- Email: [email protected]
RARβ2-Mediated Growth Inhibition in HeLa Cells
EXPERIMENTAL CELL RESEARCH ARTICLE NO.
223, 102–111 (1996)
0062
RARb2-Mediated Growth Inhibition in HeLa Cells SEONG PAN SI,* XINHUA LEE,* HUI C. TSOU,* RACHEL BUCHSBAUM,† ELMI TIBADUIZA,* AND MONICA PEACOCKE*,1 Departments of *Dermatology and †Medicine, New England Medical Center, and Tufts University School of Medicine, Boston, Massachusetts 02111
Retinoic acid inhibits the growth of a variety of normal and transformed cells in vitro and in vivo. How retinoic acid inhibits cell growth is poorly understood but involves interactions between the ligand and a series of nuclear and cytoplasmic receptors. The nuclear receptors for retinoic acid are of two types, the RARs and the RXRs. Each can function as a ligand-inducible transcription enhancing factor. In previous studies, we have demonstrated that an isoform of one RAR, RARb2, is transcriptionally up-regulated in senescent human dermal fibroblasts and senescent human mammary epithelial cells. Moreover, we have also shown that RARb2 can inhibit oncogene-induced focus formation, in primary rat embryo fibroblasts, as effectively as the tumor suppressor gene p53. Here, we extend our studies of retinoid-regulated signal transduction pathways that inhibit cell proliferation by demonstrating that HeLa cells expressing an RARb2 construct are growth inhibited by greater than 50% when compared to the parent cell lines. The RARb2expressing cell lines are inhibited further by the addition of exogenous all-trans-retinoic acid. Finally, soft agar assays show that the RARb2-expressing cell lines also demonstrate an inhibition of growth in soft agar, when compared to the parent cell lines, and are inhibited further in the presence of added all-trans-retinoic acid. These data definitively show that RARb2 can inhibit cell proliferation in an established tumor cell line and provide more strength to the notion that this isoform is an effective growth inhibitor in vitro and, most likely, in vivo. q 1996 Academic Press, Inc.
INTRODUCTION
Retinoic acid is known to inhibit cell proliferation in vitro and in vivo [reviewed in 1]. The signal transduction pathways used by retinoic acid to inhibit growth are not well defined, but most likely involve an interac1 To whom correspondence and reprint requests should be addressed at Department of Dermatology, VC-15, Columbia University, College of Physicians & Surgeons, 630 West 168th Street, New York, NY 10032. Fax: (212) 305-7882.
102
0014-4827/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
6I0A
/ m4861$3052
01-23-96 22:33:08
tion of retinoic acid with a series of nuclear and cytoplasmic receptors. Two types of nuclear receptors for retinoic acid have been identified, the RARs [2–7] and the RXRs [8–10]. Each receptor can function as a ligand-inducible transcription enhancing factor. Three distinct RARs have been described, RARa, RARb, and RARg [2–7], and each has a series of isoforms demonstrating different developmental and tissue-specific patterns of expression. Of interest, each of the RARs has an isoform that is regulated by retinoic acid, suggesting that the ligand can regulate the expression of its own receptor [11–13]. Three different RXRs also exist, RXRa, RXRb, and RXRg [8–10, 14, 15]. Finally, cytoplasmic receptors for retinoic acid have also been identified, the cellular retinoic acid binding proteins (CRABPs) [16–18]. These receptors are involved in the metabolism and transport of retinoic acid. In previous studies, we have demonstrated that alltrans-retinoic acid induced the expression of RARb, RARg, and CRABP-II in human dermal fibroblasts [19, 20]. Further studies demonstrated the selective transcriptional up-regulation of one isoform, RARb2, in senescent human mammary epithelial cells [21] and senescent human dermal fibroblasts [22]. As the growth inhibition characteristic of cellular senescence is felt to potentially be a mechanism of tumor suppression [23, 24], we went on to show that RARb2 could inhibit oncogene-induced focus formation as effectively as the wellcharacterized tumor suppressor gene p53 [22]. These data [22], combined with studies showing that certain tumor cell lines have lost the ability to express RARb2 [21, 25–27], provide more support for the possibility that RARb2 could function to inhibit the transformation of normal cells into immortal and potentially tumorigenic cells in vitro. In the experiments reported here, we extend our studies on the role of RARb2 as a nuclear receptor for retinoic acid that functions in a signal transduction pathway that inhibits cell proliferation. We first show that, in contrast to certain breast cancer cell lines where RARb2 is transcriptionally repressed [21], the RARb2 mRNA is induced normally by retinoic acid in HeLa cells. Moreover, complexes binding to the b2RARE in HeLa cells are similar to those found in
eca
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
normal human dermal fibroblasts [19, 22] and contrast with those found in certain breast cancer cell lines [21]. As would be predicted from the gel shift studies, we show that the RARb2 promoter constructs activate normally in HeLa cells, again contrasting with our previous observations in breast cancer cell lines, where the RARb2 promoter is transcriptionally repressed. HeLa cells transfected with an RARb2 expression construct demonstrate a significant reduction in growth when compared to parent cell lines. Addition of retinoic acid to the RARb2-expressing cell lines further inhibits their ability to proliferate. Assays performed in soft agar also demonstrate that RARb2 inhibits the anchorage-independent growth of these tumor cells. These data demonstrate that RARb2 effectively inhibits cell proliferation and anchorage-independent growth of certain tumor cell lines and provide more support for the notion that pathways regulated by RARb2 play a role in retinoid-regulated growth inhibition in vitro and, most likely, in vivo. MATERIALS AND METHODS Cell culture and growth experiments. HeLa cells were obtained from the American Type Culture Collection and routinely grown in Dulbecco’s minimum essential medium (DMEM) supplemented with 10% fetal calf serum (FCS). They were passed routinely at confluence. For growth curves, cells from the various cell lines were seeded in duplicate at 2 1 104 cells per 35-mm dish, trypsinized, and counted on various days after seeding using a Coulter counter (Model Zf). For experiments requiring the addition of ligand, retinoic acid was prepared fresh for each experiment at a concentration of 10 mM retinoic acid and used to stimulate cells at a final concentration of 1 mM. For the studies of anchorage-independent growth, performed in soft agar, HeLa cells containing the different expression constructs were plated at a concentration of 5.8 1 105 cells per 60-mm dish in DMEM with 10% FCS, 450 mg/ml G418, and 0.5% agarose, alone or in either 1 or 0.01 mM retinoic acid. The agarose-containing cultures were fed three times weekly. Colonies were counted on Day 14 after seeding by an investigator blinded to the experimental protocol. Colonies were those clumps with greater than 10 cells. For growth curves and anchorage-independent growth retinoic acid was made fresh and added to the cultures three times weekly. Northern and Southern analysis. Total cellular RNA was isolated with 4 M guanidine isothiocyanate and purified through a 5.7 M cesium chloride cushion as described [19, 20, 22]. The RNA was quantitated, and 10–30 mg of total cellular RNA was then size-fractionated through a 1% agarose gel containing 2.2 M formaldehyde and transferred to a nylon membrane (Hybond-N, Amersham). Probes for RARa, RARb, and RARg were oligo-labeled and hybridized as described [19, 22]. Autoradiography was performed on XAR film, with two intensifying screens at 0707C. The RARa probe (the gift of Pierre Chambon) is a 1.6-kb Kpn–EcoRI fragment of RARa cDNA in the plasmid p63 [2]. The RARb probe (the gift of Magnus Pfahl) is a 0.6-kb EcoRI fragment of the RARb cDNA site in the plasmid B1 [5]. The RARg probe (the gift of Pierre Chambon) is a 1.6-kb EcoRI fragment of RARg cDNA cloned in the plasmid pS65 [6, 7]. L7 (the gift of Joseph Nevins, originally known as pHE7) is a 300-bp piece in the Pst site of pGEM-1 [19]. Densitometric analysis of blots was performed by scanning of autoradiographs with Lightning Scan Pro/256 and a Macintosh IIci computer using Image 1.33 as analytical software. For Southern analysis, DNA was extracted
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
103
from cells, size-fractionated, and transferred as described [28]. Hybridization conditions and cDNA probes for Southern blotting were as for Northern analysis. Gel retardation assay. For these experiments, HeLa cells were growth arrested in 0.5% FCS in DMEM for 24 h and then stimulated with 1 mM retinoic acid for 18 h. The remainder of the preparation of nuclear extracts was as described [19]. Final protein concentrations used were 0.8–1.0 mg/ml. Oligonucleotides for the response element were synthesized commercially as b2RARE (GGGTAGGGTTCACCGAAAGTTCACTCG) [11, 19, 21]. DNA–protein binding was conducted in a volume of 20 ml. For the incubations, 3–5 mg was incubated with 1 mg poly(dI-dC) and 0.5–1.0 ng of 32P-labeled synthetic oligonucleotide (about 1 1 105 cpm) in a binding buffer (10 mM Hepes, pH 7.9, 10% glycerol, 50 mM KCl, 0.1 mM EDTA, 2.5 mM MgCl2, 1 mM DTT) for 20 min at room temperature. To ensure specificity of binding, 100-fold excess unlabeled oligonucleotide was added to incubations with the labeled fragments. Equal loading of lanes was performed with binding to an Sp1 element. DNA–protein complexes were resolved on 5% polyacrylamide gels in 0.51 TBE. The gels were dried and autoradiographed with intensifying screens at 0707C. RARb2 promoter constructs. A series of reporter constructs similar to those previously described were generated [11] except that the parent vector was pGL2-basic (Promega Corp., Madison, WI.), which contains a cDNA encoding the firefly luciferase gene and a multiple cloning site for the insertion of DNA fragments. The constructs were generated as follows: pb2–1.51uc (D2) contains a 1.65-kb fragment cloned into the PstI and BamHI site of the pGL2-basic vector, pb2– 7471uc (D3) contains a 902-bp fragment cloned into the BglII and BamHI site of the pGL2-basic vector, pb2–5221uc (D4) contains a 677-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of the pGL2-basic vector, pb2–2861uc (D5) contains a 441-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of the pGL2-basic vector, pb2–2431uc (D6) contains a 398-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of pGL2-basic vector, pb2–1241uc (D7) contains a 279bp fragment cloned into the SacI and BamHI site of pGL2-basic vector. Correct orientation of all clones was verified by DNA sequencing. To generate an expression construct for RARb2, the entire coding sequence of the RARb2 isoform [29] was cloned into PREP9 (Promega Corp., Madison, WI), a vector that contains an RSV promoter, and a selectable marker for Neomycin [21]. Correct orientation of the PREP9–RARb2 was verified by DNA sequencing. Transient transfection. Transient transfection was performed by calcium phosphate precipitation as described [22]. Briefly, HeLa cells were grown in standard medium, trypsinized, and counted. Twentyfour hours prior to transfection, the cells were seeded into 60-mm dishes at a concentration of 1.5 1 105 cells per dish, in duplicate, in standard medium. Two to four hours prior to transfection, the medium of the cells was changed. Expression vector DNA and promoter construct DNA were then mixed with 12–15 mg salmon sperm carrier DNA in a small volume in a buffer, vortexed, and then allowed to sit at room temperature for 20 min. The relevant DNA mixtures were added dropwise to the plated cells in the medium, swirled, and allowed to incubate with the cells for 16 h at 377C. The following morning, the medium was changed. Eighteen hours prior to the reported assay, freshly prepared retinoic acid (1 mM) was added to the appropriate cultures. The luciferase assay was performed as described [21]. Normalization to b-galactosidase was performed using a chemiluminescent technique according to manufacturer’s specifications (Tropix, Inc., Bedford, MA). Stable transfection. For these studies, HeLa cells were transfected with PREP9–RARb2 (tRARb2) as described above, or the basic PREP9 expression vector. The day following transfection, the medium of the cells was replaced with DMEM with 10% FCS and G418 at a concentration of 450 mg/ml G418. Both PREP9– RARb2 and PREP9 containing HeLa cells were then feed three times
AP: Exp Cell
104
SI ET AL.
weekly with G418-containing medium. Two to three weeks after transfection, individual clones were evident in all dishes. Five individual clones were removed from each dish of the PREP9–RARb2containing and the PREP9-containing HeLa cells by trypsinization with a cloning ring. Each clone was expanded in a selection medium containing G418, and vials of the individual, expanded clones were frozen.
