- Email: [email protected]
Reactive oxygen species induce cyanide-resistant respiration in potato infected by Erwinia carotovora subsp. Carotovora
Journal of Plant Physiology 246–247 (2020) 153132
Contents lists available at ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph
Reactive oxygen species induce cyanide-resistant respiration in potato infected by Erwinia carotovora subsp. Carotovora
T
Dong Huaa, Jiangong Duana, Minzhi Maa, Zhongping Lib, Hongyu Lia,* a
School of Life Sciences, Lanzhou University, Lanzhou, 730000, China Key Laboratory of Petroleum Resources Research, Lanzhou Petroleum Resources Research Center, Institute of Geology and Geophysics, Chinese Academy of Sciences, Lanzhou, 730000, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Solanum tuberosum Erwiniacarotovora subsp. carotovora Alternative oxidase Reactive oxygen species
Studies have shown that pathogenic bacteria infections induce the overproduction of reactive oxygen species (ROS) in plants. Cyanide-resistant respiration, an energy-dissipating pathway in plants, has also been induced by a pathogenic bacteria infection. However, it is unknown whether the induction of cyanide-resistant respiration under the pathogenic bacteria infection was caused by ROS. In this study, two pathogenic Erwinia strains were used to infect potato tuber, and membrane lipid peroxidation levels and the cyanide-resistant respiration capacity were determined. In addition, StAOX expression and regulation by ROS in potato tuber were analyzed. Moreover, the role of the Ca2+ pathway in regulating cyanide-resistant respiration was determined. The results showed that ROS induced cyanide-resistant respiration in potato tuber infected by Erwinia. Cyanide-resistant respiration inhibited the production of H2O2. Intracellular Ca2+ regulated the expression of calcium-dependent protein kinase (StCDPK1, StCDPK4, and StCDPK5) in potato, which indirectly controlled intracellular ROS levels. These results indicate that Ca2+ metabolism is involved in ROS-induced cyanide-resistant respiration.
1. Introduction As the fourth key food crop, potato (Solanum tuberosum. L) production has a great impact on world agricultural economic stability and food security (Czajkowski et al., 2011). Potatoes are susceptible to numerous adversities responsible for diseases that result in reduce crop yield such as bacteria, viruses, fungi, pests, and other abiotic and biotic stresses (Ross and Hunnius, 1986). In particular, soft rot caused a 3–5 % decline in annual potato production. The soft rot strains of Erwinia carotovora subsp. carotovora. (Ecc) are pathogens of various plant species such as potato, carrot, and pepper. The cell respiration rate is accelerated, and the tubers gradually rot after potato are infected by Ecc. These symptoms are accompanied by a series of physiological changes in response to bacterial diseases (Lund and Wyatt, 1972; Maher et al., 1986; Kloepper et al., 1981). As research on plant-pathogen interactions continues, some assumptions such as the energy dissipation hypothesis have emerged (Baker et al., 2001). Given the above
pathological changes and hypothesis, this study attempts to systematically study the relationship between plant-pathogen interaction and mitochondrial energy metabolism by examining the interaction between potato and Ecc. Cyanide-resistant respiration as a special energy dissipation metabolic pathway exists on the mitochondrial inner membrane that is extensively present in plants. SHAM-sensitive cyanide-resistant respiration is not just as a substitute for cytochrome respiration pathways; it is independent of complexes III and IV (Ordentlich et al., 1991; Keunen et al., 2013). Plant alternative oxidase (AOX) is important for plants to function under cyanide-resistant respiration, and its expression can be triggered by plant adversities and development processes such as drought (Dahal and Vanlerberghe, 2016), chilling (Ribascarbo et al., 2000), fruit ripening (Pandey et al., 1995), and pollination (Wang and Tian, 2007). Bacterial infection of potatoes results in activation of potato cyanide-resistant respiration (Mingala, 2015). As an active oxygen scavenger involved in plants under stress (Vanlerberghe, 2002), AOX
Abbreviations: APX, aseorbate peroxidase; BSA, albumin from bovine serum; CAT, catalase; DTT, DL-Dithiothreitol; EDTA, ethylene diamine tetraacetic acid; FW, fresh weight; H2O2, hydrogen peroxide; MDA, malondialdehyde; MET, methionine; NAC, N-acetyl-L-cysteine; NBT, nitro blue tetrazolium; NOX, NADPH oxidase; O2−, superoxide anion; POD, peroxidase; PEG, polyethylene glycol; PMSF, phenylmethylsulfonyl fluoride; PVPP, polyvinyl pyrrolidone; ROS, reactive oxygen species; SOD, superoxide dismutase; SHAM, salicylhydroxamic acid; TBA, thiobarbituric acid; TCA, trichloroacetic acid; XTT, 23-bis (2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide sodium salt ⁎ Corresponding author at: School of Life Sciences, Lanzhou University, Tianshui Road No.222, Lanzhou, China. E-mail addresses: [email protected] (D. Hua), [email protected] (H. Li). https://doi.org/10.1016/j.jplph.2020.153132 Received 13 June 2019; Received in revised form 29 January 2020; Accepted 29 January 2020 Available online 07 February 2020 0176-1617/ © 2020 Elsevier GmbH. All rights reserved.
