RAS Genetic Variants in Interaction with ACE Inhibitors Drugs Influences Essential Hypertension Control

Archives of Medical Research 48 (2017) 88e95

ORIGINAL ARTICLE

RAS Genetic Variants in Interaction with ACE Inhibitors Drugs Influences Essential Hypertension Control Farzad Heidari,a Ramachandran Vasudevan,b,* Siti Zubaidah Mohd Ali,c Patimah Ismail,a and Mohammad Arkania a

Department of Biomedical Science, Genetic Research Group, Faculty of Medicine and Health Sciences, University Putra Malaysia, UPM Serdang Selangor, Malaysia b Malaysian Research Institute on Ageing, University Putra Malaysia, UPM Serdang Selangor, Malaysia c Clinic Kesihatan Senawang, Persiaran Senawang 2, Senawang, Malaysia Received for publication March 4, 2016; accepted February 2, 2017 (ARCMED-D-16-00136).

Backgrounds and Aims. Essential Hypertension (EH) is a common disorder associated with increased cardiovascular morbidity and mortality in Malaysia. To investigate how genetic polymorphisms of the renin-angiotensin-aldosterone system (RAS) influence EH control with angiotensin-converting enzyme inhibitor drugs (ACEI). Methods. A caseecontrol, cross-sectional population-based nested study (n 5 142) included hypertensive subjects treated with ACEI drugs, either lisinopril or enalapril (20 mg, once daily) as monotherapy for 24 weeks. In total seven possible polymorphisms of RAS genes were genotyped. The association between those polymorphisms and the changes in blood pressure were observed in the 24 week treatment. Results. Statistically significant associations of I, G, T, M and G alleles of ACE (I/D, G2350A), AGT (M235T, T175M and G-6A) respectively were observed in essential hypertensive subjects. The decrease in systolic blood pressure and diastolic blood pressure after 24 weeks of treatment of the patients carrying II, GG, and TT genotypes were greater than the groups carrying DD, AA, MM, MM and GG of I/D, G2350A, M235T, T174M and G-6A genotypes respectively. In contrast, No significant difference was observed between renin gene polymorphisms (Bg/I and MboI) and hypertensives. Conclusions. Although this study shows a possible association of polymorphisms of RAS genes with the risk of non-control of HT in ACEI-treated patients and indicates the importance of all this system’s components in regulating HT, it needs to be replicated in other data sources. Ó 2017 IMSS. Published by Elsevier Inc. Key Words: Pharmacogenetics Hypertension, Renin-angiotensin-aldosterone System, Enalapril, Lisinopril, Gene polymorphism.

Introduction There are often large differences among individuals in the way they respond to essential hypertension, whether the endpoint is patient toxicity, treatment efficacy, or both, is an increasingly important medical and public health issue (1). In Malaysia, the National Health and Morbidity Survey IV 2015, has shown that the prevalence of hypertension in

*co-corresponding author Address reprint requests to: Farzad Heidari, GSK, 980 Great West Road, Brentford, Middlesex, UK; Phone: 0044 (0) 7474407770; FAX: 0044 (0) 2036894922; E-mail: [email protected].

adults $18 years, was 33.1%, among that 12.8% were known hypertenasives whereas 19.8% were previously undiagnosed with hypertension. Among those, only 35% of hypertensives had controlled blood pressure (BP) while on treatment (2). Eventhogh the efforts were made to control BP, but it depends on specific patients with genetic architecture (2). Current trial and error approaches for high blood pressure management is suboptimal, and alternative approaches for identifying the optimal antihypertensive regimen are much needed. Studies suggest that BP response and outcomes associated with antihypertensive drugs are influenced by genetic variation. There is much interest in developing pharmacogenetic tools to help clinicians better

0188-4409/$ - see front matter. Copyright Ó 2017 IMSS. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.arcmed.2017.03.003