RESULTS
RARb2-Mediated Signal Transduction Is Not Altered in HeLa Cells In previous studies, we have shown that RARb2 is repressed in certain breast cancer cell lines and that repression is mediated, at least in part, by complexes binding to the retinoic acid response element (RARE) found in the RARb2 promoter [21]. Thus, whether transcriptional repression of RARb2 was characteristic of all tumor cells, including HeLa cells, remained to be determined. For these studies, HeLa cells were first grown in DMEM with 10% FCS until 70% confluent, and then the serum concentration was decreased to 0.5% overnight. This maneuver minimized the concentration of retinoids present in serum on gene expression. The HeLa cells were then treated with 1 mM alltrans-retinoic acid overnight. Total cellular RNA was then extracted, and Northern blotting studies were performed. Examination of Fig. 1A demonstrates that HeLa cells express low levels of RARa and RARg and almost undetectable levels of RARb2 messenger RNA. These data are similar to those from studies we performed in dermal fibroblasts and normal human mammary epithelial cells [19, 21]. When HeLa cells are stimulated overnight with 1 mM all-trans-retinoic acid, we see 4-fold induction of RARa, 12-fold induction of RARb2, and 8-fold induction of RARg (Fig. 1A). These observations demonstrate that all-trans-retinoic acid induces the expression of all three RARs, but has a greater effect on the expression of RARb2. Moreover, in contrast to observations made in breast cancer cell lines [21], these data suggest that RARb2-mediated signal transduction is not altered in HeLa cells and show that transcriptional repression of RARb2 is not a general feature of all human tumors cultured in vitro. We next determined whether the binding of complexes to the b2RARE was altered in HeLa cells, as it is in certain breast cancer cell lines [21]. For these studies, HeLa cells were grown to 70% confluence, and then the serum concentration was decreased to 0.5% for 24 h. Control cells were stimulated with ethanol alone, while other cells were stimulated overnight with 1 mM all-trans-retinoic acid. Nuclear proteins were prepared and incubated with labeled b2RARE and then separated by gel electrophoresis. The results of these experiments are shown in Fig. 1B. Lane 1 shows a single complex binding to the b2RARE in control HeLa
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
FIG. 1. Northern blotting and gel shift analysis of retinoic acidregulated signal transduction in HeLa cells. (A) HeLa cells were stimulated overnight with 1 mM all-trans-retinoic acid. RARa demonstrates low levels of constitutive expression (C) while 1 mM all-transretinoic acid increases this basal level 4-fold (RA). RARb2 is barely detectable in unstimulated cells (C) but increases 12-fold after stimulation with retinoic acid (RA). RARg mRNA is present at low levels in unstimulated cells (C), but increases 8-fold after stimulation with retinoic acid (RA). L7 serves as a control for equal loading of all lanes. (B) Gel shift analysis of binding of proteins to the b2RARE. In lane 1, a single complex is seen binding to the b2RARE. This complex is successfully competed for by 100-fold excess cold b2RARE (lane 2). After stimulation with retinoic acid, a 2-fold increase in binding to the b2RARE is seen (lane 3). This binding is also successfully competed for by the b2RARE (lane 4).
cells (see double arrows). In lane 2, this binding is successfully competed for by 100-fold excess cold b2RARE. When 1 mM all-trans-retinoic acid is added to the cells, there is a 2-fold increase in binding to the b2RARE (lane 3), and this binding is also successfully competed out by excess cold b2RARE (lane 4). These results are similar to those we have reported for normal human dermal fibroblasts [19], where a single complex binds to the b2RARE. Binding to an Sp1 site showed equivalent binding, and at times a 2-fold increase after retinoic acid treatment. While the physiological significance of small increases in binding is unclear, these observations are in marked contrast to the results we have obtained in breast cancer cell lines, where transcriptional repression of b2RARE is associated with multiple distinct complexes binding to the b2RARE [21]. These observations add support to the notion that RARb2-mediated signal transduction is not altered significantly in HeLa cells. Finally, in order to examine promoter function, we
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
105
FIG. 2. Transient transfection of RARb2 promoter fragments into HeLa cells treated with retinoic acid. Fragments D2 through D7, as illustrated, show transcriptional activation varying from 4- to 12-fold in response to 1 mM all-trans-retinoic acid.
generated a series of deletion mutants covering 1.6 kb of the RARb2 promoter as described [11] and cloned them into a luciferase reporter construct, pGL2B. In previous studies, we have shown that RARb2 promoter function is partially repressed in breast cancer cell lines [21]. To determine whether RARb2 promoter constructs functioned normally in HeLa cells, we transfected these constructs, as well as an RARb2 expression construct [21], into HeLa cells, with and without 1 mM all-trans-retinoic acid. Figure 2 shows the mean of four transient transfection experiments performed in HeLa cells. All constructs, from D2 through D7, demonstrated significant transcriptional activation, as we have shown for normal human mammary epithelial cells [21], although activation varied from fragment to fragment, as has been previously shown [11]. These data demonstrate that promoter function is not altered by malignant transformation in HeLa cells. Generation of HeLa Cell Lines Expressing tRARb2 To assay the effects of tRARb2 on cell proliferation in HeLa cells, permanent cell lines resistant to G418 were generated. In general, 5- to 10-fold more clones were present in dishes containing the parent construct PREP9 than in the tRARb2-expressing dishes. Each time the experiment was performed with both constructs, more than 20 colonies were present in PREP9tRARb2-expressing dishes. Individual clones, representing the proliferative expansion of a single transfected cell, were visually identified and removed from the dish by trypsinization with a cloning ring. Depending on the clone, the tRARb2 transgene was present at two to four copies per mass culture, as determined by Southern analysis. Studies from a representative cell line are shown in Fig. 3. For these studies, DNA was purified from cell lines containing the PREP9 parent construct as well as those containing the tRARb2 transgene, quantitated, and then digested
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
with the restriction enzyme EcoRI. The digested DNA was then subjected to agarose gel electrophoresis, transferred to a nylon membrane, and then probed with a labeled RARb2 cDNA probe. Figure 3A shows an extra 1.7-kb fragment in the cell line containing the tRARb2 transgene (lane 2, double arrows) which is not present in the cell line containing the parent PREP-9 vector (lane 1). This suggests that the tRARb2 transgene is present in the cell lines. To determine whether the RARb2 messenger RNA from the transfected clone was actually expressed in the HeLa cell lines, we performed Northern analysis. In Fig. 3B, Northern analysis demonstrates the presence of low levels of the endogenous transcript RARb2, Ç1.6 kb in length, in HeLa cells, with 10-fold induction after 18 h of stimulation with 1 mM all-trans-retinoic acid (see single arrow in Fig. 3B, lanes 1 and 2). Total RNA extracted from a representative tRARb2 cell line demonstrated a distinct transcript of Ç1.7 kb in length (double arrows) and very low levels of the endogenous transcript (single arrow). These data suggest that the transfected gene is actively expressed in the G418-resistant HeLa cell lines. Furthermore, the low levels of endogenous transcript seen in the tRARb2 cell line suggest that the transfected gene does not induce high levels of the endogenous RARb2 transcript. Finally, to determine if the tRARb2 transgene modified binding to the b2RARE, we performed gel shift studies, with and without retinoic acid (Fig. 3C). Of interest, when compared to the control cell lines (Fig. 1B), the presence of the transgene increased specific binding to the b2RARE fourfold (Fig. 3C, lane 1), and this binding was specific in that it was effectively competed out by excess cold b2RARE (Fig. 3C, lane 2). The faint complex that migrates more slowly than the major complex is commonly seen when the gel is overloaded or overexposed. Of interest, the addition of 1 mM retinoic acid consistently decreased the binding twofold (Fig. 3C, lane 3), in comparison to an Sp1 control. Whether these small changes
AP: Exp Cell
106
SI ET AL.
FIG. 3. Southern, Northern, and gel shift analysis of a HeLa cell line expressing the tRARb2 transgene. (A) Southern blot showing the appearance of a 1.7-kb band in the tRARb2 cell line (lane 2, double arrow) that is not in the parent cell line (lane 1). (B) Northern analysis showing low levels of expression of endogenous RARb2 messenger RNA in HeLa cells (lane 1) and the induction of the endogenous RARb2 transcript by 1 mM all-trans-retinoic acid (lane 2). A 1.7-kb transcript from the tRARb2 transgene is seen in lane 3, where very low levels of the endogenous transcript are also seen. (C) Gel shift analysis of proteins binding to the b2RARE in a cell line carrying the tRARb2 transgene. In lane 1, a complex is seen binding to the b2RARE. This complex is successfully competed for by 100-fold excess cold b2RARE (lane 2). After stimulation with retinoic acid, a 2-fold decrease in binding to the b2RARE is seen (lane 3). This binding is also successfully competed for by the b2RARE (lane 4).
in binding have any physiological significance is unclear; however, it is important to note that the tRARb2 transgene did not induce the expression of novel complexes that bound to the b2RARE. Moreover, as shown in Fig. 1B, these observations are in marked contrast to the results we have obtained in breast cancer cell lines, where transcriptional repression of b2RARE is associated with multiple distinct complexes binding to the b2RARE [21].
results of studies performed on clone tRARb (tRARb2A). Each point on the graph represents the mean of two experiments performed and counted in duplicate ({SD). In these experiments, the presence of tRARb2 reduced cell number at Day 6 to 109,050 from the control value of 408,050, representing growth inhibition of 73.3%. There was no evidence of cell death in either the control dishes or the tRARb2 dishes. In all the clones examined for cell growth over a 6-day period, growth was inhibited from a maximum of 73.3%, as
Effect of RARb2 on Cell Proliferation If RARb2 plays a role in growth inhibition and tumor suppression, as has been suggested [21, 22, 25–27], it should be able to slow and/or inhibit the growth of cultured tumor cell lines. In order to test this hypothesis directly, we studied the growth characteristics of the tRARb2-expressing cell lines and compared them to cell lines expressing the parent vector construct PREP-9. In three separate transfection experiments, a series of 5 control cell lines and 5 tRARb2-expressing cell lines were generated from each transfection (15 transfected lines studied in duplicate). Selected clones were studied in detail. We first determined the effect of tRARb2 on the plating efficiency of a series of clones and determined that there was no significant difference in plating efficiency of the tRARb-expressing cells when compared to cells transfected with the parent PREP9 construct (data not shown). We then went on to examine the effect of tRARb2 on cell growth. For these experiments, cells were seeded at 20,000 cells per dish and counted on Days 1, 2, 3, and 6 after seeding. Figure 4 shows the
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
FIG. 4. Effect of tRARb2 on proliferation in HeLa cells. Growth curve showing inhibition of cell proliferation in HeLa cells containing the tRARb2 transgene (tRARb2-A) when compared to the control PREP-9 cell line (PREP-9-A). Each point represents the mean of two independent experiments counted twice. Error bars represent the standard deviation of the four determinations.