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
2. Materials and methods
PVPP w/v, then the homogenate was centrifuged at 12,000 g for 15 min at 4℃. For each sample, 0.5 mL of the supernatant extract was added to 0.5 mL of 50 mM phosphate buffer (pH 7.8) and 1 mL of 1 mM hydroxylamine hydrochloride and incubated at 25℃ for 1 h. Then, 1 mL of 17 mM p-aminobenzene sulfonate was added. Acid (prepared with glacial acetic acid: water = 3:1) and 1 mL of 7 mM α-naphthylamine (prepared with glacial acetic acid:water = 3:1) were incubated at 25℃ for 20 min, and the wavelength was measured using a spectrophotometer at 530 nm OD value. The rate of O2− production was expressed as 0.001△OD530/min/g FW. The samples were homogenized and 3 mL of cold acetone was added. This was then centrifuged at 12,000 g for 15 min at 4 °C. For each sample, 100 μl of 20 % titanium tetrachloride (dissolved in concentrated hydrochloric acid, v / v) and 100 μl of concentrated aqueous ammonia were added to 1 mL of the supernatant. The solution was precipitated, and the precipitate was washed three times with cold acetone and then resuspended with 2 mL of 1 M sulfuric acid. The absorbance at 410 nm was measured. The measured content was expressed in μmol/g FW.
2.1. Potato tuber and pathogens
2.5. Enzymatic activity assays
The potato (Solanum tuberosum) var. Atlantic was used as the experimental material. Tubers without physical injuries and infection were selected and stored at 8℃. Tubers were washed with sterile water before experiments. Two different pathogenicity E. carotovora subsp carotovora (Ecc) strains were selected and named Ecc S and Ecc L, respectively. The pathogens were inoculated on Luria-Bertani medium (LB) in the dark at 27℃ before use. Slices of potato tuber (6 mm in diameter and approximately 2 mm in thickness) were made with a sterile puncher. The spore suspension was adjusted to a concentration of 108 spores/mL. Five slices of potato tuber were placed in each 2-mL centrifuge tube every 1 h, then 1.5 mL suspension of Ecc S or Ecc L was pipetted into each tube separately. The tubes were incubated at 25℃. After 48 h of continuous operation, potato slices with a different inoculation time were obtained. All experiments were conducted three times with qualitatively similar results.
2.5.1. NOX activity The samples of inoculated potato slices were were homogenized in 6 mL of 50 mM Tris−HCl (pH 7.5), 0.25 M sucrose, 1 mM EDTA, 3 mM DTT, 0.6 % PVPP (w/v), and 1 mM PMSF. The mixture was centrifuged at 600 g for 2 min, and the supernatant was removed by filtration. The supernatant was centrifuged at 20,000 g for 40 min at 4 °C. The pellet was suspended in 1 mL of 0.25 M sucrose, 1 mM DTT, 5 mM K phosphate (pH 7.8). The test solution (1 mL; 50 mM Tris−HCl (pH 7.5), 0.5 mM XTT) was mixed with 20 μl of the suspension. The reaction was initiated by the addition of NADPH at a final concentration of 100 μM. NOX activity was expressed as △OD470/min/g FW. Each experiment included three samples, and each sample was measured three times.
has an effect on inhibiting apoptosis (Aranha et al., 2007). This physiological phenomenon and mechanism has been widely accepted. In this study, we investigated changes in ROS and lipid peroxidation during the infection of potato slices with two different pathogenic Ecc strains. The activity of nicotinamide adenine dinucleotide phosphate oxidase (NOX) and antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), and aseorbate peroxidase (APX) of potato slices was examined, and the activity of cyanide-resistant respiration and the relative expression of alternative oxidase genes were determined. In addition, the effects of the treatment of H2O2 and ROS scavengers on the relative expression of alternative oxidase genes were examined. Transcription levels of potato CDPKs were detected simultaneously. Finally, a tentative study on the regulation of cyanide-induced respiration in Ca2+ metabolism was conducted. This study expected an in-depth discovery of cyanide-resistant respiration during plant-bacteria interactions.