Association of Renin-angiotensin-aldosterone system with Hypertension Inhibitors

to predict the treatments based on their genetic profile. Using genetic make-up of an individual along with the association between single-nucleotide polymorphisms (SNPs) and angiotensin-converting enzyme (ACE) inhibitors for hypertensives response offers a new preventive approach to lower adverse drug interaction risk (3,4). Renin-angiotensin system is an important component of blood pressure regulation, and associated with high blood pressure (5). Moreover, the major active peptide of the RAS is angiotensin II, produced from the precursor molecule, angiotensinogen (AGT), via an enzyme cascade involving ACE enzyme, angiotensin II exerts numerous effects on the homeostatic regulation of blood pressure, the vast majority of which are mediated via the angiotensin II type 1 receptor (AT1R) (6). The presence of polymorphisms insertion/deletion (I/D), G2350A, M235T, T174M, G-6A, MboI and Bg/I respectively in the ACE, AGT and renin (REN ) genes of the RAS had been associated with adverse EH changes in populations (7,8). The ACEI are some of the most commonly prescribed antihypertensives and block the production of angiotensin II by inhibiting ACE (encoded by the ACE gene), an enzyme that converts Angiotensin I to Angiotensin II (9). Polymorphisms in the RAS genes have been shown to influence antihypertensive response of ACE inhibitors, however the results had been contradictory and inconclusive (10). The commonly studied variations have been I/D polymorphism in the ACE gene and Met235Thr polymorphism in the AGT gene (11). Both, D and I alleles of ACE I/D Polymorphism were shown to be associated with BP lowering response to ACE inhibitors in hypertensives (12). Besides association (case-control) studies of the M235T polymorphism in EH have yielded conflicting results (13,14). Although, the majority have examined hypertension and normotension as simple categorical variables. Moreover, A study concluded the association of other AGT SNPs with BP response to benazepril, an ACE inhibitor (15). However, recent studies have not found significant effect of this variant with BP lowering ability of ACE (16,17). This study investigated interaction of the seven polymorphisms of the RAS, ACE (I/D, G2350A), AGT(M235T, T174M, G-6A) and REN (MboI, BG/I) genes were determined. The A-6G, the A for G substitution of the AGT gene 6 nucleotides upstream from the start site; M235T, the T allele is associate with higher plasma angiotension level and ultimatly higher BP; T174M, the T was associated with high blood presure. ACE I/D polymorphism corresponding to an insertion or deletion of a 287bp alu repeat; and two polymorphisms of the REN gene, Bg/I and MboI and both in the coding area of intron 9. There are compelling reasons hypothesizing that variations in genes of the system may be predictive of variations in BP response. Therefore, genetic variation of the RAS has been investigated in relation to antihypertensive response to ACE inhibitors in various population and dosage.

89

Table 1 shows summary of the design and findings of 14 studies (18e31) examined associations between high blood pressure response (or other cardiovascular outcomes), specific gene polymorphisms, and ACEI. The aim of this study was to investigate the role of seven possible SNPs of the RAS among 142 newly diagnosed Malay male hypertensives in response to ACE inhibitors.

Materials and Methods Selection of Study Population Newly diagnosed Malay male aged between 18e55 with mild to moderate stage (I, II) aged O18 were recruited from two health clinics at Seremban, Malaysia. A questionnaire written English and Malay language were given to the subjects. The information includes age systolic BP O140 mmHg and a diastolic BP O90 mmHg on two consecutive visits. Subjects with a history of diabetes mellitus, renal failure and major infectious disease were excluded. They had no metabolic or endocrine disorder, as well as any acute illness. They had not been on antihypertensive treatment. The study conducted in conformity with the University Putra Malaysia ethical committee declaration and also from National Medical Research Register, Malaysia (Reference: NMRR-12-1062-12650). Additional approval letter was also obtained from Klinic Kesihatan Senawang, Seremaban prior recruiting subjects. Written informed consent was obtained from all the subjects, and patient’s identity were kept confidential. Study Design and Blood Pressure Reduction Stages Reduction of high blood pressure implemented in two stages: Stage 1. Non-pharmacological management: Prior antihypertensive treatments, the hypertensive subjects were advised to undergone lifestyle modifications for a period of 90 d. The hypertensive subjects were seen three times during that period to assess the efficacy of the non-pharmacological management including weight loss, regular exercise, and ingestion of a high-fiber, low fat, and low-salt diet. Stage 2. Follow-up monotraphy management. ACEIs dispensed individually among the hypertensive subjects in a regular basis. Each patient received lisinopril or enalapril (20 mg, once daily) for duration of 24 weeks on a regular basis. Hypertensive subjects’ BP was measured using the same device and protocol; follow-up visits were made 12 times (once per two weeks). Of the 152 hypertensive subjects, 10 lost to the follow-up along monitoring due to relocation, travelling and/or change of medication. Eventually 142 subjects (93.5%) completed the study. Baseline characteristics (age, sex, prior history and medication) and genetic polymorphisms were collected and matched (by propensity score). Individuals were categorised into two sub groups,

90

Heidari et al./ Archives of Medical Research 48 (2017) 88e95

Table 1. Summary of the pharmacogenetic studies on hypertension by drug class ACE Inhibitors

Gene/Variants

Study Design

ACE inhibitors (Unspecified)

