Rat ribosomal protein L35a multigene family: molecular structure and characterization of three L35a-related pseudogenes

Biochimica et Biophysica Acta 909 (1987) 99-106 Elsevier

99

BBA 91723

Rat ribosomal protein L35a multigene family: molecular structure and characterization of three L35a-related pseudogenes Takejiro Kuzumaki

a,

Tatsuo Tanaka

a,

Kiichi Ishikawa

a

and Kikuo Ogata b

a Department of Biochemistry, Yamagata University School of Medicine, Yamagata and b Department of Biochemistry, Niigata University School of Medicine, Niigata (Japan) (Received 19 January 1987)

Key words: Ribosomal protein; Multigene family; Pseudogene; Molecular structure; (Rat liver DNA)

The rat ribosomal protein L35a gene comprises a muitigen family which contains 15-20 members as shown by the Southern blot analysis using L35a cDNA as a probe. We isolated 15 independent clones which contained distinct genes from a rat genomic library. Analysis of the restriction sites showed that all of them lacked the intervening sequences. Thermal stability of the hybrid molecules between these genes and the cDNA indicated that the similarity of the genes to the cDNA sequence varied. The nucleotide sequences of three genes gRL35a-A, gRL35a-B and gRL35a-G were determined. They shared some characteristics; namely: they lacked the intervening sequences, they contained (A)-rich tracts, and they were flanked by direct repeats. Two genes, gRL35a-A and glTJ~5a-B, contained a sequence completely identical to that of the cDNA. The nucleotide sequence of the 5' flanking region of gRL35a-B showed a significant homology with that of the same region of mouse ribosomal protein L32-related unmutated processed genes. Although this region of gRL35a-B contained the sequences homologous to the TATA box and the CCAAT box, gRL35a-B was not transcribed in an in vitro assay system. Thus, the L35a gene family comprises mostly processed pseudogenes. Further, Southern blot analysis in various animals indicated that the multigene construction of this ribosomal protein gene was a feature of mammalian genes. The origin and the evolutionary aspect of processed pseudogenes are discussed.

Introduction

Recent studies of the gene structure and its organization in mammals have shown that, as in the case of bacteria, the genes of many proteins in mammalian are single and have no pseudogenes in general. Although little is known about the structure of the ribosomal protein genes in mammals, it seems certain that the ribosomal protein gene

Correspondence: T. Kuzumaki, Department of Biochemistry, Yamagata University School of Medicine, Zaoh-Iido, Yamagata 990-23, Japan.

organization of mammalian is very different from that of bacteria [1-3]. For instance, bacteria have a single gene [1], whereas mammalian have 7-20 genes for each ribosomal protein [2]. In Escherichia coli, most ribosomal protein genes duster in a few cistrons [1], whereas mammalian ribosomal protein genes are monocistronic, and they are distributed on many chromosomes [3]. In general, the gene families of mammalian ribosomal proteins are supposed to be consisted of one functional gene containing introns and the other processed pseudogenes which are not expressed [11,12,16]. Although the functional genes of eukaryotes usually contain the intervening sequences, this is not a prerequisite for expression, as is shown in the

0167-4781/87/$03.50 © 1987 Elsevier Science Publishers B.V. (Biomedical Division)

100 case of histone genes [4]. A chicken calmodulin gene which lacks introns has been shown to be expressed in a tissue-specific fashion [17]. Considering such circumstances, more detailed investigations of processed genes of mammalian ribosomal proteins may be necessary for deeper understanding of the features of eukaryotic genes. In this report we describe the cloning and the sequence determination of the genes for rat ribosomal protein L35a and the multigene organization of this gene. The sequence of three genes showed some interesting features of processed pseudogenes. Also, the characteristics of the evolutionary features of mammalian ribosomal genes are discussed. Materials and Methods

scribed by Maniatis et al. [7]. The recombinant DNA obtained from phage ~ Charon 4A clone was analyzed by the same procedure. Isolation and analysis of genomic clones. A genomic library prepared in phage k Charon 4A from rat (Sprague-Dawley) nuclear DNA was kindly provided by Drs. T.D. Sargent, R.B. Wallace, L.L. Jagodzinsky and J. Bonner. The phages were plated on E. coli LE392 and screened with the nick-translated cDNA clone pRL35a by the standard procedure of Benton and Davis [8]. Positive recombinant phages were purified by replating two or three times. A small amount of the recombinant D N A was prepared by the plate lysate method [7]. A large amount of DNA was obtained from a 2 liter culture of infected bacteria by equilibrium centrifugation in CsC1 [7].