2.5.2. SOD activity The samples were homogenized in 5 mL of 50 mM phosphate buffer pH 7.8. The mixture was centrifuged at 12,000 g for 20 min at 4℃ to obtain supernatant. The supernatant (0.5 mL) was mixed in 1.5 mL of 50 mM phosphate buffer (pH 7.8), 0.3 mL of 130 mM MET, 100 mM EDTA, 750 mM NBT, and 0.3 mL of 20 mM riboflavin. The absorbance at 560 nm was measured. The SOD activity was expressed as U/g FW. One unit of SOD activity is defined as the amount of enzyme that causes 50 % inhibition of NBT. Each experiment included three samples, and each sample was measured three times.
2.2. Determination of cell membrane integrity The bacterial suspension was aspirated from the centrifuge tube, and 1.5 mL of deionized water was added to the centrifuge tube. Conductivity was measured using a conductivity meter (DDS-510), and it was recorded as C1. The conductivity of deionized water without potato slices was determined and recorded as C0. The tube was placed in boiling water for 30 min and then removed and kept at 25 °C. The conductivity of each tube was measured again and recorded as C1*. The conductivity of deionized water without potato slices was measured under the same conditions and recorded as C0*. Cell membrane integrity = [1-(C1- C0)/(C1*- C0*)]×100 %
2.5.3. CAT activity The samples were homogenized in 6 mL of 50 mM phosphate buffer (pH 7.5) containing 1 % PVPP w/v and 5 mM DTT. The mixture was centrifuged at 12,000 g for 30 min at 4℃. After preheating at 25℃, 0.3 mL of 0.1 mM H2O2 was added. The absorbance was measured at 240 nm, and readings were performed once every 1 min for 4 min. CAT activity was expressed as △0.01OD240/min/g FW. Each experiment included three samples, and each sample was measured three times.
2.3. Determination of MDA content For the determination of MDA content, one gram of inoculated tissue was homogenized with a mortar and pestle in 1.5 mL of 10 % TCA (w/v) and 1 mL of 0.5 % TBA w/v. The homogenate was then centrifuged at 10,000 g for 20 min at 4℃. The supernatant was heated in a 95℃ water bath for 30 min and rapidly cooled. It was then centrifuged at 8000 g for 10 min. The absorbances of supernatant were separately measured at 532 nm, 450 nm, and 600 nm. The supernatant was used for MDA determination according to Sato et al. (2011). The MDA concentration unit was used as μmol/g fresh weight (FW).
2.5.4. POD activity The samples were homogenized in 6 mL of 1 mM PEG, 1 mM PMSF, 2 % PVPP (w/v), and 0.01 % Triton X-100 v/v. The mixture was centrifuged at 12,000 g for 30 min at 4℃. The supernatant (0.5 mL) was mixed in 0.5 mL of 0.05 M guaiacol and 1 mL of 2 % H2O2. The absorbance at 470 nm was measured. POD activity was expressed as △OD470/min/g FW. Each experiment included three samples, and each sample was measured three times.
2.4. O−2 production rate and H2O2 content assay 2.5.5. APX activity The samples were homogenized in 6 mL of 50 mM PBS. The homogenate was centrifuged at 4000 g for 10 min, and 0.1 ml of the
Inoculated potato slices were homogenized with a mortar and pestle in 3 mL of 100 mM phosphate buffer (pH 7.8) amended with 0.1 % 2
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
3. Results
supernatant was mixed with 3 ml of the reaction solution (50 mM PBS (pH 7.0), 0.1 mM EDTA-Na2, 0.3 mM AsA, 0.06 mM H2O2). The change in absorbance at 290 nm was determined rapidly, within 10−30 s. APX activity was expressed as △OD290/min/g FW.