AGT M235T ACE I/D 125 hypertensives in a prospective, AT1R A1166C, 4 week study

Enalapril 10 mg

ACE I/D

27 normotensive men in a single dose, 6 h study Captopril 50 mg ACE I/D 82 hypertensives in a single dose, 1 h study Enalapril, dose variable ACE I/D 36 patients with glomerular disease in a 6 month prospective study Captopril 50 mg AGT M235T ACE I/D 246 subjects in a single dose, 1 h study Lisinopril 10 mg; captopril 75 mg ACE I/D 34 subjects with congestive cardiac failure in a prospective, Two-way crossover study of 6 weeks/trial Fosinophil 20 mg ACE I/D 104 hypertensives in a 6 month prospective trial Quinapril, unspecified dose; ACE I/D 16 hypertensive, renal transplant patients unspecific in a 2 year prospective treatment study Antihypertensive co-medication AGT M235T 324 hypertensive survivors of MI or stroke frequency matched to 717 controls in a retrospective study Perindopril 4 mg; indapamide ACE I/D 5688 participants in a 3.9 year mean 2 or 2.5 mg co-medication follow-up prospective treatment/control in some case study

Benazepril 10 mg

ACE I/D

Imidapril 5e10 mg; benazepril 10e20 mg Quinapril 40 mg

ACE I/D ACE I/D

Benazepril 10 mg

D919G

89 hypertensives in a 2 month prospective study 517 hypertensives randomized to drug in a 6 week prospective study 82 coronary bypass surgery patients were randomized to receive drug or placebo; vascular responses to angiotensin II was measured in a 1 year prospective study

726 hypertensives and their families in a 15 d prospective study

responding (n 5 107) to given ACEIs properly and non-responding (n 5 35) to ACEIs. Figure 1 presents how responded and non-responded EH groups were categorised. Biochemistry Test A total of 8 mL of blood sample were taken from the subjects in two separate tubes for analyzing the total cholesterol (TC), high density lipid profile (HDL), low density lipid profile (LDL), triacylglycerol (TG) and fasting glucose (FBG) using Diays Commercial Kits (Diagnostic System, GmBH, Holzheim, Germany). DNA Extraction and Genotyping Whole-blood sample was obtained from cases and controls before and after the monotropy. DNA was isolated from whole- blood cells using the DNA Blood

Outcomes

References

AGT: MT, TT showed greater BP response than MM No differences among genotypes No differences among the genotype No differences among genotypes

(18)

II þ ID patients showed greater BP response No differences among the genotype Lisinopril: no differences captopril: II showed greatest response, followed by ID then DD DD subjects showed greater SBP and DBP response II subjects showed greater MBP response ACE inhibitors provided TT individuals with greater protection against stroke (but not MI). No differences among genotypes for the long-term risks of stroke, cardiac events, mortality, dementia, cognitive decline; neither did ACE genotype predict BP reduction DD subjects showed greater BP response No differences among genotypes

(21)

DD subjects showed decreased vascular response to angiotensin II but drug completely restored the vascular response; no effect of drug was demonstrated in the II þ ID subjects The G allele was associated with a significantly less DBP reduction than the D allele

(30)

(19) (20)

(22) (23)

(24) (25) (26)

(27)

(28) (29)

(31)

Mini Kit (Qiagen, Germany). genotyping was determined by allele-specific polymerase chain reaction (AS-PCR) as described previously with minor modifications (12). A typical 50 mL reaction mixture consisted of 25 mL of HotStar-Taq Master Mix (Qiagen), 100 ng of genomic DNA, and 0.2 mmol of each primer. Primers used in PCR were listed in Table 2. PCR conditions consisted of an initial 2 min denaturation at 94 C followed by 35 cycles of 30 s at 94
C, 30 s at 60
C, 30 s at 72
C, and 7 min at 72 C. PCR products were separated on 2% agarose gel and visualised by ethidium bromide staining. DNA fragments were stained in ethidium bromide and visualised by Alpha Imager (Alpha Innotech, San Leandro, CA, USA) under ultraviolet (UV) light (Figure 2Ae2H). The different genotypes were further confirmed by the direct sequencing method.

Association of Renin-angiotensin-aldosterone system with Hypertension Inhibitors

91

General Population (n = 152)

Two months follow-up with advice on non-pharmacological management (n = 162)

10 patients lost, due to: Relocation, Traveling or change medications

Lisinopril or Enalapril Treated Hypertensive Population within 24-week (n = 142)

Population with controls HT (n = 107)

Population with not controlled (n = 35) Figure 1. The flowchart of sample collection.

Statistical Analysis SPSS 20 statistical package (SPSS, Chicago, USA) was used for analysis. Allele frequencies were calculated from the genotypes of all subjects. Hardy-Weinberg equilibrium was assessed by c2 analysis. Continuous data are presented as mean  SD. Differences between groups were tested by an c2test for qualitative parameters and by one-way analysis of variance (ANOVA). All tests were two-tailed and the values of p !0.05 were considered to indicate statistical significance. Calculation of mean arterial pressure (MAP) was performed by using the formula given below: MAP 5 ([2xdiastolic] þ systolic)/3

Where diastole counts twice as much as systole because 2/3 of the cardiac cycle is spent in diastole. To detect falsepositive results due to multiple testing, we applied the Bonferroni correction test for 94 independent genotype loci.