Thermal stability of hybrids of genomic clones. Materials. Restriction enzymes and T4 polynucleotide kinase were purchased from Takara Shuzo (Kyoto, Japan); RNAase A from Sigma (St. Louis, U.S.A.); proteinase K from Merck (Darmstadt, F.R.G.); and [a-a2p]dCTP (about 3000 Ci/mmol) and [y-32p]ATP (about 3000 Ci/mmol) from Amersham (U.K.). Preparation of genomic DNA. About 1 g liver tissue of various animals was homogenized with 15 ml of buffer A (20 mM Tris-HC1 (pH 7.5)/50 mM KC1/5 mM MgC12). After centrifugation at 3000 rpm for 10 min, the pellet was suspended in 15 ml of 0.25 M sucrose in buffer A and recentrifuged. The precipitate was suspended in 10 ml of 0.5 M EDTA (pH 8.0) containing proteinase K (100 /~g/ml) and 0.5% SDS, and incubated at 50°C for 3 h. Then, DNA was extracted with phenol, dialyzed against 10 mM Tris-HC1 (pH 8.0)/1 mM EDTA, treated with RNAase A (100 /xg/ml) at 37°C for 2 h, reextracted with phenol, and precipitated with 2 vol. of ethanol. Southern blot analysis. Genomic DNA (about 15 /~g each) was digested with various restriction enzymes and subjected to electrophoresis in 0.8% agarose gel using HindlII-digested ~ phage DNA as position markers. The DNA was denatured by alkaline treatment, and transferred to nitrocellulose filter by the method of Southern [5]. The filters were then hybridized with a nick-translated insert of the cDNA clone pRL35a [6] (specific activity, 2- 107 cpm//~g) under the conditions de-

Thermal stability of the hybrid molecules of cloned L35a genomic DNAs and the insert of cDNA clone pRL35a was measured by the procedure described by Meyuhas et al. [9]. The thermal stability (ST) value was defined as the washing temperature at which 50% of the nick-translated cDNA was released from a nitrocellulose filter.

Restriction site mapping, subcloning and DNA sequencing. The recombinant phage DNA was digested with the restriction enzymes, EcoRI, BamHI and HindlII by single or combined digestions. The restriction sites were mapped by the electrophoresis of the digests in an ethidiumbromide-stained agarose gel and DNA blotting as described above. Appropriate fragments were subcloned into the plasmid vector pBR322 and propagated in E. coli HB101 transformed by the CaC12 procedure [7]. The subclones were mapped with additional restriction enzymes, HpalI and HinfI by 5% polyacrylamide gel electrophoresis. The nucleotide sequence of the DNA was determined by the method of Maxam and Gilbert [10]. Results

Organization of rat ribosomal protein L35a gene As reported previously [6], we isolated a cDNA clone (pRL35a) which was complementary to the mRNA encoding rat ribosomal protein L35a. Using the cDNA as a probe, we analyzed the

101

L35a gene organization in the rat genome. Southern blot analysis of rat liver DNA, which was digested with several restriction enzymes, showed 15-20 bands for each digest (Fig. 1). From the size distribution of these bands, and considering the fact that the probe DNA size was fairly small, we concluded that the L35a gene has a multigene construction. For confirmation, the clones which contained these genes were isolated. We screened approximately 150000 plaques of a Charon 4A rat gene library by plaque hybridization with 32p_ labeled pRL35a as a probe under fairly stringent conditions (0.1 x SSC at 65 °C) (1 × SSC is 0.15 M NaC1/0.015 M sodium citrate) and isolated about 140 positive clones. The restriction enzyme maps of these clones showed that they were mostly overlapped. By reducing the number of these overlapped genes, we finally obtained 15 distinct clones and named these gRL35a-A to gRL35a-O, in alphabetical order.