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
TABLE 1 Clone PREP-9A tRARb2-A PREP-9B tRARb2-B PREP-9C tRARb2-C PREP-9D tRARb2-D PREP-9E tRARb2-E
Cell number (SD) 408,050 109,050 1,595,300 1,007,450 546,000 276,500 683,500 430,900 911,600 581,600
% Inhibition
(17,832) (21,316) (165,552) (49,660) (36,430) (11,268) (60,727) (14,629) (25,114) (15,210)
73 37 50 37 36
Note. The results represent the mean of the cell number on Day 6 of two independent experiments with each of the five clones. SD, standard deviation.
shown in Fig. 4, to a minimum value of 37% when compared to control values (see Table 1). These data suggest that clonally derived, G418-resistant HeLa cells expressing tRARb2 are consistently growth inhibited to varying degrees by the presence of the RARb2 transgene. These data add further support to the notion that tRARb2 is an effective growth inhibitor of certain human tumor cell lines. Moreover, as the growth inhibition is a consistent finding in multiple cell lines on multiple occasions, it is likely to be a specific finding and unlikely to merely represent the nonspecific effect of overexpression on cell proliferation. As the protein for tRARb2 is thought to be ligandactivated, we next performed growth curves in the presence of 1 mM all-trans-retinoic acid. For these experiments, PREP-9B cells and tRARb2-B cells were seeded at 20,000 per dish in duplicate. On the first day after seeding, a group of each type of cells was treated with 1 mM all-trans-retinoic acid in ethanol daily for the next 5 days in DMEM with 10% FCS. Control cells were fed with equivalent amounts of ethanol in DMEM with 10% FCS. Cells from all four groups were trypsinized and counted on Days 1, 4, and 7 after seeding. A representative experiment is shown in Fig. 5A. The PREP9B cells grew the fastest with 838,800 ({14,078) cells evident in these dishes on Day 7. In contrast, the tRARb2-B cells were significantly growth inhibited with only 446,400 ({7910) cells present in these dishes. When 1 mM all-trans-retinoic acid was added to the parent PREP-9B cell line, growth inhibition was also seen, with 420,600 ({21,606) cells present in these dishes. Of interest, tRARb2 and 1 mM all-trans-retinoic acid provided a similar amount of growth inhibition in this assay system. Finally, addition of 1 mM all-transretinoic acid to the tRARb2-B cells inhibited growth even further, with only 269,100 ({14,581) cells present on Day 7. Other clones showed similar amounts of growth inhibition (data not shown). These observations show that the tRARb2 transgene inhibits the growth
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
107
of HeLa cells similarly to the addition of 1 mM retinoic acid. Moreover, the addition of 1 mM retinoic acid inhibits the tRARb2-B cell line further, suggesting that the receptors’ ability to inhibit cell proliferation can be augmented by pharmacological doses of ligand. We then went on to examine the effect of 0.1 mM alltrans-retinoic acid on the growth of these clones (Fig. 5B). These experiments were performed as described above, except that the concentration of added retinoic acid was less. These results (Fig. 5B) also clearly show that the presence of the tRARb2 transgene inhibited the proliferation of HeLa cells, with 911,600 ({19,452) cells present in the control PREP9-B dishes compared with 581,600 ({21,463) in tRARb2-B cell dishes. However, 0.1 mM all-trans-retinoic acid had almost no effect on the parent PREP9-B cells, decreasing cell numbers
FIG. 5. Effect of retinoic acid and tRARb2 on proliferation in HeLa cells. Growth curve showing inhibition of cell proliferation in the presence of the tRARb2 transgene (A) and 1 mM all-trans-retinoic acid (B) and 0.1 mM all-trans-retinoic acid. Each point represents the mean of two independent experiments counted twice. Error bars represent the standard deviation of the four determinations.
AP: Exp Cell
108
SI ET AL.
by 5%. In contrast, 0.1 mM all-trans-retinoic decreased cell numbers by almost 30% in the tRARb2 cell line. These data add further support to the notion that the tRARb2 transgene inhibits cell proliferation and further suggest that the receptors’ ability to inhibit proliferation is increased by the presence of exogenous ligand. Effect of tRARb2 on Anchorage-Independent Growth The tumorigenicity of cells in vivo correlates well with the ability of cells to form anchorage-independent colonies in vitro. To determine the effect of the tRARb2 transgene on anchorage-independent growth, we plated the cell lines, as described above, in soft agar. PREP9-C cells and tRARb2-C were plated at 5.8 1 105 per 60-mm dish in DMEM 10% FCS with 450 mg G418 and 0.5% agarose, alone, or with either 1 or 0.1 mM alltrans-retinoic acid. Colonies were counted on Day 14 by a investigator blinded to the protocol. It was grossly evident that in two of the three conditions, there were more colonies, and the colonies were larger in the PREP9-C cells (Figs. 6a–6c) than in the cell lines expressing the tRARb2 transgene (Figs. 6e–6g). Specifically, when PREP9-C was grown in standard medium (Fig. 6a), large colonies formed. However, 1 mM retinoic acid inhibited colony formation of the PREP9-C cell line (Fig. 6c), much as it had cell growth. In contrast, when the tRARb2-C cell line was examined in the soft agar assay, fewer colonies formed, and in general, they were much smaller in size (Figs. 6d–6f) than those generated in the parent cell line. Interestingly, in the presence of 1 mM all-trans-retinoic acid, the colonyforming abilities of tRARb2-C were completely inhibited (Fig. 6f). In two separate experiments on three different clones, we then quantitated our findings by counting 60 random fields of colonies in a blind fashion (Table 2). Under each condition, tRARb2 suppressed colony formation, although the amount of suppression varied. The most striking result was obtained in the experiments performed without added retinoic acid. In these experiments, the presence of the tRARb2 transgene inhibited anchorage-independent growth of HeLa cells by 48.4%. Of interest, 0.1 mM all-trans-retinoic acid consistently inhibited anchorage-independent growth of the parent HeLa cell lines to a significant degree in all clones tested (Table 2). This contrasts with the effect of this concentration of retinoic acid on cell proliferation, which was minimal (Fig. 5B), and suggests that the concentration of ligand needed to inhibit anchorage-independent growth is less than that required to inhibit cell proliferation, at least in this assay system. Whether distinct retinoid-regulated signal transduction pathways mediate the suppressive effects on cell proliferation and anchorage-independent growth could
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
not be determined from these studies. However, these data clearly show that HeLa cell lines expressing an RARb2 transgene demonstrate a significantly decreased amount of anchorage-independent growth, when compared to the parent cell lines. These observations add more strength to the argument that RARb2 is an effective inhibitor of anchorage-independent growth as well as of cell proliferation in human tumor cell lines where RARb2 is transactivated normally. DISCUSSION
Retinoids are known to inhibit cell proliferation and tumorigenesis in a variety of systems, both in vitro and in vivo, although how these agents inhibit growth is not well understood (1). Retinoid-regulated signal transduction pathways are well known to be complex and involve diverse ligands and their metabolites as well as cytoplasmic and nuclear receptors. Recent studies have demonstrated the existence of two distinct ligand-activated nuclear receptors for retinoids, the RARs and the RXRs, allowing further definition of potential mechanisms that retinoid-regulated signal transduction pathways may use to inhibit cell growth [2–15]. We have previously demonstrated the selective up-regulation of one retinoic acid receptor isoform, RARb2, in senescent cells with decreased proliferative capacity in vivo [21, 22]. Moreover, we also showed that RARb2 was as effective as the tumor suppressor gene p53 in inhibiting the ability of known oncogenes to form tumor foci in vitro [22]. These data suggest that, at least in certain situations in vitro, RARb2 can inhibit signals that drive cell proliferation and potentially, oncogenic transformation. In the experiments reported here, we have furthered our studies on the role of RARb2 as a retinoid receptor that can inhibit cell growth and transformation by demonstrating that HeLa cells, a human tumor cell line derived from the cervix, can be growth inhibited in vitro by the presence of a transfected RARb2 transgene. We also show that the basal growth inhibition exhibited by the RARb2-transfected cell lines can be increased by the addition of exogenous retinoic acid. We have also shown that transfected RARb2 inhibits anchorage independent growth, as well as inhibiting cell proliferation. These observations were all correlated with the presence of an endogenous RARb2 that could be induced by retinoic acid and was associated with gel shift and transient transfection studies demonstrating that the transcriptional regulation of RARb2 by retinoic acid was as in normal, nontransformed cells [19, 21]. These data contrast with studies in squamous cell carcinoma cell lines [25], lung cancer cell lines [26, 27], and breast cancer cell lines [21], where the RARb2 isoform cannot be induced by retinoic acid and is, most likely, transcriptionally repressed by
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
109
FIG. 6. Effect of tRARb2 on anchorage-independent growth in HeLa cells. (a) The parent PREP-9 cell line under standard conditions, (b) the parent PREP-9 cell line grown in 0.1 mM all-trans-retinoic acid, (c) the parent PREP-9 cell line grown in 1 mM all-trans-retinoic acid, (d) the tRARb2 cell line under standard conditions, (e) the tRARb2 cell line grown in 0.1 mM all-trans-retinoic acid, (f) the tRARb2 cell line grown in 1 mM all-trans-retinoic acid.
specific proteins binding to the 5* regulatory sequences of RARb2. The mechanisms RARb2 may use to inhibit the growth of tumor cells are unknown, but potentially fall into two broad categories. First, it has been shown that RARa, another member of the RAR multigene family, is a negative growth regulatory of AP-1 responsive genes [30]. AP-1 sites bind fos–jun heterodimers or jun–jun homodimers and are commonly found in the regulatory regions of genes that positively affect growth [31, 32]. In the experiments describing this inhibitory function for RARa, it was shown that an interaction between the RAR and the AP-1 proteins results in a mutual loss of DNA-binding activity [31, 32]. The RARs need not bind to the AP-1 site, nor does AP-1 need to bind to the retinoic acid response element [31, 32], thus suggesting the mechanism regulating this
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
process is a fundamental protein–protein interaction. While this AP-1 inhibitory function has not been definitively shown for RARb2, we feel that it is likely that RARb2 is also a negative growth regulatory of AP-1 responsive genes based on the high degree of known structural and functional homology between RARa and RARb2 [reviewed in 33]. These observations suggest that a protein–protein interaction between factors binding to AP-1 sites and RARb2 could inhibit the ability of certain cells to proliferate [30]. The development of a tumor cell assay where RARb2 can consistently inhibit cell proliferation, as described here, will now permit rapid delineation of the mechanisms that RARb2 uses to inhibit cell proliferation through the study of specific RARb2 mutants. As RARb2 is a modular protein, it will be important to ascertain the role of ligand binding, DNA binding, transcriptional activa-
AP: Exp Cell
110
SI ET AL.