Results Population Characteristics Table 3 shows the anthropometric characteristics and the biochemical factors of the responding hypertensives and non-responding via lisinopril or enalapril patient groups. This

Table 2. The PCR primer sequences and the restriction enzymes of polymorphic sites for genotyping of the studied polymorphisms in RAS pathway

Gene Location dbSNP ID ACE

Intron16 Exon16 AGT Exon 2 Exon2 Promoter Renin Intron1 Promoter

rs4646994 rs4343 rs699 rs4769 rs5051 rs11571099 rs4762

PCR Primer sequences(50 30 )

Variation I/D G2350A M235T T174M A-6G BglI [A/G] MboI [A/G]

F: F: F: F: F: F: F:

CTGGAGACCACTCCCATCATTTCTR: GTGGTCGCCATCACATTGGTCAGAT CTGACGAATGTGATGGCCGCR: TTGATGAGTTCCACGTATTTCG GATGCGCACAAGGTCCTGR: CAGGGTGCTGTCCACACTGGCTCGC TCTCTCTATCTGGGAGCCTTGGR: CACCAGGTATGTCCGCAGGC AGAAATCCCAGCGTGAGTGTR: AGACCAGAAGGAGCTGAGGG GGGGAAGCAGCTTGATATCGTGGR: CTAGGCTGGAGCTCAAGCGATC GAG GTT CGAGTC GGC CCC CR: TGC CCA AAC ATG GCC ACA CAT

TA TE (
C) Enzyme (
C)

58 60 60 59 62 61

* BstU I SfaNI NcoI BstOI BglI MboI

 60 37 37 37 37 37

F, Forward primer; R, Reverse primer; TA, The annealing temperature; TE, The temperature of restriction enzyme; *PCR products were subjected to 2.0% agarose gels for genotype identification.

92

Heidari et al./ Archives of Medical Research 48 (2017) 88e95

Figure 2. A. Detection of I/D polymorphism of the ACE gene in 2% agarose gel electrophoresis. Lanes 3, 7, 8 and 9 show homozygous II genotypes; lanes 1, 2, 4, 6 and 10 show heterozygous ID genotypes; lane 5 shows homozygous DD genotypes of I/D polymorphism. Figure 2B. Detection of mistyping of ID heterozygotes in 2% agarose gel electrophoresis. Lanes 1, 2, 4 and 5 show mistyping of ID heterozygotes as D homozygotes, which show the presence of the I allele (335 bp), whereas lanes 3, 6 and 7 show no products, which means there are confirmed homozygous DD genotypes of I/D polymorphism. M represents a 100 bp DNA ladder. Figure 2C. Detection of G2350A polymorphism of ACE gene in 3% Metaphor agarose gel electrophoresis. Lane 5, and 7shows homozygous GG genotype, lane 3, 4 and 6 shows heterozygous GA genotypes, lane 1, 2 show homozygous AA genotypes of G2350A polymorphism. Figure 2D. AGT M235T genotypes after restriction of the amplified product in a 3.5% agarose gel. Genotypes are as follows: sample numbers 1 and 4are MM; 2, 5 and 7are MT, 5 and 6 is TT. Figure 2E. PCR products of AGT gene T174M polymorphism TT mutant (353 bp; lane 2, and 7), the MT heterozygote (155 bp, 198bp, and 353 bp; lane 1, 3, and 6), and M: 50bp DNA marker. Figure 2F. PCR products of AGT gene G-6A polymorphism gel shows the GG genotype (55, 107, 184 bp; lane 2, and 6), AA genotype (55 bp, 107bp, and 129 bp; lane 1 and4), and AG: 55, 107, 129, 184 lane 3 and 7). Figure 2G. Visualization of the human REN MboI two-allele polymorphism by PCR-RFLP assay after electrophoresis in a 2% agarose gel. MM indicated in lanes: 1, 2, 6 and 7, Mm has shown in line 3 and mm depicted as mm genotype. Figure 2H. PCR products of Renin gene BgII polymorphism gel shows the (Bg [þ þ] genotype (2.8kb lanes 1, and 6), (BgII [ ] genotype (3.9 kb lanes 3, and 5), and (BgII [þ ]): 1.1kb, 2.8kb and 3.9 lanes 2,4 and7) M represents either 100/50bp DNA marker.

study found significant differences for the levels of total cholesterol and LDL-cholesterol, systolic blood pressure(SBP) and diastolic blood pressure(DBP), in which were all higher in the non-responding HT group. The SBP levels for the non-responding group (159.03  19.46 mmHg) were slightly higher than the limit set by WHO for HT (140 mmHg), while the DBP levels (89.17  10.11 mmHg) were near the limit established for the general population (90 mmHg).