Characterization of the isolated genomic clones Next, we measured ST values of the hybrid

molecules annealed between these clones and the 32p-labeled cDNA insert of pRL35a. The typical melting curves of five clones are shown in Fig. 2. The curves of other clones were distributed between those of gRL35a-A and gRL35a-G. As seen in Fig. 2, the S T values of these hybrid molecules were distributed over a broad temperature range. This result indicates that the clones have different degree of sequence similarity to the cDNA. Then, to examine the characteristics of these clones in more detail, DNAs from the clones were digested with several restriction enzymes and analyzed by Southern blotting using nick-translated pRL35a as a probe. The patterns (not shown) indicated that none of these clones has intervening sequences. Two clones, gRL35a-A and gRL35a-B, had high S T values. By the detailed analysis of the restriction maps of these clones, it was shown that they have the same restriction sites as the cDNA

,o0] 80

1

2

3

(kb) °°

9.46.64o

4.420

2.0-

washing temperature (°C)

Fig. 1. Southern blot analysis of rat genomic DNA. A 15 #g sample of rat genomic D N A for each lane was digested with BamHI (lane 1), HindlIl (lane 2) and EcoRI (lane 3) and analyzed using eDNA d o n e pRL35a as a probe as described in Materials and Methods. The hybridized filter was washed with 0.1 x S S C containing 0.1% SDS at 6 0 ° C for 2-3 h. Autoradiography was performed at - 7 0 ° C with 4 days exposure.

Fig. 2. Thermal stability of hybrids of genomic DNAs and eDNA. About 100 ng of phage D N A was spotted on nitrocellulose filter, denatured by the alkali treatment, baked at 80 o C and hybridized with nick-translated cDNA. Filters were washed briefly in 1 x SSC several times followed by a wash in 0.1 × SSC containing 0.1% SDS at 5 0 ° C for 1 h, and then washed for 30 rain at the temperature indicated. The remaining radioactivity was measured in a liquid scintillation counter. The released radioactivity was calculated and plotted. Each point represents the average of two or three measurements.

102 pRL35a. In contrast, the restriction map of gRL35a-G, which had a low ST value, was not the same as that of the c D N A (Fig. 3).

Sequence analysis of three cloned genes We determined the nucleotide sequences of these three clones according to the strategies shown in Fig. 3. The results are shown in Fig. 4. Two clones, gRL35a-A and gRL35a-B, contained a sequence that is completely identical to that of the cDNA. No intervening sequences were observed. The sequence determination of gRL35a-G showed that there is some base substitution, insertion and deletion in the corresponding sequence. However, these three genes shared the following features in common. About 60 bp upstream from the initiation codon A T G they contained pyrimidine tract CTCTTTCT, which was claimed as the capping site [11]. The coding sequence was followed by a putative 3' noncoding sequence about 40 bp long and (A)-rich sequence of various lengths. The sequence from the putative capping site to the end of (A)-rich sequence was flanked by a pair of direct repeats as indicated by boxes in Fig. 4.

(a) L35a-cDNA

,~,~

Characteristic sequences in the gRL35a-A and gRL35a-B genes These two genes have completely conserved coding sequences. Moreover, the 5' flanking regions showed most of the features possessed by the transcription initiation site of an expressing gene. There are T A T A box-like sequences, T A T G T A in gRL35a-A and TATA box in gRL35a-B, 26 bp upstream from the above-mentioned putative cap site. There is also a CCAAT box in gRL35a-B upstream from the TATA box. So far, there has been reported only one ribosomal protein processed gene (rpL32-4A) which has a sequence completely identical to that of cDNA without an intervening sequence [12]. Interestingly, as shown in Fig. 5, the 5' flanking sequence of gRL35a-B had a significant homology with that of rpL32-4A. Transcription assay of the gRL35a-A and gRL35a-B genes Since gRL35a-A and gRL35a-B had the same coding sequence with the cDMA, and the consensus promoter-like sequences in the 5' flanking