TABLE 2 Colony No. Experiment
A
B
C
PREP9-C tRARb2-C PREP9-C (0.1 mM) tRARb2-C (0.1 mM) PREP9-C (1 mM) tRARb2-C (1 mM)
29.8 12.4 12.1 4.4 1 1
36.8 24.9 21.5 15.3 8.4 7.8
43.8 19.8 22 14.5 10.9 4.5
Mean (SD) 36.8 19 18.53 11.4 6.7 4.3
(7) (6.2) (5.6) (6.1) (5.14) (3.4)
% Inhibition
48.4 38.5 35.8
Note. The results represent the mean of the colony number at Day 14 of two independent experiments with each of the 3 clones. (SD, standard deviation).
tion, and dimerization on the ability of RARb2 to inhibit cell proliferation. It has been suggested that RARb2, as well as the other RARs, may require ligand for activation [32]. Whether this is true for the growth and anchorageindependent growth function we have demonstrated for RARb2 in HeLa cells could not be determined from the present study. It is possible that enough retinoic acid is present in fetal calf serum to activate the transfected receptor. We think that this is unlikely as endogenous RARb2 can be induced by low concentrations of retinoic acid [19], and this was not shown in our Northern analysis. Alternatively, HeLa cells may be able to metabolize retinol to retinoic acid and thus provide ligand for receptor activation. We also think that this is unlikely as this pathway should also induce the expression of the endogenous RARb2, which was not evident in our studies. It remains possible that growth inhibition may be a ligand-independent function of RARb2, with the growth inhibition mediated solely by the ability of RARb2 to interfere with AP-1 activation pathways. Experiments with ligand-binding mutants are presently in progress to determine the role of retinoic acid and receptor activation in the growth inhibition function of RARb2. As RARb2 is a transcription factor and binds to specific RAREs in order to regulate gene expression, it is also possible that RARb2 inhibits cell proliferation by transcriptionally up-regulating a gene that is involved in growth and/or transformation suppression. This has recently been demonstrated for the tumor suppressor gene p53, which up-regulates p21 (WAF-1, CIP-1, SDI1), a novel protein that is involved in tumor suppression [34–36]. Of interest, the expression of p21 is significantly up-regulated in senescent human dermal fibroblasts [35]. Whether genes with a function similar to that of p21 are induced by RARb2 in selected tissues, either in vitro or in vivo, remains to be determined. However, our Northern analysis does not demonstrate significant induction of the endogenous RARb2 by the transfected RARb2 transgene, suggesting that activa-
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
tion of gene expression may not be the mechanism responsible for RARb2-mediated growth inhibition. The experiments reported here are most compatible with a model where RARb2 inhibits proliferation in a ligandindependent manner, and the mechanism requires negative regulation of AP-1 responsive genes. Using the HeLa cell assay described here, studies are now in progress that will test this hypothesis directly. Previous studies from a series of groups [25, 26], as well as our own [21], have demonstrated differences in the expression of RARb2 between normal cells in culture and their malignant counterparts. Specifically, the ability of retinoids to induce RARb2 was altered and/ or absent in certain squamous cell carcinoma cell lines derived from the oral cavity [25], certain lung cancers [26, 27], and almost all breast cancer cell lines [21]. While the functional significance and the mechanism responsible for the loss of RARb2 expression in certain tumor cells is unknown, studies performed in breast cancer cell lines suggest that RARb2 maybe transcriptionally repressed by distinct proteins binding to response elements in the RARb2 promoter [21]. The RARb2 promoter has a series of well-defined response elements, an RARE [11], a AP-1 site [37], a CRE [37], an Spl site, and an Octabox site [37]. Preliminary studies from our laboratory (X. Lee, and M. Peacocke, unpublished observations), have shown that each of these response elements has an altered pattern of binding in the breast cancer cell lines when compared to normal, nontransformed cells. Whether this type of alteration is responsible for the transcriptional repression of RARb2 seen in certain tumor cells remains to be determined, and is certainly possible. From the functional point of view, it is intriguing to speculate that the loss of the ability of retinoic acid to induce a gene with a known growth-inhibiting function, such as RARb2, could be one step along the path to malignant transformation. In summary, we have demonstrated here that retinoic acid induces the expression of RARb2 in HeLa cells and that the signal transduction pathway leading to its induction has not been altered by malignant
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
transformation. We have also shown that a transfected RARb2 transgene inhibits the ability of HeLa cells to proliferate and that exogenous retinoic acid further increases the ability of the transgene to inhibit proliferation. Finally, we show that the transfected RARb2 transgene decreases the ability of HeLa cells to form colonies in soft agar. These data demonstrate that RARb2 effectively inhibits cell proliferation and anchorage-independent growth of certain tumor cell lines and provide more support for the notion that pathways regulated by RARb2 play a role in retinoid-regulated growth inhibition in vitro and, most likely, in vivo. The authors are grateful to Dr. Vimla Band for her help with the development of the soft agar assays. This work was supported by NIH grants AG-09927, AG-00694, and CA-66693, the American Institute for Cancer Research Grant to M.P., NIH Training Grant in Dermatology T32 AR07562 to H.C.T., and a Dermatology Foundation Fellowship from Roche Dermatologics to H.C.T.
REFERENCES 1. Hill, D. L., and Grubbs, C. J. (1992) Annu. Rev. Nutr. 12, 161– 181. 2. Petkovich, M., Brand, N., Krust, A., and Chambon, P. (1987) Nature 330, 444–450. 3. Gigue`re, V., Ong, E. S., Segui, P., and Evans, R. M. (1988) Nature 330, 624–629. 4. Brand, N., Petkovitch, M., Krust, A., Chambon, P., de The´, H., Marchio, A., Tiollais, P., and Dejean, A. (1988) Nature 330, 850–853. 5. Benbrook, D., Lernhardt, E., and Pfahl, M. (1988) Nature 333, 669–672. 6. Zelent, A., Krust, A., Petkovitch, M., Kastner, P., and Chambon, P. (1989) Nature 339, 714–717. 7. Krust, A., Kastner, P., Petkovitch, M., Zelent, A., and Chambon, P. (1989) Proc. Natl. Acad. Sci. USA 86, 5310–5314. 8. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A., and Evans, R. M. (1990) Nature 345, 224–229. 9. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R., Eichele, G., Evans, R. M., and Thaller, C. (1992) Cell 68, 397– 406. 10. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Huselton, C., Allenby, G., Speck, J., Kratzeisen, C., Rosenberger, M., Lovey, A., and Grippo, J. F. (1992) Nature 355, 359– 361. 11. de The´, H., del Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H., and Dejean, A. (1990) Nature 343, 177–180. 12. Leroy, P., Nakshatri, H., and Chambon, P. (1991) Proc. Natl. Acad. Sci. USA 88, 10138–10142. 13. Lehmann, J. M., Zhang, X. Z., and Pfahl, M. (1992) Mol. Cell Biol. 12, 2976–2985.
14. Mangelsdorf, D. J., Borgrneyer, U., Heyman, R. A., Zjou, J. Y., Ong, E. S., Oro, A. E., Kakizuka, A., and Evans, R. (1992) Genes Dev. 6, 329–344. 15. Leid, M., Kastner, P., Lyons, R., Nakshari, H., Saunders, M., Zachewski, T., Chen, J.-Y., Staub, A., Garnier, J.-M., Mader, S., and Chambon, P. (1992) Cell 68, 377–395. 16. Shubeita, H. E., Sambrook, J. F., and McCormick, A. M. (1987) Proc. Natl. Acad. Sci. USA 84, 5645–5649. 17. Stoner, C. M., and Gudas, L. M. (1989) Cancer Res. 49, 1497– 1504. 18. Gigue`re, V., Lyn, S., Yip, P., Siu, C. H., and Amin, S. (1990) Proc. Natl. Acad. Sci. USA 87, 6233–6237. 19. Tsou, H., Lee, X., Si, S. P., and Peacocke, M. (1994) Exp. Cell Res. 211, 74–81. 20. Si, S. P., Lee, X., Tsou, H., and Peacocke, M. (1995) Exp. Cell Res. 219, 243–248. 21. Swisshelm, K., Ryan, K., Lee, X., Tsou, H. C., Peacocke, M., and Sager, R. (1994) Cell Growth Differ. 5, 133–141. 22. Lee, X., Si, S. P., Tsou, H., and Peacocke, M. (1995) Exp. Cell Res. 218, 296–304. 23. Sager, R. (1985) Adv. Cancer Res. 44, 40–43. 24. Peacocke, M., and Campisi, J. (1991) J. Cell. Biochem. 45, 147– 155. 25. Hu, L., Crowe, D. L., Rheinwald, J. G., Chambon, P., and Gudas, L. (1991) Cancer Res. 51, 3972–3981. 26. Houle, B., Leduc, F., and Bradley, W. E. C. (1991) Genes, Chromosomes Cancer 3, 358–366. 27. Gebert, J. F., Moghal, N., Frangioni, J. V., Sugarbaker, D. J., and Neel, B. G. (1992) Oncogene 6, 1859–1868. 28. Peacocke, M., and Siminovitch, K. S. (1987) Proc. Natl. Acad. Sci. USA 84, 3430–3433. 29. Zelent, A., Mendelsohn, C., Kastner, P., Krust, A., Garnier, J. M., Ruffenach, F., Leroy, P., and Chambon, P. (1991) EMBO J. 10, 71–81. 30. Schu¨le, R., Ranggrajan, P., Yang, N., Kliewer, S., Ransome, L. J., Bolado, J., Verma, I., and Evans, R. M. (1991) Proc. Natl. Acad. Sci. USA 88, 6092–6096. 31. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rhamsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 49, 729–739. 32. Yang-Yen, H.-F., Zhang, X.-K., Graupner, G., Tzukerman, M., Sakamoto, B., Karin, M., and Pfahl, M. (1991) The New Biologist 3, 1206–1219. 33. Gigue`re, V. (1994) Endocr. Rev. 15, 61–79. 34. Harper, J. W., Adami, G. R., Wet, N., Keyomarsi, K., and Elledge, S. (1993) Cell 75, 805–816. 35. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817–825. 36. Noda, A., Ning, Y., Venable, S. F., Pereira-Smith, O. M., and Smith, J. (1994) Exp. Cell Res. 211, 90–98. 37. Shen, S., Kruyt, F. A. E., den Hertog, J., van der Saag, P., and Kruger, W. (1991) DNA Sequence 2, 111–119.