2.4460 (Cl 1.7334e3.4318, p 5 0.0003) was obtained for I/I. Likewise, for rs4343 of G2350A gene polymorphism, we obtained an OR of 1.1416 (Cl 0.8098e1.6092, p 5 0.0001) for genotypes G/GeG/A. Regarding the SNPs belonging to the AGT gene, we obtained an OR of 0.3506 (Cl 02496e 0.4925 p 5 0.001), 0.3506 (Cl 02496e0.4925, p 5 0.001) and 2.9458 (Cl 2.0716e4.1888, p 5 0.003) for rs11571099, rs4762, and when the / and m/m genotypes were expressed for the first SNP and for the second as well, respectively.

SNPs Association Analysis All the restricted fragments of the respective PCR products were shown in Figure 2Ae2H. In the association analysis of the genotypic distribution of the SNPs, through the comparison between responding and non-responding HT, conclusive results were obtained for seven risk SNPs (Table 4). For rs4646994, which belongs to the ACE I/D gene polymorphism, an adjusted odds ratio (OR) of

Comparison of Reductions of Blood Pressure in Hypertensive Subjects Receiving Enalapril and Lisinopril Two ACEIs were applied for the high blood pressure subjects equally. We have found no significant difference in BP reduction within 24 weeks between the groups in response to lisinopril and enalapril (Table 5).

Association of Renin-angiotensin-aldosterone system with Hypertension Inhibitors

93

Table 3. General characteristics of the groups of individuals with responding and non-responding HT Responding (n [ 107, 75.3%)

Parameters Age (years) Body Mass Index(Kg/m2) Normal Pre-Obese Obese Waist-to-hip ration Systolic BP (mmHg) Diastolic BP (mmHg) Fasting glucose (mg/Hg) Biochemical parametersTotal cholesterol (mg/dL) HDLCholesterol (mg/dL) LDLCholesterol (mg/dL) Triglycerides (mg/dL) Serum creatinine (mg/dL) Serum Serum Sodium (mEq/l) Smoking status Non-smokers Smokers/ex-smokers Illiterate Literate

Non-responding (n [ 35, 24.6%)

p

47.22  11.3

46.92  12.7

0.810

32 (29.99%) 22 (20.5%) 57 (49.5%) 0.89  0.02 127.32  12.23 73.22  6.51 111.88  44.1 171.31  29.17 42.06  11.39 89.23  29.75 135.43  92.4 0.98  0.31.12 121.35  3.17

7 (20%) 13 (37.14%) 15 (42.8%) 0.91  0.1 159.03  19.46 89.17  10.11 103.91  29.97 211.53  23.31 51.32  11.12 119.03  24.19 23.132  100.2 0.92  0.23 126.42  3.54

0.061 0.118 0.020 0.371 !0.001* !0.001* 0.258 0.007* 0.042* 0.013 0.015 0.116 0.680

62 (59.81%) 45 (42.05%) 7 (6.54%) 100 (74.7%)

17 (48.57%) 18 (0.51.42) 8 (22.85%) 27 (77.14%)

0.003* 0.004* 0.690 0.062

*Significant ( p !0.05).

Discussion The concept of ‘‘pharmacogenomics’’ promises to offer the ultimate in personalised medicine, and the RAS is one of the most plausible candidates for the application of this approach in the area of hypertension. The serum ACE concentration differs according to the I/D allele

numbers (32) , and this phenomenon has been reconfirmed in the two studies (33,34). Accordingly, the I/D variant is one of the most plausible candidates for pharmacogenomics the RAS blockade mediation. Indeed, early studies showed significant differences of blood pressure reduction among the variants. A greater reduction by enalapril in II

Table 4. Distribution of the hypertensive population treated with ACEIs among the various ACE polymorphisms and the analysis of the risk of lost treatment efficacy SNP ID

Variant

rs4646994

I/D

rs4343

G2350A

rs699

rs4769

M235T

T174M

rs5051

G-6A

rs11571099

BglI

rs4762

MboI

*Significant ( p !0.05).