3.1. Effects of two strains of Erwinia on cell membrane integrity and MDA content There was a negative correlation between the degree of cell membrane integrity and the trend of MDA content generally when cells were exposed to various stresses. The cell membrane integrity of the potato slices inoculated with the strongly pathogenic strain Ecc S decreased rapidly for 4 h after inoculation. The cell membrane integrity of the potato slices inoculated with the weak pathogenic strain Ecc L and the control group showed a similar downward trend during the 24-h inoculation period. The cell membrane integrity of slices at 48 h after inoculation with Ecc S and Ecc L was 67.3 % and 55.8 % lower than that of the control (Fig. 1A). The results of the assessment of MDA content showed a converse tendency to that of the assessment of cell membrane integrity. The MDA content tended to be the same during the initial period after inoculation. The MDA content of the Ecc S group was higher than that of the Ecc L group and the control group by 38.9 % and 63.9 %, respectively, 12 h after inoculation. The potato slices in the strongly pathogenic strain group showed a higher MDA content than that of the weak pathogenic strain group during the 48-h period after inoculation, and the control group showed the lowest value (Fig. 1B). These findings suggest that potato slices inoculated with Erwinia will induce cell damage and exacerbate membrane lipid peroxidation.
2.6. Extraction and separation of mitochondria Mitochondria were extracted according to a method previously described (Considine et al., 2003). Thirty grams of inoculated potato slices and abstract solution (400 mM mannitol, 1 mM EDTA, 0.1 g/L bovine serum albumin (BSA), 0.05 g/L cysteine) were mixed in a 1:2 ratio (w/v) and the adjusted pH to 7.2. The filtrate was collected by filtration through a 200 mesh sieve and centrifuged at 1000 g for 15 min. The pellet was discarded, and the supernatant was centrifuged at 10,000 g for 15 min. The pellet was centrifuged at 250 g for 10 min with washing solution (400 mM mannitol, 1 mM EDTA, 0.1 g/L BSA, pH 7.2) Supernatant was taken and centrifuged at 6000 g for 15 min. The supernatant was discarded, and the precipitate was added to the same amount of washing solution. The mitochondria suspension was used for determination of cyanide-resistant respiration rate.
2.7. Determination of cyanide-resistant respiration rate Oxygen isotope content was measured using the oxygen isotope fractionation method (OIF) according to previous descriptions (Robinson et al., 1995; Guy et al., 1989). Mitochondria were heated at 27℃ under constant temperature. The oxygen isotope content ([16O], [18O]) was measured using the mass spectrometer vacuum system in the MAT-253 gas isotope mass spectrometer. Cytochrome respiration was inhibited by 1 mM KCN, and the OIF value (Da) of the cyanideresistant respiration was measured. Anti-cyanide respiration was inhibited by 5 mM of salicylhydroxamic acid (SHAM), and the OIF value (Dc) of the cytochrome respiration was measured. The OIF value (Dt) of the total breadth of the slice was measured without any inhibitor. The OIF value of 200 μL gas was calculated. [O2] 0 represents the total oxygen content in the air, [O2] represents the total oxygen content in the gas sample taken from the reaction chamber, R0 and R represent the air and gas samples in the [18O] / [16O] values, respectively. In the function, set f = [O2] / [O2] 0, -lnf as abscissa. Set 1000 ln (R / R0) as ordinate. Through the origin of a linear regression, the slope of the resulting line was the OIF value. The total respiration rate is expressed as Vt. The cyanide-resistant respiration rate is expressed as Valt. The contribution of cyanide-resistant respiration to total respiration A, was calculated by Valt/ Vt. Valt/ Vt = 100 % - (Dt-Dc) / (Da-Dc).