(b) gRL35a-A

~,~,

-f

O,lkb

'R

B

H

R

R

H

L'

I

I

I

I

I

0.1kb

t

,

H,~--~

(d) gRL35a-G

(c)gRL35a-B B

'R r'

lkb

O. ~ k b

~a

RB II

RB

R

H

B

H 'R,

'R

B

B H

kb

HB

'H

=

R

:: =

Fig. 3. Restrictionmaps of L35a-cDNA, gRL35a-A,gRL35a-Band gRL35a-G. Filled bars on the line mark the fragmentshybridized with cDNA. Sequencingstrategies are indicated by horizontal arrows. Restrictionsites are denoted as follows; R, EcoRl; B, BamHI; H, HindlII; c~, HpalI; ~, HinfI; 'R, EcoRI sites at which genornic DNA was inserted into the vector; 'P, PstI sites at which cDNA was inserted into the vector plasmid.

103 -60

cDNA A B G

ACTTAGAGCCATTAGTGTAGGGCTGGTATGTATCTT[AAGAGATGTGGCTGT GCTCTTTCTGCCATCTTGGCGTCTTTGGAGGCCTGCTGGGAACA TTATCTACCAAAAGCCAATCATTACTATACCCACTTTIACAAATGGCAAAGC TCCCTTCAGTAAGATCTGAACTGGAAACTTAAATGAAAAG[TTGACACGGTG

G111111--111111111111111111111111111111111

l AT--GGTcTGGAAGGCTGTGGTGCAAGGCCATTTTTGCTGGCTACAAGCGAGGCCTCCGGAACCAAAGAGAGCACACGGC

cDNA A

GGACTTCTAAAAAAACAAGT

B

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

G

.....

cDNA A B G

AA-

.............................................................................

TG--C-A---C-G--A

..........................

A---A

.....

G ......

A-T ..........................

lO0 TCTTCTTAAAATTGAAGGTGTTTATGCCCGAGATGAAACTGAGTTCTACTTAGGCAAGAGGTGTGCTTATGTGTACAAAGCAAAA .

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

........

C. . . . . .

C--C . . . . . . . . .

A. . . . . . . . . . . . . .

A. . . . . . . . . . .

T-C-TCTG-ACATGCAG . . . . A. . . . CAACAACAACAAC 200

cDNA A B G cDNA A B G cDNA A B

G cDNA A B G

AACAATACAGTGACTCCTGGAGGCAAACCAAACAAAACCAGAGTGATCTGGGGAAAAGTAACTC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

AACAACAACAACAACAAGAACAAGAACAACAAC

.....

C .....................

T ....

TG . . . . . . . . . . . . . . . . . . .

G ..........

300 GGGCCCATGGAAACAGTGGCATGGTT•GTGCCAAATTCCGAAGCAAC•TTcCTGCAAAGGCCATTGGACACAGAATCCGTGTGATGCTGTACCCATC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.......

C. . . . . . . . . . . . . . . . . . . . . . .

T. . . . . .

T. . . . . . . . . . . . . . .

T. . . . . .

AT. . . . . . . . . . .

333 CCGGATTTAA .......... A•TAATGGAGAGTAAATAAATAAAAGTAGATTTGTGCTCTTGTATTTTTTTCAAAAAAAAAAAAAAAAAA•AAGAGAcGTGGcTGT [ ..................................................... AAAAAAAAAAAACAAAACAAAAIACAAATGGGCAAAGCIAAGTC -A--A-C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C--C . . . . A. . . . . . . TTAAAAAAAGAAAAGGAAGAAAGGAAGGGAGGGAGGGAGGAAGA

AAGAACAGACGAGAAGCCATTTAAGGCTGAGCCTGTAAAGACCAGAAGCTAGAAATACAAGGAGCATCAGGCAGAGGGGAGTGAGGTGAGCAG CCCAGAAGACTTTGTTGAAGGCCACACAGTGAATGGGTGGTGGAGACAAGGTCCAATAACCCTTAGAGATG AAGAAAGAAAGACAGACAGACAGACAGACAGACAGACAGAcA•TTGAcACAGTGIAAGTAGACCTcAGCAGCAGCTGCCCAGT