RespondingHT (n, %) II ID DD GG GA AA MM MT TT TT TM MM AA AG GG [þþ] [þ] [ ] MM Mm mm

58 37 16 41 35 31 23 65 39 29 35 43 59 30 14 54 29 24 40 34 29

(42.43%) (34.5%) (14.9%) (38.3%) (32.7%) (28.9%) (21.4%) (46.1%) (36.4%) (27.1%) (32.7%) (40.8%) (55.1%) (29.1%) (13.08%) (50.4%) (27.1%) (22.4%) (38.8%) (33.0%) (28.1%)

Non-responding HT (n, %) 11 70 45 11 8 16 57 66 19 17 7 11 14 9 12 17 9 9 7 9 19

(31.4%) (49.1.%) (32.14%) (31.42%) (22.2%) (45.7%) (39.73%) (46.61%) (13.67%) (48.5%) (20.0%) (31.4%) (40.0%) (25.7%) (34.28%) (48.5%) (50%) (50%) (20.0%) (25.7%) (54.2%)

OR (CI)

p

2.4460 (1.7334e3.4318)

0.0003*

1.1416 (0.8098e1.6092)

0.0001*

0.3506 (02496e0.4925)

0.001*

0.3506 (02496e0.4925)

0.001*

2.9458 (2.0716e4.1888)

0.003*

0.9840 (0.7060e1.37)

0.9240

1.0730 (0.7721e1.4910)

0.694

94

Heidari et al./ Archives of Medical Research 48 (2017) 88e95

Table 5. Interactions of HT and Lisinopril and Enalapril groups after 24 weeks Parameters

Enalapril

Lisinopril

Number of Patient (n)

(n [ 71)

(n [ 71)

p

          

0.81 0.84 0.183 0.531 0.332 0.961 0.384 0.728 0.221 0.157 0.741

Age (years) Body Mass Index (Kg/m2) Pretreatment SBP (mmHg) Post treatment SBP (mmHg) Pretreatment DBP (mmHg) Post treatment DBP (mmHg) Pretreatment HR (bpm) Post treatment HR (bpm) MAPB (mmHg) MAPA (mmHg) MAPD (bpm)

47.22 27.2 161.3 138.5 98.6 87.1 76.0 75.4 22.8 16.5 0.4

          

11.3 3.1 10.4 11.8 4.2 7.0 9.2 9.0 1.40 1.8 9.0

46.92 27.2 161.9 137.7 98.1 88.3 75.9 74.1 24.2 9.8 0.6

12.7 3.2 10.4 10.3 4.3 7.2 7.4 7.2 0.5 2.9 8.3

genotype compared with DD genotype was reported in 23 normotensive men (35). A greater reduction by insertion in D allele compared with I allele was also reported (36) However, as shown in Table 1, recent relatively wellpowered studies have almost consistently shown no difference in blood pressure reduction in ACE genotypes (mainly the I/D, G2340A) variant by ACE inhibitors (20,22,23,27) Thus, this study concludes the ACE I/D and G2350A gene variants are associated in response to lisinopril /enalapril among Malay male hypertensives. Another of the most evaluated genes in pharmacogenomics studies for the RAS is AGT, especially the M235T, T174M and A-6G genetic variants. Evidence of genetic linkage between the AGT gene and high BP, as well as association of AGT with the disorder, has been observed, and significant differences in plasma concentrations of angiotensinogen were found among hypertensive subjects with different AGT genotypes (37). Thus, the AGT variant is one of the most plausible candidates for pharmacogenomic theRAS blockade intervention. Although a study of 125 cases reported that M235T was associated with lowered blood pressure in response to ACE inhibitors (38), the recent relatively well-powered studies are almost consistently observed no difference in blood pressure reduction with M235T and A-6G by ACE inhibitors (39,40) Accordingly, this study can conclude M235T, T174M and A-6G, gene variant of AGT are associated with lisinopril and enalapril in response to hypertensives. Among collected samples, we have found no association between Mob/I and Bg/I of REN in response to cause ACEIs among Malay male hypertensives. As the MboI polymorphism is located in an intron, it is probably not the causative mutation of the effect uncovered here. However, our results together with those of a trial suggest that genetic variations in linkage disequilibrium with this site (either in the REN gene itself or in a nearby gene in linkage disequilibrium with it) may not be directly implicated in an individual’s genetic susceptibility to blood pressure regulation (39,40). It is,

therefore, necessary that studies, which advance this particular aspect, be conducted so that the efficacy of treatments that targets the genetic component of hypertension may be enhanced, resulting in more effective blood pressure control and in a lower incidence of hypertension-related morbidity and mortality. In addition to improved efficacy, screening for the genetic basis of hypertension may improve the overall outcome and the cost-benefit ratio (41). Malaysian population is suitable for carrying out pharmacogenetic studies for complex disorders, due to different ethnics and high degree of consanguinity. Future sib-pair analyses would further help in identifying the genetic effects underlying hypertension in this population. Competing Interests All the authors declared that they have no conflicts of interest concerning this article.

Acknowledgments The authors gratefully like to extend their gratitude to all the volunteers participated in this study.