3.2. Effect of two strains of Erwinia on O2− production and H2O2 content The increase in the degree of oxidation of potato slices is inevitably accompanied by the accumulation of reactive oxygen species and H2O2. The rates of O2− production of the potato slices inoculated with the strongly pathogenic strain Ecc S increased 2 h after inoculation. It was higher than that of the potato slices inoculated with the weak pathogenic strain Ecc L. After 48 h of inoculation, the rate of O2− production of the Ecc S group was 43.8 % higher than that of the Ecc L group, and 65.2 % higher than that of the aging tuber control group (Fig. 2A). The content of H2O2 in potato slices inoculated with Ecc S increased rapidly during the initial period after inoculation. The rate of increase was faster than those of the Ecc L group and the control group. The platform period was reached at 4 h inoculation. The content of H2O2 in the Ecc L group simultaneously reached a peak 48 h after inoculation. The content of H2O2 in potato slices in the control group rose slowly throughout the inoculation period (Fig. 2B). These results indicated the accumulation of ROS when potato slices were inoculated with Erwinia, and the strongly pathogenic strain were more likely to cause accumulation of cellular ROS than the weak pathogenic strain. 3.3. Effect of two strains of Erwinia on activity of NOX, SOD, CAT, POD, and APX
2.8. RNA extraction, cDNA synthesis, and quantitative RT-PCR (qRT-PCR) analysis
To reveal whether the oxidative aggravation in potato slices activated the operation of the antioxidant system, we determined changes in the activity of NADPH oxidase and antioxidant enzymes. The NOX activity of the potato slices inoculated with the strongly pathogenic strain Ecc S increased more rapidly than that of the potato slices inoculated with weak pathogenic strains Ecc L and the aging tuber control group. After 48 h of inoculation, NOX activity of the potato slices inoculated with Ecc S reached a peak and was 2.36 times higher than that of the Ecc L group (Fig. 3A). The SOD activity of the potato slices inoculated with Ecc S increased more rapidly than those of the potato slices inoculated with Ecc L and the control group. SOD activity rose rapidly during the initial phase after inoculation and peaked at 48 h. It was 1.84 times and 3.78 times higher than those of the Ecc L and control groups, respectively, 48 h after inoculation (Fig. 3B). There was no significant difference in CAT activity between the experimental group and the control group during the 12-h inoculation. After 12 h of
Total RNA was extracted using the RNA extract kit (Sangon Biotech Co., Shanghai). Reverse transcriptions were used from the M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech Co., Shanghai). To examine the expression of potato genes, real-time PCR analysis was performed.The Real-PCR Detection System 2 × SG Fast qPCR Master Mix (Sangon Biotech Co., Shanghai) was used and performed with an iCycler iQ Multicolor Real-PCR Detection System (Bio-Rad, Hercules, CA, U.S.A.). Each reaction (20-μl total volume) consisted of 10 μl of SYBR Green Supermix, 0.1 μM of diluted cDNA, and 0.1 μM each of forward and reverse primers. The elongation factor 1-alpha(EF1α) (LOC102577640) was used as an internal reference control gene. Relative gene expression was calculated as described for the 2−ΔΔCt method (Livak and Schmittgen, 2001), Table 1.
3
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Table 1 A list of primer sets for qRT-PCR analysis. Gene
Gene annotation
Forward primer (5′- 3′)
Reverse primer (5′- 3′)
StAOX StCDPK1 StCDPK4 StCDPK5 StEF1α
Alternative oxidase calcium-dependent protein kinase 1 calcium-dependent protein kinase 4 calcium-dependent protein kinase 5 Elongation factor 1-alpha
AGCAACAAGGATGACCCGAG TGGCTCAAGGTAGGTGGAGT AGTGGCGGTGAGTTGTTTGA ATGCCGTGGATCTTTCGGAG ATTGGAAACGGATATGCTCCA
CGATGGATTCGCCGGAAAAC ATCCAAGTCTGGCCAATCCG GAGAATGACACGCCTCCACA TTCATGGTGACGAGGGGTTG TCCTTACCTGAACGCCTGTCA
Fig. 1. Effect of two strains of Erwinia carotovora subsp. carotovora on cell membrane integrity, aging potato tuber as control(A). MDA content in inoculated slices of potato tuber(B).
3.4. Effect of two strains of Erwinia on contribution to cyanide-resistant respiration
inoculation, the CAT activity of the Ecc S group increased rapidly and peaked at 48 h. It was 32.6 % and 39.5 % higher than those of the Ecc L and control groups, respectively, 48 h after inoculation (Fig. 3C). There was no significant difference in POD activity between the experimental group and the control group during the period 8 h after inoculation, and 8 h after inoculation, the POD activity of both the Ecc S group and Ecc L group increased rapidly and peaked at 48 h after inoculation (Fig. 3D). The potato APX activity in the Ecc S group increased rapidly during the initial period of interaction, and the rate was higher than that in the Ecc L group. The APX activity of the aging control group increased slowly throughout the 48-h monitoring period (Fig. 3E). These results indicate that potato slices inoculated with two different pathogenic Erwinia caused an accumulation of H2O2 and increase in the activity of antioxidant enzymes. These results indicate that infection by Erwinia results in the efficient functioning of antioxidant systems and the continuous clearance of ROS by antioxidant enzymes.