Received August 14, 1995 Revised version received October 25, 1995
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
111
AP: Exp Cell
223, 102–111 (1996)
0062
RARb2-Mediated Growth Inhibition in HeLa Cells SEONG PAN SI,* XINHUA LEE,* HUI C. TSOU,* RACHEL BUCHSBAUM,† ELMI TIBADUIZA,* AND MONICA PEACOCKE*,1 Departments of *Dermatology and †Medicine, New England Medical Center, and Tufts University School of Medicine, Boston, Massachusetts 02111
Retinoic acid inhibits the growth of a variety of normal and transformed cells in vitro and in vivo. How retinoic acid inhibits cell growth is poorly understood but involves interactions between the ligand and a series of nuclear and cytoplasmic receptors. The nuclear receptors for retinoic acid are of two types, the RARs and the RXRs. Each can function as a ligand-inducible transcription enhancing factor. In previous studies, we have demonstrated that an isoform of one RAR, RARb2, is transcriptionally up-regulated in senescent human dermal fibroblasts and senescent human mammary epithelial cells. Moreover, we have also shown that RARb2 can inhibit oncogene-induced focus formation, in primary rat embryo fibroblasts, as effectively as the tumor suppressor gene p53. Here, we extend our studies of retinoid-regulated signal transduction pathways that inhibit cell proliferation by demonstrating that HeLa cells expressing an RARb2 construct are growth inhibited by greater than 50% when compared to the parent cell lines. The RARb2expressing cell lines are inhibited further by the addition of exogenous all-trans-retinoic acid. Finally, soft agar assays show that the RARb2-expressing cell lines also demonstrate an inhibition of growth in soft agar, when compared to the parent cell lines, and are inhibited further in the presence of added all-trans-retinoic acid. These data definitively show that RARb2 can inhibit cell proliferation in an established tumor cell line and provide more strength to the notion that this isoform is an effective growth inhibitor in vitro and, most likely, in vivo. q 1996 Academic Press, Inc.
INTRODUCTION
Retinoic acid is known to inhibit cell proliferation in vitro and in vivo [reviewed in 1]. The signal transduction pathways used by retinoic acid to inhibit growth are not well defined, but most likely involve an interac1 To whom correspondence and reprint requests should be addressed at Department of Dermatology, VC-15, Columbia University, College of Physicians & Surgeons, 630 West 168th Street, New York, NY 10032. Fax: (212) 305-7882.
102
0014-4827/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
6I0A
/ m4861$3052
01-23-96 22:33:08
tion of retinoic acid with a series of nuclear and cytoplasmic receptors. Two types of nuclear receptors for retinoic acid have been identified, the RARs [2–7] and the RXRs [8–10]. Each receptor can function as a ligand-inducible transcription enhancing factor. Three distinct RARs have been described, RARa, RARb, and RARg [2–7], and each has a series of isoforms demonstrating different developmental and tissue-specific patterns of expression. Of interest, each of the RARs has an isoform that is regulated by retinoic acid, suggesting that the ligand can regulate the expression of its own receptor [11–13]. Three different RXRs also exist, RXRa, RXRb, and RXRg [8–10, 14, 15]. Finally, cytoplasmic receptors for retinoic acid have also been identified, the cellular retinoic acid binding proteins (CRABPs) [16–18]. These receptors are involved in the metabolism and transport of retinoic acid. In previous studies, we have demonstrated that alltrans-retinoic acid induced the expression of RARb, RARg, and CRABP-II in human dermal fibroblasts [19, 20]. Further studies demonstrated the selective transcriptional up-regulation of one isoform, RARb2, in senescent human mammary epithelial cells [21] and senescent human dermal fibroblasts [22]. As the growth inhibition characteristic of cellular senescence is felt to potentially be a mechanism of tumor suppression [23, 24], we went on to show that RARb2 could inhibit oncogene-induced focus formation as effectively as the wellcharacterized tumor suppressor gene p53 [22]. These data [22], combined with studies showing that certain tumor cell lines have lost the ability to express RARb2 [21, 25–27], provide more support for the possibility that RARb2 could function to inhibit the transformation of normal cells into immortal and potentially tumorigenic cells in vitro. In the experiments reported here, we extend our studies on the role of RARb2 as a nuclear receptor for retinoic acid that functions in a signal transduction pathway that inhibits cell proliferation. We first show that, in contrast to certain breast cancer cell lines where RARb2 is transcriptionally repressed [21], the RARb2 mRNA is induced normally by retinoic acid in HeLa cells. Moreover, complexes binding to the b2RARE in HeLa cells are similar to those found in
eca
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
normal human dermal fibroblasts [19, 22] and contrast with those found in certain breast cancer cell lines [21]. As would be predicted from the gel shift studies, we show that the RARb2 promoter constructs activate normally in HeLa cells, again contrasting with our previous observations in breast cancer cell lines, where the RARb2 promoter is transcriptionally repressed. HeLa cells transfected with an RARb2 expression construct demonstrate a significant reduction in growth when compared to parent cell lines. Addition of retinoic acid to the RARb2-expressing cell lines further inhibits their ability to proliferate. Assays performed in soft agar also demonstrate that RARb2 inhibits the anchorage-independent growth of these tumor cells. These data demonstrate that RARb2 effectively inhibits cell proliferation and anchorage-independent growth of certain tumor cell lines and provide more support for the notion that pathways regulated by RARb2 play a role in retinoid-regulated growth inhibition in vitro and, most likely, in vivo. MATERIALS AND METHODS Cell culture and growth experiments. HeLa cells were obtained from the American Type Culture Collection and routinely grown in Dulbecco’s minimum essential medium (DMEM) supplemented with 10% fetal calf serum (FCS). They were passed routinely at confluence. For growth curves, cells from the various cell lines were seeded in duplicate at 2 1 104 cells per 35-mm dish, trypsinized, and counted on various days after seeding using a Coulter counter (Model Zf). For experiments requiring the addition of ligand, retinoic acid was prepared fresh for each experiment at a concentration of 10 mM retinoic acid and used to stimulate cells at a final concentration of 1 mM. For the studies of anchorage-independent growth, performed in soft agar, HeLa cells containing the different expression constructs were plated at a concentration of 5.8 1 105 cells per 60-mm dish in DMEM with 10% FCS, 450 mg/ml G418, and 0.5% agarose, alone or in either 1 or 0.01 mM retinoic acid. The agarose-containing cultures were fed three times weekly. Colonies were counted on Day 14 after seeding by an investigator blinded to the experimental protocol. Colonies were those clumps with greater than 10 cells. For growth curves and anchorage-independent growth retinoic acid was made fresh and added to the cultures three times weekly. Northern and Southern analysis. Total cellular RNA was isolated with 4 M guanidine isothiocyanate and purified through a 5.7 M cesium chloride cushion as described [19, 20, 22]. The RNA was quantitated, and 10–30 mg of total cellular RNA was then size-fractionated through a 1% agarose gel containing 2.2 M formaldehyde and transferred to a nylon membrane (Hybond-N, Amersham). Probes for RARa, RARb, and RARg were oligo-labeled and hybridized as described [19, 22]. Autoradiography was performed on XAR film, with two intensifying screens at 0707C. The RARa probe (the gift of Pierre Chambon) is a 1.6-kb Kpn–EcoRI fragment of RARa cDNA in the plasmid p63 [2]. The RARb probe (the gift of Magnus Pfahl) is a 0.6-kb EcoRI fragment of the RARb cDNA site in the plasmid B1 [5]. The RARg probe (the gift of Pierre Chambon) is a 1.6-kb EcoRI fragment of RARg cDNA cloned in the plasmid pS65 [6, 7]. L7 (the gift of Joseph Nevins, originally known as pHE7) is a 300-bp piece in the Pst site of pGEM-1 [19]. Densitometric analysis of blots was performed by scanning of autoradiographs with Lightning Scan Pro/256 and a Macintosh IIci computer using Image 1.33 as analytical software. For Southern analysis, DNA was extracted
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
103
from cells, size-fractionated, and transferred as described [28]. Hybridization conditions and cDNA probes for Southern blotting were as for Northern analysis. Gel retardation assay. For these experiments, HeLa cells were growth arrested in 0.5% FCS in DMEM for 24 h and then stimulated with 1 mM retinoic acid for 18 h. The remainder of the preparation of nuclear extracts was as described [19]. Final protein concentrations used were 0.8–1.0 mg/ml. Oligonucleotides for the response element were synthesized commercially as b2RARE (GGGTAGGGTTCACCGAAAGTTCACTCG) [11, 19, 21]. DNA–protein binding was conducted in a volume of 20 ml. For the incubations, 3–5 mg was incubated with 1 mg poly(dI-dC) and 0.5–1.0 ng of 32P-labeled synthetic oligonucleotide (about 1 1 105 cpm) in a binding buffer (10 mM Hepes, pH 7.9, 10% glycerol, 50 mM KCl, 0.1 mM EDTA, 2.5 mM MgCl2, 1 mM DTT) for 20 min at room temperature. To ensure specificity of binding, 100-fold excess unlabeled oligonucleotide was added to incubations with the labeled fragments. Equal loading of lanes was performed with binding to an Sp1 element. DNA–protein complexes were resolved on 5% polyacrylamide gels in 0.51 TBE. The gels were dried and autoradiographed with intensifying screens at 0707C. RARb2 promoter constructs. A series of reporter constructs similar to those previously described were generated [11] except that the parent vector was pGL2-basic (Promega Corp., Madison, WI.), which contains a cDNA encoding the firefly luciferase gene and a multiple cloning site for the insertion of DNA fragments. The constructs were generated as follows: pb2–1.51uc (D2) contains a 1.65-kb fragment cloned into the PstI and BamHI site of the pGL2-basic vector, pb2– 7471uc (D3) contains a 902-bp fragment cloned into the BglII and BamHI site of the pGL2-basic vector, pb2–5221uc (D4) contains a 677-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of the pGL2-basic vector, pb2–2861uc (D5) contains a 441-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of the pGL2-basic vector, pb2–2431uc (D6) contains a 398-bp fragment cloned in a blunt-ended ligation into an XhoI and HindIII site of pGL2-basic vector, pb2–1241uc (D7) contains a 279bp fragment cloned into the SacI and BamHI site of pGL2-basic vector. Correct orientation of all clones was verified by DNA sequencing. To generate an expression construct for RARb2, the entire coding sequence of the RARb2 isoform [29] was cloned into PREP9 (Promega Corp., Madison, WI), a vector that contains an RSV promoter, and a selectable marker for Neomycin [21]. Correct orientation of the PREP9–RARb2 was verified by DNA sequencing. Transient transfection. Transient transfection was performed by calcium phosphate precipitation as described [22]. Briefly, HeLa cells were grown in standard medium, trypsinized, and counted. Twentyfour hours prior to transfection, the cells were seeded into 60-mm dishes at a concentration of 1.5 1 105 cells per dish, in duplicate, in standard medium. Two to four hours prior to transfection, the medium of the cells was changed. Expression vector DNA and promoter construct DNA were then mixed with 12–15 mg salmon sperm carrier DNA in a small volume in a buffer, vortexed, and then allowed to sit at room temperature for 20 min. The relevant DNA mixtures were added dropwise to the plated cells in the medium, swirled, and allowed to incubate with the cells for 16 h at 377C. The following morning, the medium was changed. Eighteen hours prior to the reported assay, freshly prepared retinoic acid (1 mM) was added to the appropriate cultures. The luciferase assay was performed as described [21]. Normalization to b-galactosidase was performed using a chemiluminescent technique according to manufacturer’s specifications (Tropix, Inc., Bedford, MA). Stable transfection. For these studies, HeLa cells were transfected with PREP9–RARb2 (tRARb2) as described above, or the basic PREP9 expression vector. The day following transfection, the medium of the cells was replaced with DMEM with 10% FCS and G418 at a concentration of 450 mg/ml G418. Both PREP9– RARb2 and PREP9 containing HeLa cells were then feed three times
AP: Exp Cell
104
SI ET AL.
weekly with G418-containing medium. Two to three weeks after transfection, individual clones were evident in all dishes. Five individual clones were removed from each dish of the PREP9–RARb2containing and the PREP9-containing HeLa cells by trypsinization with a cloning ring. Each clone was expanded in a selection medium containing G418, and vials of the individual, expanded clones were frozen.