Fig. 4. Nucleotide sequences of three genes and cDNA. The coding sequence of eDNA is sited in the upper most line. A hyphen indicates the same base as eDNA. A blank shows absence of a nucleotide, The number begins at A of initiation codon. Direct repeats are boxed. Pyrimidine tract CTCTTTCT and poly(A) addition signal AATAAA are 0verlined. The initiation and termination codon, ATG and TTA are underlined.

gRL35a-B 5'- A A AA G C C A A

I

I I I I

T

C A T T A C T A T A C C

C A C T T T IA c A A A T G G C - 3 '

I

I I I

ILl

I

III

I

GTATCCCAAGTAACATCATTATAATACACATT

II

I llI

II

IACAAATTAG

rpL32-4A

Fig~5~C~mp~n~fthenuc~e~des~uen~sin~e5~an~6ngre~n~fg~35a-B~dr~L32-4A~Identic~b~es~em~catedby ve~ic~lmes.~ed~tr~ts~uences~eb~x~.~esequen~s~esp~n~ngt~TATAb~x~dCC~Tb~xareunder~n~.

104

(A) D e l e t i o n 300 cDNA G

GGAC

ACAGA

(ATC

C GTGTGATGC

TG

333 AC C C A T C C

GGACACAGA a

) CGGATTTAAA CAGAATCAAA a c

c (B) I n s e r t i o n cDNA G

160 AAAGCAAAA

AACAA

170 AC A

A A A A C A A A C ((A A C)I3,(A A G) 2) A A C A A C A C A

Fig. 6. Deletion and insertion found in gRL35a-G. (A) Deletion delineated by short repeat sequences (a, b, c) generated by three base substitutions. The repeat sequences are underlined. (B) Insertion constructed with AAC(G) repeat. The numbering of nucleotides correspond to that in Fig. 4. Arrows indicate nucleotide substitutions.

region, it seemed important to examine whether these genes are functional or not. We tested these genes by an in vitro run-off assay in HeLa cell extract. No transcript was detected by this assay (not shown). Nucleotide sequence of the gRL35a-G gene Besides many base substitutions, gRL35a-G contained a 45-bp-long insertion and a 24-bp-long deletion. Many short direct repeats were observed around the deletion and the insertion sites. Around the deletion site (Fig. 6A), direct repeat (b) was observed in cDNA, and three base changes ( G 326 A, T 329 -'-~ A and T 331 "--~C ) produced new repeats (a and c). Although the mechanism involved is not known, these direct repeats might be important in the formation of the deletion. Around the insertion site also (Fig. 6B), three substitutions ( 6 157 ~ A, A 162 --~ C and T 168 ~ C ) produced several reiterations of AAC. Probably, the insertion of AAC repeat then occurred by the same mechanism as described by Lusting and Peters for A-rich tracts of repetitive gene dements [13]. Southern blot analysis of L35a-related genes in various animals To test whether multigene construction of the L35a gene is common to all higher animals, we analyzed the gene structure of amphibians, reptiles, birds and mamrr~als. When genomic DNAs were digested with EcoR! and BamHI and

analyzed with Southern blotting using the cDNA insert of pRL35a as a probe, amphibian (Xenopus) showed double bands, reptilian (turtle) and avian (chicken) showed a single band each, whereas mammalian (mouse, hamster, rabbit and human)

1 2 3 4 5 6 7 8 (kb) 23.16.64.4-

2.0-

Fig. 7. Southern blot analysis of genomic DNAs from various animals. A 15 #g sample for each lane of genomic DNA was digested with EcoRl (lanes 1-4) or BamHI (lanes 5-8) and electrophoresed and blotted. The hybridized filter was washed with 1 × SSC containing 0.1% SDS at 52 ° C for 3-4 h. Autoradiography was performed at - 7 0 ° C with 7 days exposure. Lane 1, Xenopus; 2, turtle; 3, chicken; 4, mouse; 5, hamster; 6, guinea-pig; 7, rabbit; 8, human.