In order to accurately determine the capacity of cyanide-resistant respiration after potato were inoculated with Erwinia, the oxygen isotope fractionation was used to measure accurate cyanide-resistant respiration values. The oxygen isotope fractionation values of potato slices inoculated with the strongly pathogenic strain Ecc S were 2.52 % for cyanide-resistant respiration, 1.77 % for cytochrome respiration, and 2.13 % for total respiration (Fig. 4A). The oxygen isotope fractionation values of potato slices inoculated with the weak pathogenic strain Ecc L were 2.36 % for cyanide-resistant respiration, 1.80 % for cytochrome respiration, and 2.02 % for total respiration (Fig. 4B). The oxygen isotope fractionation values of aging potato slices in the control group were 2.50 % for cyanide-resistant respiration, 1.74 % for cytochrome respiration, and 1.96 % for total respiration (Fig. 4C). In addition, the actual contribution values of cyanide-resistant respiration were calculated (Table 2). The contribution value of potato slices inoculated with Ecc S was 48.30 ± 1.41 %, for potato slices inoculated
Fig. 2. O2− production (A) and H2O2 content (B) in slices of potato tuber inoculated with two Erwinia carotovora subsp. strains carotovora. 4
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 3. Activity of NOX (A), SOD (B), CAT (C), POD (D), and APX (E)in slices of potato tuber inoculated with two Erwinia carotovora subsp. strains carotovora.
groups inoculated with Ecc S and Ecc L showed StAOX levels 7.8 times and 6.1 times higher than those in the control group 4 h after inoculation. The transcription level of StAOX was then rapidly downregulated. The degree of upregulation was not significant during the 4 h–24 h period after inoculation (Fig. 5). These results indicate that whether potato slices were infected with different pathogenicity of Erwinia or the aging process, StAOX up-regulation were triggered. The sharp up-regulation of transcriptional levels in a short period of time suggests that potatoes respond rapidly to cyanide respiration after infection with Erwinia.
with Ecc L the contribution value was 38.55 ± 1.18 %, and for aging potato slices in the control group it was 29.42 ± 1.09 %. All of these results were measured 4 h after inoculation. These results indicate that the infection of Erwinia accelerates the operation of cyanide-resistant respiration in potatoes and is more severe for strongly pathogenic bacteria. 3.5. Effect of two strains of Erwinia on relative transcript level of StAOX To investigate the operation of cyanide-resistant respiration after inoculation with two strains of Erwinia in potato slices, we first analyzed the mRNA transcript level of the functional protein StAOX of the potato cyanide-resistant respiration. The mRNA transcript level of potato slices inoculated with the strongly pathogenic strain Ecc S was rapidly upregulated at 4 h after inoculation, and the highest transcript level of StAOX was observed 4 h after inoculation. The experimental
3.6. Effect of cyanide-resistant respiration on the production of H2O2 In order to further verify the relationship between H2O2 and cyanide-resistant respiration during the interaction between potato and Erwinia, the potato slices were treated with 5 mM SHAM to inhibit 5
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 4. Oxygen isotope fractionation values (D) for respiration of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains. A: DSa: D values through cyanide-resistant respiration of potato tuber inoculated with Ecc S, DSc: D values through cytochrome respiration of potato tuber inoculated with Ecc S, Ds: D values through total of potato tuber inoculated with Ecc S. B: DLa: D values through cyanide-resistant respiration of potato tuber inoculated with Ecc L, DLc: D values through cytochrome respiration of potato tuber inoculated with Ecc L, DL: D values through total of potato tuber inoculated with Ecc L. C: Dca: D values through cyanide-resistant respiration with aging potato tuber, Dcc: D values through cytochrome respiration with aging potato tuber, Dc: D values through total of aging potato tuber. Table 2 Oxygen isotope fractionation D (%) and the actual contribution of cyanide-resistant respiration A (%).
+KCN +SHAM No inhibitor A(%)
Ecc S
Ecc L
Aging
2.521 ± 0.026 1.767 ± 0.032 2.131 ± 0.015 48.30 ± 1.41
2.364 ± 0.017 1.801 ± 0.024 2.018 ± 0.019 38.55 ± 1.18
2.504 ± 0.011 1.735 ± 0.014 1.960 ± 0.018 29.42 ± 1.09
Fig. 6. H2O2 content in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of added SHAM(gray bar) and treated with nothing (white bar) at 4-h postinoculated time.
3.7. Effects of ROS scavenger and ROS on the relative transcript level of StAOX Fig. 5. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains at different times. Black bar graph represents potato inoculated with Ecc S; gray bar graph represents potato inoculated with Ecc L; white bar graph represents aging potato tuber.