References 1. Schilders JE, Wu H, Boomsma F, et al. Renin-angiotensin system phenotyping as a guidance toward personalized medicine for ACE inhibitors: can the response to ACE inhibition be predicted on the basis of plasma renin or ACE? Cardiovasc Drugs Ther 2014;28:335e345. 2. Annamalai C, Govindaraja C, Chandramouli C. Prevalence, awareness and control of hypertension in estate workers in Malaysia. N Am J Med Sci 2011;3:540. 3. Johnson JA. Pharmacogenomics of antihypertensive drugs: past, present and future. Pharmacogenomics J 2010;1:487e491. 4. Arnett DK, Claas SA. Pharmacogenetics of antihypertensive treatment: detailing disciplinary dissonance. Pharmacogenomics J 2009;10: 1295e1307. 5. Konoshita T, Genomic Disease Outcome Consortium, Study Investigators. Do Genetic Variants of the Renin-Angiotensin System Predict Blood Pressure Response to Renin-Angiotensin SystemeBlocking Drugs? A Systematic Review of Pharmacogenomics in the Renin-Angiotensin System. Curr Hypertens Reports 2011;13:356e361. 6. Gong Y, McDonough CW, Wang Z, et al. Hypertension Susceptibility Loci and Blood Pressure Response to Antihypertensives-Results from the Pharmacogenomic Evaluation of Antihypertensive Responses (PEAR) Study. Circ Cardiovasc Genet 2012;5:686e691. 7. Taverne K, de Groot M, de Boer A, et al. Genetic polymorphisms related to the renineangiotensinealdosterone system and response to antihypertensive drugs. Expert Opin Drug Metab Toxicol 2010;6: 439e460. 8. Ramachandran V, Ismail P, Stanslas J, et al. Analysis of reninangiotensin aldosterone system gene polymorphisms in malaysian essential hypertensive and type 2 diabetic subjects. Cardiovasc Diabetol 2009;8:1. 9. Hiltunen TP, Donner KM, Sarin AP, et al. Pharmacogenomics of Hypertension: A Genome-Wide, Placebo-Controlled Cross-Over Study, Using Four Classes of Antihypertensive Drugs. J Am Heart Assoc 2015;4:e001521. 10. Johnson JA. Advancing management of hypertension through pharmacogenomics. Ann Med 2012;44:S17eS22.

Association of Renin-angiotensin-aldosterone system with Hypertension Inhibitors 11. Takeuchi F, Yamamoto K, Katsuya T, et al. Reevaluation of the association of seven candidate genes with blood pressure and hypertension: a replication study and meta-analysis with a larger sample size. Hypertens Res 2012;35:825e831. 12. Heidari F, Vasudevan R, Ali SZ, et al. Association of insertion/deletion polymorphism of angiotensin-converting enzyme gene among Malay male hypertensive subjects in response to ACE inhibitors. J Renin Angiotensin Aldosterone Syst 2015;16:872e879. 13. Hata A, Namikawa C, Sasaki M, et al. Angiotensinogen as a risk factor for essential hypertension in Japan. J Clin Invest 1994;93: 1285. 14. Bennett CL, Schrader AP, Morris BJ. Cross-sectional analysis of Met 235/ Thr variant of angiotensinogen gene in severe, familial hypertension. Biochem Biophys Res Commun 1993;197:833e839. 15. Wang YJ, Pan Y. The M235T polymorphism in the angiotensinogen gene and myocardial infarction risk: A meta-analysis. J Renin Angiotensin Aldosterone Syst 2015;2014(15):294e300. 16. Su X, Lee L, Li X, et al. Association between angiotensinogen, angiotensin II receptor genes, and blood pressure response to an angiotensin-converting enzyme inhibitor. Circ 2007;115:725e732. 17. Redon J, Luque-Otero M, Martell N, et al. Renineangiotensin system gene polymorphisms: relationship with blood pressure and microalbuminuria in telmisartan-treated hypertensive patients. Pharmacogenomics J 2005;5:14e20. 18. Hingorani AD, Stevens PA, Brown MJ, et al. Renin-angiotensin system gene polymorphisms influence blood pressure and the response to angiotensin converting enzyme inhibition. J Hypertens 1995;13: 1602e1609. 19. Todd GP, Chadwick IG, Higgins KS, et al. Relation between changes in blood pressure and serum ACE activity after a single dose of enalapril and ACE genotype in healthy subjects. Br J Clin Pharmacol 1995;39:131e134. 20. Nakano Y, Oshima T, Watanabe M, et al. Angiotensin I-converting enzyme gene polymorphism and acute response to captopril in essential hypertension. Am J Hypertens 1997;10:1064e1068. 21. Haas M, Yilmaz N, Schmidt A, et al. Angiotensin-converting enzyme gene polymorphism determines the antiproteinuric and systemic hemodynamic effect of enalapril in patients with proteinuric renal disease. Kidney Blood Press Res 1998;21:66e69. 22. Mondorf UF, Russ A, Wiesemann A, et al. Contribution of angiotensin I converting enzyme gene polymorphism and angiotensinogen gene polymorphism to blood pressure regulation in essential hypertension. Am J Hypertens 1998;11:174e183. 23. O’Toole L, Stewart M, Padfield P, et al. Effect of the insertion/deletion polymorphism of the angiotensin-converting enzyme gene on response to angiotensin-converting enzyme inhibitors in patients with heart failure. J Cardiovasc Pharmacol 1998;32:988e994. 24. Stavroulakis GA, Makris TK, Krespi PG, et al. Predicting response to chronic antihypertensive treatment with fosinopril: the role of angiotensin-converting enzyme gene polymorphism. Cardiovascu Drugs Ther 2000;14:427e432. 25. Suwelack B, Kempkes-Koch M, Kobelt V, et al. Impact of ACE polymorphism on renal allograft function, blood pressure, and proteinuria under ACE inhibition, Transplant proc34. Elsevier; 2002. pp. 1763e1766.