RESULTS
RARb2-Mediated Signal Transduction Is Not Altered in HeLa Cells In previous studies, we have shown that RARb2 is repressed in certain breast cancer cell lines and that repression is mediated, at least in part, by complexes binding to the retinoic acid response element (RARE) found in the RARb2 promoter [21]. Thus, whether transcriptional repression of RARb2 was characteristic of all tumor cells, including HeLa cells, remained to be determined. For these studies, HeLa cells were first grown in DMEM with 10% FCS until 70% confluent, and then the serum concentration was decreased to 0.5% overnight. This maneuver minimized the concentration of retinoids present in serum on gene expression. The HeLa cells were then treated with 1 mM alltrans-retinoic acid overnight. Total cellular RNA was then extracted, and Northern blotting studies were performed. Examination of Fig. 1A demonstrates that HeLa cells express low levels of RARa and RARg and almost undetectable levels of RARb2 messenger RNA. These data are similar to those from studies we performed in dermal fibroblasts and normal human mammary epithelial cells [19, 21]. When HeLa cells are stimulated overnight with 1 mM all-trans-retinoic acid, we see 4-fold induction of RARa, 12-fold induction of RARb2, and 8-fold induction of RARg (Fig. 1A). These observations demonstrate that all-trans-retinoic acid induces the expression of all three RARs, but has a greater effect on the expression of RARb2. Moreover, in contrast to observations made in breast cancer cell lines [21], these data suggest that RARb2-mediated signal transduction is not altered in HeLa cells and show that transcriptional repression of RARb2 is not a general feature of all human tumors cultured in vitro. We next determined whether the binding of complexes to the b2RARE was altered in HeLa cells, as it is in certain breast cancer cell lines [21]. For these studies, HeLa cells were grown to 70% confluence, and then the serum concentration was decreased to 0.5% for 24 h. Control cells were stimulated with ethanol alone, while other cells were stimulated overnight with 1 mM all-trans-retinoic acid. Nuclear proteins were prepared and incubated with labeled b2RARE and then separated by gel electrophoresis. The results of these experiments are shown in Fig. 1B. Lane 1 shows a single complex binding to the b2RARE in control HeLa
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
FIG. 1. Northern blotting and gel shift analysis of retinoic acidregulated signal transduction in HeLa cells. (A) HeLa cells were stimulated overnight with 1 mM all-trans-retinoic acid. RARa demonstrates low levels of constitutive expression (C) while 1 mM all-transretinoic acid increases this basal level 4-fold (RA). RARb2 is barely detectable in unstimulated cells (C) but increases 12-fold after stimulation with retinoic acid (RA). RARg mRNA is present at low levels in unstimulated cells (C), but increases 8-fold after stimulation with retinoic acid (RA). L7 serves as a control for equal loading of all lanes. (B) Gel shift analysis of binding of proteins to the b2RARE. In lane 1, a single complex is seen binding to the b2RARE. This complex is successfully competed for by 100-fold excess cold b2RARE (lane 2). After stimulation with retinoic acid, a 2-fold increase in binding to the b2RARE is seen (lane 3). This binding is also successfully competed for by the b2RARE (lane 4).
cells (see double arrows). In lane 2, this binding is successfully competed for by 100-fold excess cold b2RARE. When 1 mM all-trans-retinoic acid is added to the cells, there is a 2-fold increase in binding to the b2RARE (lane 3), and this binding is also successfully competed out by excess cold b2RARE (lane 4). These results are similar to those we have reported for normal human dermal fibroblasts [19], where a single complex binds to the b2RARE. Binding to an Sp1 site showed equivalent binding, and at times a 2-fold increase after retinoic acid treatment. While the physiological significance of small increases in binding is unclear, these observations are in marked contrast to the results we have obtained in breast cancer cell lines, where transcriptional repression of b2RARE is associated with multiple distinct complexes binding to the b2RARE [21]. These observations add support to the notion that RARb2-mediated signal transduction is not altered significantly in HeLa cells. Finally, in order to examine promoter function, we
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
105
FIG. 2. Transient transfection of RARb2 promoter fragments into HeLa cells treated with retinoic acid. Fragments D2 through D7, as illustrated, show transcriptional activation varying from 4- to 12-fold in response to 1 mM all-trans-retinoic acid.
generated a series of deletion mutants covering 1.6 kb of the RARb2 promoter as described [11] and cloned them into a luciferase reporter construct, pGL2B. In previous studies, we have shown that RARb2 promoter function is partially repressed in breast cancer cell lines [21]. To determine whether RARb2 promoter constructs functioned normally in HeLa cells, we transfected these constructs, as well as an RARb2 expression construct [21], into HeLa cells, with and without 1 mM all-trans-retinoic acid. Figure 2 shows the mean of four transient transfection experiments performed in HeLa cells. All constructs, from D2 through D7, demonstrated significant transcriptional activation, as we have shown for normal human mammary epithelial cells [21], although activation varied from fragment to fragment, as has been previously shown [11]. These data demonstrate that promoter function is not altered by malignant transformation in HeLa cells. Generation of HeLa Cell Lines Expressing tRARb2 To assay the effects of tRARb2 on cell proliferation in HeLa cells, permanent cell lines resistant to G418 were generated. In general, 5- to 10-fold more clones were present in dishes containing the parent construct PREP9 than in the tRARb2-expressing dishes. Each time the experiment was performed with both constructs, more than 20 colonies were present in PREP9tRARb2-expressing dishes. Individual clones, representing the proliferative expansion of a single transfected cell, were visually identified and removed from the dish by trypsinization with a cloning ring. Depending on the clone, the tRARb2 transgene was present at two to four copies per mass culture, as determined by Southern analysis. Studies from a representative cell line are shown in Fig. 3. For these studies, DNA was purified from cell lines containing the PREP9 parent construct as well as those containing the tRARb2 transgene, quantitated, and then digested
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
with the restriction enzyme EcoRI. The digested DNA was then subjected to agarose gel electrophoresis, transferred to a nylon membrane, and then probed with a labeled RARb2 cDNA probe. Figure 3A shows an extra 1.7-kb fragment in the cell line containing the tRARb2 transgene (lane 2, double arrows) which is not present in the cell line containing the parent PREP-9 vector (lane 1). This suggests that the tRARb2 transgene is present in the cell lines. To determine whether the RARb2 messenger RNA from the transfected clone was actually expressed in the HeLa cell lines, we performed Northern analysis. In Fig. 3B, Northern analysis demonstrates the presence of low levels of the endogenous transcript RARb2, Ç1.6 kb in length, in HeLa cells, with 10-fold induction after 18 h of stimulation with 1 mM all-trans-retinoic acid (see single arrow in Fig. 3B, lanes 1 and 2). Total RNA extracted from a representative tRARb2 cell line demonstrated a distinct transcript of Ç1.7 kb in length (double arrows) and very low levels of the endogenous transcript (single arrow). These data suggest that the transfected gene is actively expressed in the G418-resistant HeLa cell lines. Furthermore, the low levels of endogenous transcript seen in the tRARb2 cell line suggest that the transfected gene does not induce high levels of the endogenous RARb2 transcript. Finally, to determine if the tRARb2 transgene modified binding to the b2RARE, we performed gel shift studies, with and without retinoic acid (Fig. 3C). Of interest, when compared to the control cell lines (Fig. 1B), the presence of the transgene increased specific binding to the b2RARE fourfold (Fig. 3C, lane 1), and this binding was specific in that it was effectively competed out by excess cold b2RARE (Fig. 3C, lane 2). The faint complex that migrates more slowly than the major complex is commonly seen when the gel is overloaded or overexposed. Of interest, the addition of 1 mM retinoic acid consistently decreased the binding twofold (Fig. 3C, lane 3), in comparison to an Sp1 control. Whether these small changes
AP: Exp Cell
106
SI ET AL.
FIG. 3. Southern, Northern, and gel shift analysis of a HeLa cell line expressing the tRARb2 transgene. (A) Southern blot showing the appearance of a 1.7-kb band in the tRARb2 cell line (lane 2, double arrow) that is not in the parent cell line (lane 1). (B) Northern analysis showing low levels of expression of endogenous RARb2 messenger RNA in HeLa cells (lane 1) and the induction of the endogenous RARb2 transcript by 1 mM all-trans-retinoic acid (lane 2). A 1.7-kb transcript from the tRARb2 transgene is seen in lane 3, where very low levels of the endogenous transcript are also seen. (C) Gel shift analysis of proteins binding to the b2RARE in a cell line carrying the tRARb2 transgene. In lane 1, a complex is seen binding to the b2RARE. This complex is successfully competed for by 100-fold excess cold b2RARE (lane 2). After stimulation with retinoic acid, a 2-fold decrease in binding to the b2RARE is seen (lane 3). This binding is also successfully competed for by the b2RARE (lane 4).
in binding have any physiological significance is unclear; however, it is important to note that the tRARb2 transgene did not induce the expression of novel complexes that bound to the b2RARE. Moreover, as shown in Fig. 1B, these observations are in marked contrast to the results we have obtained in breast cancer cell lines, where transcriptional repression of b2RARE is associated with multiple distinct complexes binding to the b2RARE [21].
results of studies performed on clone tRARb (tRARb2A). Each point on the graph represents the mean of two experiments performed and counted in duplicate ({SD). In these experiments, the presence of tRARb2 reduced cell number at Day 6 to 109,050 from the control value of 408,050, representing growth inhibition of 73.3%. There was no evidence of cell death in either the control dishes or the tRARb2 dishes. In all the clones examined for cell growth over a 6-day period, growth was inhibited from a maximum of 73.3%, as
Effect of RARb2 on Cell Proliferation If RARb2 plays a role in growth inhibition and tumor suppression, as has been suggested [21, 22, 25–27], it should be able to slow and/or inhibit the growth of cultured tumor cell lines. In order to test this hypothesis directly, we studied the growth characteristics of the tRARb2-expressing cell lines and compared them to cell lines expressing the parent vector construct PREP-9. In three separate transfection experiments, a series of 5 control cell lines and 5 tRARb2-expressing cell lines were generated from each transfection (15 transfected lines studied in duplicate). Selected clones were studied in detail. We first determined the effect of tRARb2 on the plating efficiency of a series of clones and determined that there was no significant difference in plating efficiency of the tRARb-expressing cells when compared to cells transfected with the parent PREP9 construct (data not shown). We then went on to examine the effect of tRARb2 on cell growth. For these experiments, cells were seeded at 20,000 cells per dish and counted on Days 1, 2, 3, and 6 after seeding. Figure 4 shows the
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
FIG. 4. Effect of tRARb2 on proliferation in HeLa cells. Growth curve showing inhibition of cell proliferation in HeLa cells containing the tRARb2 transgene (tRARb2-A) when compared to the control PREP-9 cell line (PREP-9-A). Each point represents the mean of two independent experiments counted twice. Error bars represent the standard deviation of the four determinations.