In order to further explore the effect of the ROS level on cyanideresistant respiration in potato, we treated H2O2 and ROS scavenger NAC in the experimental group to analyze changes in transcriptional level of StAOX 4 h after inoculation. The selection of 4 h was based on StAOX being most upregulated 4 h after inoculation (Fig. 6). The relative transcript level of StAOX on the NAC treatment group was downregulated compared with the non-treatment group both in the Ecc S and Ecc L group 4 h after inoculation. The relative transcript level of StAOX on the H2O2 treatment group was upregulated compared with the nontreatment group. However, the downregulation and upregulation were not obvious. The level of StAOX transcription in each treatment in the experimental group was higher than that in the corresponding control group (Fig. 7). These results showed that treatment of exogenous ROS triggered the upregulation of StAOX transcription levels, further leading to the operation of cyanide-resistant respiration. In addition to the treatment of ROS scavengers, NAC’s downregulation of the transcription level of StAOX was limited. These results indicate that the presence of ROS was a factor affecting the operation of potato cyanide-resistant respiration at the transcriptional level.
cyanide-resistant respiration for 4 h. The results showed that in both the potato inoculated with Erwinia and the aging control group, the treatment of 5 mM SHAM caused more accumulation of H2O2 than that in the untreated group. In the Ecc L inoculated group, the H2O2 content under the SHAM treatment was 47.7 % higher than that in the untreated group. In the Ecc S inoculated group, the H2O2 content under the SHAM treatment was 29.3 % higher than that of the untreated group. Both were higher than the 22.7 % of the control group (Fig. 6). These results indicate the operation of cyanide-resistant respiration was negatively correlated with the accumulation of H2O2 during the interaction between potato and Erwinia. The operation of cyanide-resistant respiration inhibited the peroxidation of the potato tubers.
6
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 7. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of treated NAC (white bar), under the condition of treated H2O2 (black bar) and treated with nothing (gray bar) at 4-h postinoculated time.
Fig. 9. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of treated EGTA (gray bar) and treated with nothing (black bar) at 4-h postinoculated time. Aging tuber as control.
3.8. Relative transcript level of StCDPKs and effect of Ca2+ on relative transcript level of StAOX
EGTA, and then detected changes in the transcription level of the StAOX gene 4 h after inoculation. The results showed that the relative expression levels of the StAOX gene were upregulated. After treatment with Ca2+ chelating agent EGTA, the relative expression of the StAOX gene was 81.5 %, 68.2 %, and 50.3 % higher in tubers with Ecc S inoculation, Ecc L inoculation and the aging tuber than that without EGTA treatment (Fig. 9). These results suggest that the concentration of Ca2+ and the regulation of calmodulin play a regulatory role in the operation of cyanide-resistant respiration.
Ca2+ metabolism regulates the occurrence of many physiological processes in plant cells. In order to explore the effect of the Ca2+ regulatory pathway on the cyanide-resistant respiration of potato, we designed primers to detect changes in the transcriptional level of the potato CDPK gene family after the inoculation of Erwinia. The relative transcription level of StCDPK1 was continuously downregulated from the initial inoculation period to 24 h after inoculation (Fig. 8A). We hypothesized that StCDPK1 played a negative regulatory role in the regulation of ROS-induced cyanide-resistant respiration. This result was opposite to StCDPK4 and StCDPK5. The relative transcription level of StCDPK4 and StCDPK5 showed similar upregulation 4 h after inoculation (Fig. 8B and C). The results were similar to the trend seen in the transcriptional level change of the StAOX gene. This suggests that Ca2+ may regulate the action of cyanide-resistant respiration. In order to verify the regulation of Ca2+ concentration on the cyanide-resistant respiration of potato, we set up treatment with 10 mM
4. Discussion Potatoes can be wounded by insect bites, strong wind erosion, and hail damage during the growth process. Moreover, harvesting and transportation also cause mechanical damage. Potatoes are susceptible to pathogenic microorganisms that enter the body through wounds and stomata. This research was based on the interaction between potato and
Fig. 8. Relative expression of StCDPK1, StCDPK4, and StCDPK5 genes in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains at 4=h postinoculated time. Black ba represents potato inoculated with Ecc S; gray bar represents potato inoculated with Ecc L; white bar represents aging potato tuber. 7
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