95

26. Bis JC, Smith NL, Psaty BM, et al. Angiotensinogen Met235Thr polymorphism, angiotensin-converting enzyme inhibitor therapy, and the risk of nonfatal stroke or myocardial infarction in hypertensive patients. Am J Hypertens 2003;16:1011e1017. 27. Harrap SB, Tzourio C, Cambien F, et al. The ACE gene I/D polymorphism is not associated with the blood pressure and cardiovascular benefits of ACE inhibition. J Hypertension 2003;42:297e303. 28. Li X, Du Y, Du Y, et al. Correlation of angiotensin-converting enzyme gene polymorphism with effect of antihypertensive therapy by angiotensin-converting enzyme inhibitor. J Cardiovasc Pharmacol Ther 2003;8:25e30. 29. Voors AA, van Geel PP, Oosterga M, et al. Vascular effects of quinapril completely depend on ACE insertion/deletion polymorphism. J Renin Angiotensin Aldosterone Syst 2004;5:130e134. 30. Brugts JJ, Danser AJ, de Maat MP, et al. Pharmacogenetics of ACE inhibition in stable coronary artery disease: steps towards tailored drug therapy. Curr Opin Cardiol 2008;23:296e301. 31. Zhang Y, Zhang M, Niu T, et al. D919G polymorphism of methionine synthase gene is associated with blood pressure response to benazepril in Chinese hypertensive patients. J Hum Genet 2004;49:296e301. 32. Rigat B, Hubert C, Alhenc-Gelas F, et al. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343. 33. Nakai K, Itoh C, Miura Y, et al. Deletion polymorphism of the angiotensin I-converting enzyme gene is associated with serum ACE concentration and increased risk for CAD in the Japanese. Circulation 1994;90:2199e2202. 34. Abbas D, Ezzat Y, Hamdy E, et al. Angiotensin-converting enzyme (ACE) serum levels and gene polymorphism in Egyptian patients with systemic lupus erythematosus. Lupus 2012;21:103e110. 35. Singh D, Jajodia A, Kaur H, et al. Gender specific association of RAS gene polymorphism with essential hypertension: a case-control study. Bio Med Res Int; 2014. 36. Reisin E, Graves JW, Yamal JM, et al. Blood pressure control and cardiovascular outcomes in normal-weight, overweight, and obese hypertensive patients treated with three different antihypertensives in ALLHAT. J Hypertens 2014;32:1503e1513. 37. Yu H, Zhang Y, Liu G. Relationship between polymorphism of the angiotensin-converting enzyme gene and the response to angiotensin-converting enzyme inhibition in hypertensive patients. Hypertens Res 2003;26:881e886. 38. Charita B, Padma G, Sushma P, et al. Estimation of risk and interaction of single nucleotide polymorphisms at angiotensinogen locus causing susceptibility to essential hypertension: a case control study. J Renin Angiotensin Aldosterone Syst 2012;13:461e471. 39. Santos PC, Krieger JE, Pereira AC. Renineangiotensin system, hypertension, and chronic kidney disease: pharmacogenetic implications. J Pharmacol Sci 2012;120:77e88. 40. Song SB, Jin HS, Hong KW, et al. Association between renineangiotensinealdosterone system-related genes and blood pressure in a Korean population20. Blood Press; 2011. pp. 204e210. 41. Brugts JJ, Isaacs A, de Maat MP, et al. A pharmacogenetic analysis of determinants of hypertension and blood pressure response to angiotensin-converting enzyme inhibitor therapy in patients with vascular disease and healthy individuals. J Hypertens 2011;29:509e519.