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
TABLE 1 Clone PREP-9A tRARb2-A PREP-9B tRARb2-B PREP-9C tRARb2-C PREP-9D tRARb2-D PREP-9E tRARb2-E
Cell number (SD) 408,050 109,050 1,595,300 1,007,450 546,000 276,500 683,500 430,900 911,600 581,600
% Inhibition
(17,832) (21,316) (165,552) (49,660) (36,430) (11,268) (60,727) (14,629) (25,114) (15,210)
73 37 50 37 36
Note. The results represent the mean of the cell number on Day 6 of two independent experiments with each of the five clones. SD, standard deviation.
shown in Fig. 4, to a minimum value of 37% when compared to control values (see Table 1). These data suggest that clonally derived, G418-resistant HeLa cells expressing tRARb2 are consistently growth inhibited to varying degrees by the presence of the RARb2 transgene. These data add further support to the notion that tRARb2 is an effective growth inhibitor of certain human tumor cell lines. Moreover, as the growth inhibition is a consistent finding in multiple cell lines on multiple occasions, it is likely to be a specific finding and unlikely to merely represent the nonspecific effect of overexpression on cell proliferation. As the protein for tRARb2 is thought to be ligandactivated, we next performed growth curves in the presence of 1 mM all-trans-retinoic acid. For these experiments, PREP-9B cells and tRARb2-B cells were seeded at 20,000 per dish in duplicate. On the first day after seeding, a group of each type of cells was treated with 1 mM all-trans-retinoic acid in ethanol daily for the next 5 days in DMEM with 10% FCS. Control cells were fed with equivalent amounts of ethanol in DMEM with 10% FCS. Cells from all four groups were trypsinized and counted on Days 1, 4, and 7 after seeding. A representative experiment is shown in Fig. 5A. The PREP9B cells grew the fastest with 838,800 ({14,078) cells evident in these dishes on Day 7. In contrast, the tRARb2-B cells were significantly growth inhibited with only 446,400 ({7910) cells present in these dishes. When 1 mM all-trans-retinoic acid was added to the parent PREP-9B cell line, growth inhibition was also seen, with 420,600 ({21,606) cells present in these dishes. Of interest, tRARb2 and 1 mM all-trans-retinoic acid provided a similar amount of growth inhibition in this assay system. Finally, addition of 1 mM all-transretinoic acid to the tRARb2-B cells inhibited growth even further, with only 269,100 ({14,581) cells present on Day 7. Other clones showed similar amounts of growth inhibition (data not shown). These observations show that the tRARb2 transgene inhibits the growth
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
107
of HeLa cells similarly to the addition of 1 mM retinoic acid. Moreover, the addition of 1 mM retinoic acid inhibits the tRARb2-B cell line further, suggesting that the receptors’ ability to inhibit cell proliferation can be augmented by pharmacological doses of ligand. We then went on to examine the effect of 0.1 mM alltrans-retinoic acid on the growth of these clones (Fig. 5B). These experiments were performed as described above, except that the concentration of added retinoic acid was less. These results (Fig. 5B) also clearly show that the presence of the tRARb2 transgene inhibited the proliferation of HeLa cells, with 911,600 ({19,452) cells present in the control PREP9-B dishes compared with 581,600 ({21,463) in tRARb2-B cell dishes. However, 0.1 mM all-trans-retinoic acid had almost no effect on the parent PREP9-B cells, decreasing cell numbers
FIG. 5. Effect of retinoic acid and tRARb2 on proliferation in HeLa cells. Growth curve showing inhibition of cell proliferation in the presence of the tRARb2 transgene (A) and 1 mM all-trans-retinoic acid (B) and 0.1 mM all-trans-retinoic acid. Each point represents the mean of two independent experiments counted twice. Error bars represent the standard deviation of the four determinations.
AP: Exp Cell
108
SI ET AL.
by 5%. In contrast, 0.1 mM all-trans-retinoic decreased cell numbers by almost 30% in the tRARb2 cell line. These data add further support to the notion that the tRARb2 transgene inhibits cell proliferation and further suggest that the receptors’ ability to inhibit proliferation is increased by the presence of exogenous ligand. Effect of tRARb2 on Anchorage-Independent Growth The tumorigenicity of cells in vivo correlates well with the ability of cells to form anchorage-independent colonies in vitro. To determine the effect of the tRARb2 transgene on anchorage-independent growth, we plated the cell lines, as described above, in soft agar. PREP9-C cells and tRARb2-C were plated at 5.8 1 105 per 60-mm dish in DMEM 10% FCS with 450 mg G418 and 0.5% agarose, alone, or with either 1 or 0.1 mM alltrans-retinoic acid. Colonies were counted on Day 14 by a investigator blinded to the protocol. It was grossly evident that in two of the three conditions, there were more colonies, and the colonies were larger in the PREP9-C cells (Figs. 6a–6c) than in the cell lines expressing the tRARb2 transgene (Figs. 6e–6g). Specifically, when PREP9-C was grown in standard medium (Fig. 6a), large colonies formed. However, 1 mM retinoic acid inhibited colony formation of the PREP9-C cell line (Fig. 6c), much as it had cell growth. In contrast, when the tRARb2-C cell line was examined in the soft agar assay, fewer colonies formed, and in general, they were much smaller in size (Figs. 6d–6f) than those generated in the parent cell line. Interestingly, in the presence of 1 mM all-trans-retinoic acid, the colonyforming abilities of tRARb2-C were completely inhibited (Fig. 6f). In two separate experiments on three different clones, we then quantitated our findings by counting 60 random fields of colonies in a blind fashion (Table 2). Under each condition, tRARb2 suppressed colony formation, although the amount of suppression varied. The most striking result was obtained in the experiments performed without added retinoic acid. In these experiments, the presence of the tRARb2 transgene inhibited anchorage-independent growth of HeLa cells by 48.4%. Of interest, 0.1 mM all-trans-retinoic acid consistently inhibited anchorage-independent growth of the parent HeLa cell lines to a significant degree in all clones tested (Table 2). This contrasts with the effect of this concentration of retinoic acid on cell proliferation, which was minimal (Fig. 5B), and suggests that the concentration of ligand needed to inhibit anchorage-independent growth is less than that required to inhibit cell proliferation, at least in this assay system. Whether distinct retinoid-regulated signal transduction pathways mediate the suppressive effects on cell proliferation and anchorage-independent growth could
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
not be determined from these studies. However, these data clearly show that HeLa cell lines expressing an RARb2 transgene demonstrate a significantly decreased amount of anchorage-independent growth, when compared to the parent cell lines. These observations add more strength to the argument that RARb2 is an effective inhibitor of anchorage-independent growth as well as of cell proliferation in human tumor cell lines where RARb2 is transactivated normally. DISCUSSION
Retinoids are known to inhibit cell proliferation and tumorigenesis in a variety of systems, both in vitro and in vivo, although how these agents inhibit growth is not well understood (1). Retinoid-regulated signal transduction pathways are well known to be complex and involve diverse ligands and their metabolites as well as cytoplasmic and nuclear receptors. Recent studies have demonstrated the existence of two distinct ligand-activated nuclear receptors for retinoids, the RARs and the RXRs, allowing further definition of potential mechanisms that retinoid-regulated signal transduction pathways may use to inhibit cell growth [2–15]. We have previously demonstrated the selective up-regulation of one retinoic acid receptor isoform, RARb2, in senescent cells with decreased proliferative capacity in vivo [21, 22]. Moreover, we also showed that RARb2 was as effective as the tumor suppressor gene p53 in inhibiting the ability of known oncogenes to form tumor foci in vitro [22]. These data suggest that, at least in certain situations in vitro, RARb2 can inhibit signals that drive cell proliferation and potentially, oncogenic transformation. In the experiments reported here, we have furthered our studies on the role of RARb2 as a retinoid receptor that can inhibit cell growth and transformation by demonstrating that HeLa cells, a human tumor cell line derived from the cervix, can be growth inhibited in vitro by the presence of a transfected RARb2 transgene. We also show that the basal growth inhibition exhibited by the RARb2-transfected cell lines can be increased by the addition of exogenous retinoic acid. We have also shown that transfected RARb2 inhibits anchorage independent growth, as well as inhibiting cell proliferation. These observations were all correlated with the presence of an endogenous RARb2 that could be induced by retinoic acid and was associated with gel shift and transient transfection studies demonstrating that the transcriptional regulation of RARb2 by retinoic acid was as in normal, nontransformed cells [19, 21]. These data contrast with studies in squamous cell carcinoma cell lines [25], lung cancer cell lines [26, 27], and breast cancer cell lines [21], where the RARb2 isoform cannot be induced by retinoic acid and is, most likely, transcriptionally repressed by
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
109
FIG. 6. Effect of tRARb2 on anchorage-independent growth in HeLa cells. (a) The parent PREP-9 cell line under standard conditions, (b) the parent PREP-9 cell line grown in 0.1 mM all-trans-retinoic acid, (c) the parent PREP-9 cell line grown in 1 mM all-trans-retinoic acid, (d) the tRARb2 cell line under standard conditions, (e) the tRARb2 cell line grown in 0.1 mM all-trans-retinoic acid, (f) the tRARb2 cell line grown in 1 mM all-trans-retinoic acid.
specific proteins binding to the 5* regulatory sequences of RARb2. The mechanisms RARb2 may use to inhibit the growth of tumor cells are unknown, but potentially fall into two broad categories. First, it has been shown that RARa, another member of the RAR multigene family, is a negative growth regulatory of AP-1 responsive genes [30]. AP-1 sites bind fos–jun heterodimers or jun–jun homodimers and are commonly found in the regulatory regions of genes that positively affect growth [31, 32]. In the experiments describing this inhibitory function for RARa, it was shown that an interaction between the RAR and the AP-1 proteins results in a mutual loss of DNA-binding activity [31, 32]. The RARs need not bind to the AP-1 site, nor does AP-1 need to bind to the retinoic acid response element [31, 32], thus suggesting the mechanism regulating this
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
process is a fundamental protein–protein interaction. While this AP-1 inhibitory function has not been definitively shown for RARb2, we feel that it is likely that RARb2 is also a negative growth regulatory of AP-1 responsive genes based on the high degree of known structural and functional homology between RARa and RARb2 [reviewed in 33]. These observations suggest that a protein–protein interaction between factors binding to AP-1 sites and RARb2 could inhibit the ability of certain cells to proliferate [30]. The development of a tumor cell assay where RARb2 can consistently inhibit cell proliferation, as described here, will now permit rapid delineation of the mechanisms that RARb2 uses to inhibit cell proliferation through the study of specific RARb2 mutants. As RARb2 is a modular protein, it will be important to ascertain the role of ligand binding, DNA binding, transcriptional activa-
AP: Exp Cell
110
SI ET AL.