105 showed as many as 10-20 bands, except for the guinea-pig, which showed only four bands (Fig. 7). When the DNAs were digested with BgllI, the pattern was essentially the same, except that Xenopus showed a single band (not shown). These results indicate that the multigene construction of this ribosomal protein gene is the feature of mammals. Discussion

In this communication, we reported that a multigene family of rat ribosomal protein L35a was clearly indicated by Southern blot analysis. Using L35a-cDNA (pRL35a) as a probe, we isolated 15 independent clones which contained L35a gene from a rat genomic library. Among them, we sequenced three genomic clones (gRL35a-A, -B and -G), and found that none of these contained intervening sequences. Out of these three genes, two unmutated genes, especially gRL35a-B, had some features of a functional gene. Moreover, homology of the 5' flanking region of the gRL35a-B gene to the same region of mouse ribosomal protein L32 processed gene, rpL32-4A [12] was observed. Why are there so many genes of ribosomal protein L35a, and are they functional or not? Ribosomal components are known to be synthesized coordinately [21,22]. The coordination is necessary not only among each ribosomal protein but also between ribosomal proteins and ribosomal RNAs. Since there exist several hundred ribosomal RNA genes in mammalian cells [15], it is not unreasonable to suppose that multiple gene coding ribosomal proteins are functional. It is reported that some of the mouse ribosomal protein genes comprise multigene families, and that there are many processed pseudogenes in the families [11,12,16]. But it is not clear how many genes of each ribosomal protein are functional. Concerning this point, Stein et al. reported an interesting observation about chick calmodulin genes [17]. Chick has two calmodulin genes per haploid. One contains intervening sequences and the other does not. The intron-containing gene is expressed ubiquitously, whereas the intron-lacking gene is expressed only in muscle cells. Although this suggested that some of these genes might be functional, our preliminary in vitro run-off assay

showed that gRL35a-B is not transcribable. Dudov and Perry stated that rpL32-4A may not be expressed when judged by its extent of methylation [12]. As the sequences of the promoter region of these two genes, gRL35a-B and rpL32-4A, are too similar to be a coincidence, the homology might indicate that the sites for the insertion of pseudogenes are limited or are required to have some specific sequence. Although not many species have been tested for their gene organization, so-called processed pseudogenes seem to exist only in higher animals [26]. It is known that the prokaryote contains only one gene for each ribosomal protein [1]. Yeast has one or two genes, and when there are two genes, both are functional [18,19]. Xenopus laevis has two genes for each ribosomal protein so far cloned, and both are also functional in this case [20,23]. Rat [27], mouse [2,11,12,16] and human [24] ribosomal protein genes have been reported for their multigene construction. We made a more detailed analysis of the evolutional change of ribosomal protein gene construction in the animal kingdom using rat L35a-cDNA as a probe. The results showed that the mammalian genes have multigene construction in common, whereas the genes of avian or lower animals have single genes. Piechaczyk et al. reported a similar observation about the glyceraldehyde-3-phosphate dehydrogenase gene [25]. In this case also, this gene had multigene construction in mammalian, and single gene in avian cells. From these, it is reasonable to consider that the existence of a pseudogene is one of the evolutionarily newly acquired features of mammalian cells. It is believed that the processed pseudogenes are synthesized by reverse transcription of mRNA in germ cells [26]. Concerning the occurrence of these pseudogenes reported in this communication, we made calculated guesses about their evolutional incidence on the basis that the rate of base substitution for neutral change is about 0.7% per 106 years [14]. The gene is gRL35a-G was calculated to have diverged approx. 41 million years ago on account of its 29.5% base substitution. Because of the absence of base substitution in gRL35a-A and gRL35a-B gene, it may be no longer than half a million years since they were integrated in the genome. Although gRL35a-G

106

showed the lowest S T value of those examined, the possibility may exist that we missed some older genes, since we selected the clones under the fairly stringent conditions already mentioned. The data presented here may offer some substantial basis for understanding the gene construction of higher animals. However, it is inappropriate at present to discuss the role of these processed pseudogenes.

