, O. Pascual, Is astrocyte calcium signaling relevant for synaptic plasticity? Neuron Glia Biol. 6 (3) (2010) 147–155. [41] M. Cammarota, R. Bernabeu, M. Levi De Stein, I. Izquierdo, J.H. Medina, Learning-specific, time-dependent increases in hippocampal Ca2+ /calmodulin-dependent protein kinase II activity and AMPA GluR1 subunit immunoreactivity, Eur. J. Neurosci. 10 (8) (1998) 2669–2676. [42] S.J. Coultrap, K.U. Bayer, CaMKII regulation in information processing and storage, Trends Neurosci. 35 (10) (2012) 607–618. [43] C. Alev, S. Urschel, S. Sonntag, G. Zoidl, A.G. Fort, T. Höher, M. Matsubara, K. Willecke, D.C. Spray, R. Dermietzel, The neuronal connexin36 interacts with and is phosphorylated by CaMKII in a way similar to CaMKII interaction with glutamate receptors, Proc. Natl. Acad. Sci. U. S. A. 105 (52) (2008) 20964–20969. [44] S. Maxeiner, O. Kruger, K. Schilling, O. Traub, S. Urschel, K. Willecke, Spatiotemporal transcription of connexin45 during brain development results in neuronal expression in adult mice, Neuroscience 19 (3) (2003) 689–700. [45] C. Zhang, D. Restrepo, Expression of connexin 45 in the olfactory system, Brain Res. 929 (1) (2002) 37–47. [46] R.S. Van Der Giessen, S. Maxeiner, P.J. French, K. Willecke, C.I. De Zeeuw, Spatiotemporal distribution of Connexin45 in the olivocerebellar system, J. Comp. Neurol. 495 (2) (2006) 173–184. [47] S. Weickert, A. Ray, G. Zoidl, R. Dermietzel, Expression of neural connexins and pannexin1 in the hippocampus and inferior olive: a quantitative approach, Brain research, Mol. Brain. Res. 133 (1) (2005) 102–109. [48] D. Schmitz, S. Schuchmann, A. Fisahn, A. Draguhn, E.H. Buhl, E. Petrasch-Parwez, R. Dermietzel, U. Heinemann, R.D. Traub, Axo-axonal coupling. a novel mechanism for ultrafast neuronal communication, Neuron 31 (5) (2001) 831–840. [49] C.B. McCracken, K.M. Patel, K.E. Vrana, D.L. Paul, D.C. Roberts, Amphetamine withdrawal produces region-specific and time-dependent changes in connexin36 expression in rat brain, Synapse (New York N.Y.) 56 (1) (2005) 39–44. [50] S. Beheshti, M. Sayyah, M. Golkar, H. Sepehri, J. Babaie, B. Vaziri, Changes in hippocampal connexin 36 mRNA and protein levels during epileptogenesis in the kindling model of epilepsy, Prog. Neuro-Psychopharmacol. Biol. Psychiatry 34 (3) (2010) 510–515. [51] N. Rouach, C.F. Calvo, J. Glowinski, C. Giaume, Brain macrophages inhibit gap junctional communication and downregulate connexin 43 expression in cultured astrocytes, Eur. J. Neurosci. 5 (2) (2002) 403–407. [52] C.B. McCracken, D.C. Roberts, A single evoked afterdischarge produces rapid time-dependent changes in connexin36 protein expression in adult rat dorsal hippocampus, Neurosci. Lett. 405 (1–2) (2006) 84–88. [53] J.E. Rash, T. Yasumura, K.G. Davidson, C.S. Furman, F.E. Dudek, J.I. Nagy, Identification of cells expressing Cx43, Cx30, Cx26, Cx32 and Cx36 in gap junctions of rat brain and spinal cord, Cell Commun. Adhesion 8 (4–6) (2001) 315–320. [54] J.E. Rash, T. Yasumura, F.E. Dudek, J.I. Nagy, Cell-specific expression of connexins and evidence of restricted gap junctional coupling between glial cells and between neurons, J. Neurosci. 21 (6) (2001) 1983–2000. [55] B.W. Connors, M.A. Long, Electrical synapses in the mammalian brain, Annu. Rev. Neurosci. 27 (2004) 393–418.