TABLE 2 Colony No. Experiment
A
B
C
PREP9-C tRARb2-C PREP9-C (0.1 mM) tRARb2-C (0.1 mM) PREP9-C (1 mM) tRARb2-C (1 mM)
29.8 12.4 12.1 4.4 1 1
36.8 24.9 21.5 15.3 8.4 7.8
43.8 19.8 22 14.5 10.9 4.5
Mean (SD) 36.8 19 18.53 11.4 6.7 4.3
(7) (6.2) (5.6) (6.1) (5.14) (3.4)
% Inhibition
48.4 38.5 35.8
Note. The results represent the mean of the colony number at Day 14 of two independent experiments with each of the 3 clones. (SD, standard deviation).
tion, and dimerization on the ability of RARb2 to inhibit cell proliferation. It has been suggested that RARb2, as well as the other RARs, may require ligand for activation [32]. Whether this is true for the growth and anchorageindependent growth function we have demonstrated for RARb2 in HeLa cells could not be determined from the present study. It is possible that enough retinoic acid is present in fetal calf serum to activate the transfected receptor. We think that this is unlikely as endogenous RARb2 can be induced by low concentrations of retinoic acid [19], and this was not shown in our Northern analysis. Alternatively, HeLa cells may be able to metabolize retinol to retinoic acid and thus provide ligand for receptor activation. We also think that this is unlikely as this pathway should also induce the expression of the endogenous RARb2, which was not evident in our studies. It remains possible that growth inhibition may be a ligand-independent function of RARb2, with the growth inhibition mediated solely by the ability of RARb2 to interfere with AP-1 activation pathways. Experiments with ligand-binding mutants are presently in progress to determine the role of retinoic acid and receptor activation in the growth inhibition function of RARb2. As RARb2 is a transcription factor and binds to specific RAREs in order to regulate gene expression, it is also possible that RARb2 inhibits cell proliferation by transcriptionally up-regulating a gene that is involved in growth and/or transformation suppression. This has recently been demonstrated for the tumor suppressor gene p53, which up-regulates p21 (WAF-1, CIP-1, SDI1), a novel protein that is involved in tumor suppression [34–36]. Of interest, the expression of p21 is significantly up-regulated in senescent human dermal fibroblasts [35]. Whether genes with a function similar to that of p21 are induced by RARb2 in selected tissues, either in vitro or in vivo, remains to be determined. However, our Northern analysis does not demonstrate significant induction of the endogenous RARb2 by the transfected RARb2 transgene, suggesting that activa-
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
tion of gene expression may not be the mechanism responsible for RARb2-mediated growth inhibition. The experiments reported here are most compatible with a model where RARb2 inhibits proliferation in a ligandindependent manner, and the mechanism requires negative regulation of AP-1 responsive genes. Using the HeLa cell assay described here, studies are now in progress that will test this hypothesis directly. Previous studies from a series of groups [25, 26], as well as our own [21], have demonstrated differences in the expression of RARb2 between normal cells in culture and their malignant counterparts. Specifically, the ability of retinoids to induce RARb2 was altered and/ or absent in certain squamous cell carcinoma cell lines derived from the oral cavity [25], certain lung cancers [26, 27], and almost all breast cancer cell lines [21]. While the functional significance and the mechanism responsible for the loss of RARb2 expression in certain tumor cells is unknown, studies performed in breast cancer cell lines suggest that RARb2 maybe transcriptionally repressed by distinct proteins binding to response elements in the RARb2 promoter [21]. The RARb2 promoter has a series of well-defined response elements, an RARE [11], a AP-1 site [37], a CRE [37], an Spl site, and an Octabox site [37]. Preliminary studies from our laboratory (X. Lee, and M. Peacocke, unpublished observations), have shown that each of these response elements has an altered pattern of binding in the breast cancer cell lines when compared to normal, nontransformed cells. Whether this type of alteration is responsible for the transcriptional repression of RARb2 seen in certain tumor cells remains to be determined, and is certainly possible. From the functional point of view, it is intriguing to speculate that the loss of the ability of retinoic acid to induce a gene with a known growth-inhibiting function, such as RARb2, could be one step along the path to malignant transformation. In summary, we have demonstrated here that retinoic acid induces the expression of RARb2 in HeLa cells and that the signal transduction pathway leading to its induction has not been altered by malignant
AP: Exp Cell
RARb2-MEDIATED GROWTH INHIBITION IN HeLa CELLS
transformation. We have also shown that a transfected RARb2 transgene inhibits the ability of HeLa cells to proliferate and that exogenous retinoic acid further increases the ability of the transgene to inhibit proliferation. Finally, we show that the transfected RARb2 transgene decreases the ability of HeLa cells to form colonies in soft agar. These data demonstrate that RARb2 effectively inhibits cell proliferation and anchorage-independent growth of certain tumor cell lines and provide more support for the notion that pathways regulated by RARb2 play a role in retinoid-regulated growth inhibition in vitro and, most likely, in vivo. The authors are grateful to Dr. Vimla Band for her help with the development of the soft agar assays. This work was supported by NIH grants AG-09927, AG-00694, and CA-66693, the American Institute for Cancer Research Grant to M.P., NIH Training Grant in Dermatology T32 AR07562 to H.C.T., and a Dermatology Foundation Fellowship from Roche Dermatologics to H.C.T.
REFERENCES 1. Hill, D. L., and Grubbs, C. J. (1992) Annu. Rev. Nutr. 12, 161– 181. 2. Petkovich, M., Brand, N., Krust, A., and Chambon, P. (1987) Nature 330, 444–450. 3. Gigue`re, V., Ong, E. S., Segui, P., and Evans, R. M. (1988) Nature 330, 624–629. 4. Brand, N., Petkovitch, M., Krust, A., Chambon, P., de The´, H., Marchio, A., Tiollais, P., and Dejean, A. (1988) Nature 330, 850–853. 5. Benbrook, D., Lernhardt, E., and Pfahl, M. (1988) Nature 333, 669–672. 6. Zelent, A., Krust, A., Petkovitch, M., Kastner, P., and Chambon, P. (1989) Nature 339, 714–717. 7. Krust, A., Kastner, P., Petkovitch, M., Zelent, A., and Chambon, P. (1989) Proc. Natl. Acad. Sci. USA 86, 5310–5314. 8. Mangelsdorf, D. J., Ong, E. S., Dyck, J. A., and Evans, R. M. (1990) Nature 345, 224–229. 9. Heyman, R. A., Mangelsdorf, D. J., Dyck, J. A., Stein, R., Eichele, G., Evans, R. M., and Thaller, C. (1992) Cell 68, 397– 406. 10. Levin, A. A., Sturzenbecker, L. J., Kazmer, S., Bosakowski, T., Huselton, C., Allenby, G., Speck, J., Kratzeisen, C., Rosenberger, M., Lovey, A., and Grippo, J. F. (1992) Nature 355, 359– 361. 11. de The´, H., del Mar Vivanco-Ruiz, M., Tiollais, P., Stunnenberg, H., and Dejean, A. (1990) Nature 343, 177–180. 12. Leroy, P., Nakshatri, H., and Chambon, P. (1991) Proc. Natl. Acad. Sci. USA 88, 10138–10142. 13. Lehmann, J. M., Zhang, X. Z., and Pfahl, M. (1992) Mol. Cell Biol. 12, 2976–2985.
14. Mangelsdorf, D. J., Borgrneyer, U., Heyman, R. A., Zjou, J. Y., Ong, E. S., Oro, A. E., Kakizuka, A., and Evans, R. (1992) Genes Dev. 6, 329–344. 15. Leid, M., Kastner, P., Lyons, R., Nakshari, H., Saunders, M., Zachewski, T., Chen, J.-Y., Staub, A., Garnier, J.-M., Mader, S., and Chambon, P. (1992) Cell 68, 377–395. 16. Shubeita, H. E., Sambrook, J. F., and McCormick, A. M. (1987) Proc. Natl. Acad. Sci. USA 84, 5645–5649. 17. Stoner, C. M., and Gudas, L. M. (1989) Cancer Res. 49, 1497– 1504. 18. Gigue`re, V., Lyn, S., Yip, P., Siu, C. H., and Amin, S. (1990) Proc. Natl. Acad. Sci. USA 87, 6233–6237. 19. Tsou, H., Lee, X., Si, S. P., and Peacocke, M. (1994) Exp. Cell Res. 211, 74–81. 20. Si, S. P., Lee, X., Tsou, H., and Peacocke, M. (1995) Exp. Cell Res. 219, 243–248. 21. Swisshelm, K., Ryan, K., Lee, X., Tsou, H. C., Peacocke, M., and Sager, R. (1994) Cell Growth Differ. 5, 133–141. 22. Lee, X., Si, S. P., Tsou, H., and Peacocke, M. (1995) Exp. Cell Res. 218, 296–304. 23. Sager, R. (1985) Adv. Cancer Res. 44, 40–43. 24. Peacocke, M., and Campisi, J. (1991) J. Cell. Biochem. 45, 147– 155. 25. Hu, L., Crowe, D. L., Rheinwald, J. G., Chambon, P., and Gudas, L. (1991) Cancer Res. 51, 3972–3981. 26. Houle, B., Leduc, F., and Bradley, W. E. C. (1991) Genes, Chromosomes Cancer 3, 358–366. 27. Gebert, J. F., Moghal, N., Frangioni, J. V., Sugarbaker, D. J., and Neel, B. G. (1992) Oncogene 6, 1859–1868. 28. Peacocke, M., and Siminovitch, K. S. (1987) Proc. Natl. Acad. Sci. USA 84, 3430–3433. 29. Zelent, A., Mendelsohn, C., Kastner, P., Krust, A., Garnier, J. M., Ruffenach, F., Leroy, P., and Chambon, P. (1991) EMBO J. 10, 71–81. 30. Schu¨le, R., Ranggrajan, P., Yang, N., Kliewer, S., Ransome, L. J., Bolado, J., Verma, I., and Evans, R. M. (1991) Proc. Natl. Acad. Sci. USA 88, 6092–6096. 31. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rhamsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987) Cell 49, 729–739. 32. Yang-Yen, H.-F., Zhang, X.-K., Graupner, G., Tzukerman, M., Sakamoto, B., Karin, M., and Pfahl, M. (1991) The New Biologist 3, 1206–1219. 33. Gigue`re, V. (1994) Endocr. Rev. 15, 61–79. 34. Harper, J. W., Adami, G. R., Wet, N., Keyomarsi, K., and Elledge, S. (1993) Cell 75, 805–816. 35. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817–825. 36. Noda, A., Ning, Y., Venable, S. F., Pereira-Smith, O. M., and Smith, J. (1994) Exp. Cell Res. 211, 90–98. 37. Shen, S., Kruyt, F. A. E., den Hertog, J., van der Saag, P., and Kruger, W. (1991) DNA Sequence 2, 111–119.
Received August 14, 1995 Revised version received October 25, 1995
6I0A
/ m4861$3052
01-23-96 22:33:08
eca
111
AP: Exp Cell