Acknowledgements We wish to thank Drs. T.D. Sargent, R.B. Wallace, L.L. Jagodzinsky and J. Bonner for a generous gift of a rat genornic library. We thank Dr. Y. Mishima for his teaching of the run-off transcription assay, and Ms. M. Seki for typing the manuscript. This work was supported by Grants-in-aid from the Ministry of Education, Science and Culture of Japan.

References 1 Nomura, M., Gourse, R. and Baughman, G. (1984) Annu. Rev. Biochem. 53, 75-117 2 Monk, R.J., Meyuhas, O. and Perry, R.P. (1981) Cell 24, 301-306 3 D'Eustachio, P., Meyuhas, O., Ruddle, F. and Perry, R.P. (1981) Cell 24, 307-312 4 Schaffner, W., Kunz, G., Daetwyler, H., Telford, J., Smith, H.D. and Birnstiel, M.L. (1978) Cell 14, 655-671 5 Southern, E.M. (1975) J. Mol. Biol. 98, 503-517 6 Tanaka, T., Wakasugi, K., Kuwano, Y.,.Ishikawa, K. and Ogata, K. (1986) Eur. J. Biochem. 154, 523-527 7 Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, New York 8 Benton, W.D. and Davis, R.W. (1977) Science 196, 180-182

9 Peled-Yalif, E., Cohen-Binder, I. and Meyuhas, O. (1984) Gene 29, 157-166 10 Maxam, A.M. and Gilbert, W. (1980) Methods Enzymol. 65, 499-560 11 Wagner, M. and Perry, R.P. (1985) Mol. Cell Biol. 5, 3560-3576 12 Dudov, K.P. and Perry, R.P. (1984) Cell 37, 457-468 13 Lustig, A.J. and Petes, T.D. (1984) J. Mol. Biol. 180, 753-759 14 Pealer, F., Efstratiadis, A., Lomedico, P., Gilbert, W., Kolodner, R. and Dodgson, J. (1980) Call 20, 555-566 15 Birnstiel, M.L., Chipchase, M. and Speirs, J. (1971) Prog. Nucleic Acid Res. Mol. Biol. 11, 351-361 16 Wiedemann, L.M. and Perry, R.P. (1984) Mol. Cell Biol. 4, 2518-2528 17 Stein, J.P., Munjaal, R.P., Lagace, L., Lal, E.C., O'Malley, B.W. and Means, A.R. (1983) Proc. Natl. Acad. So. USA 80, 6485-6489 18 Woolford, J.L., Hereford, L.M. and Rosbash, M. (1979) Cell 18, 1247-1259 19 Leer, R.J., Raamsdonk-Duin, M.M.C., Schoppink, P.J., Cornelissen, M.T.E., Cohen, L.H., Magar, W.H. and Planta, R.J. (1983) Nucleic Acids Res. 11, 7759-7768 20 Loreni, F., Ruberti, I., Bozzoni, I., Pierandrei-Amaldi, P. and Amaldi, F. (1985) EMBO J. 4, 3483-3488 21 Warner, J.R., Tushinski, R.J. and Wejksnora, P.J. (1980) Ribosomes. Structure, Function and Genetics (Chambliss, G., Craven, G.R., Davies, K., Kahan, L. and Nomura, M., eds.), pp. 889-902, University Park Press, Baltimore 22 Falks, D. and Meyuhas, O. (1982) Nucleic Acids Res. 10, 789-801 23 Beccari, E., Mazzetti, P., Mileo, A., Bozzoni, I., PierandreiAmaldi, P. and Amaldi, F. (1986) Nucleic Acids Res. 14, 7633-7646 24 Chen, I-T., Dixit, A., Rhoads, D.D. and Roufa, D.J. (1986) Proc. Natl. Acad. Sci. USA 83, 6907-6911 25 Piechaczyk, M., Blanchard, J.M., Sabouty, S.R.-E., Dani, C., Marty, L. and Jeanteur, P. (1984) Nature 312, 469-471 26 Vanin, E.F. (1984) Biochim. Biophys. Acta 782, 231-241 27 Kuwano, Y, Nakanishi, O., Nabeshima, Y., Tanaka, T. and Ogata, K. (1985) J. Biochem. 97, 983-992