resistant respiration. This research explored the regulation process of ROS-induced cyanide-resistant respiratory operation. Existing studies have shown that Ca2+ plays an important regulatory role in the plant defense response and autophagy. ROS as an important signal substance, plays a role in regulating the intracellular Ca2+ concentration (Honda et al., 2007). We designed experiments to detect the transcription levels of Ca2+related proteins StCDPK1, StCDPK4, and StCDPK5 during the interaction between potato and Erwinia within 24 h after inoculation. The relative transcription level of StCDPK1 was continuously downregulated from the initial inoculation period to 24 h (Fig. 8A). We hypothesized that StCDPK1 plays a negative regulatory role in the regulation of ROSinduced cyanide-resistant respiration. This result was opposite to StCDPK4 and StCDPK5. Relative transcription levels of StCDPK4 and StCDPK5 showed upregulation 4 h after inoculation (Fig. 8B and C), and this result was similar to the upregulation trend in the transcriptional level of the StAOX gene. We have reason to assume that the Ca2+ signaling pathway indirectly regulated the operation of potato mitochondrial cyanide-resistant respiration by regulating ROS production. Relevant experiments have verified the above hypothesis. The intracellular Ca2+ concentration cannot be changed easily. However, we changed the extracellular Ca2+ concentration and treated the Ca2+ chelator EGTA during the interaction between potato and Erwinia. Changes in the transcription level of StAOX were observed (Fig. 9). Treatment with EGTA resulted in a decrease in extracellular Ca2+ concentration, and the transcription level of StAOX was also reduced to correspond with that of the non-treated group. This change was not obvious compared with the results presented in Fig. 5. Therefore, we suspected that there are other ways to participate in the regulation of cyanide-resistant respiration. A regulatory pathway for the anti-cyanide respiration of plants caused by bacterial infection can be attempted to be established. Potatoes are highly susceptible to soft rot bacteria during the growth stage and storage. The threonine-protein kinase FLS2 on the cell wall first responds to the flagellin of the pathogen (Gómez-Gómez et al., 2001). Signals are transmitted through ion channels to cyclic nucleotide gated channels (CNGC), whose conformational changes mediate the transfer of calcium ions inside and outside the cell wall (Raíces et al., 2003; Gromadka et al., 2017). Increased intracellular calcium ion concentration activates phosphorylation of CDPKs. It was well known that phosphorylation of CDPKs in plant cells activates reactive burst oxidase (RBOH) and accelerate the oxidation of NAD(P)H to NAD(P)+, as well as the accumulation of ROS (Takahashi et al., 2012; Kobayashi et al., 2007). The accumulation of reactive oxygen species (ros) and electrons in the mitochondrial respiratory electron transport chain (mETC) promotes the conformational change and active activation of the alternant oxidase, which relieves the metabolic pressure of ATP on the mETC. However, the high adaptability formed in the process of plant evolution means that there are many metabolic regulatory pathways in plant cells. Thereby it is reasonable to speculate that mitochondrial anti-cyanide respiration is regulated by other signaling molecules and metabolic regulatory pathways, which need further study.
the soft rot pathogen Erwinia. This study found an increase in the production of ROS, loss of cell membrane integrity, change of MDA content, and rise in antioxidative enzyme activity in Erwinia inoculated slices. ROS was found to be a factor causing lipid peroxidation and cell membrane integrity when comparing the outcome of inoculation with the weakly pathogenic Ecc L and strongly pathogenic Ecc S. This study proved that the strongly pathogenic Ecc S inoculation caused an earlier and higher level of ROS production, loss of cell membrane integrity, and a rise in NADH oxidase activity and antioxidative enzyme activity (Fig. 1, 2 and 3). These findings are similar to those in a previous tomato study (Dey et al., 2009). Existing studies have shown that the above physiological phenomena take place when plants are harmed, leading to a general acceleration of anti-cyanide respiration (Rychter and Mikulska, 2010; Borovik and Grabelnych, 2018). Because the activity of anti-cyanide respiration is closely related to the internal and external conditions of the tissue, the activity of anti-cyanide respiration depends on the need of the plant tissue to perform specific physiological functions. Therefore, to accurately determine the activity of the pathway under different physiological and environmental conditions, it is necessary to understand its regulatory mechanism and physiological significance. The determination of cyanide-resistant respiration activity using the oxygen isotope fractionation method (OIF) is more accurate and effective than the hydroxamate inhibition method. Compared with previous studies (Day et al., 1996), a disadvantage of the hydroxamate inhibition method was that the inhibition of the cyanide respiratory pathway would lead to a partial flow of respiratory electrons from this pathway to the cytochrome pathway. In addition, the oxonic acid inhibitor in the inhibition method has a certain promoting effect on total mitochondrial respiration. The above reasons lead to a lower value of cyanide-resistant respiratory activity than actual activity. The OIF method used the oxygen isotope fractionation effect in the respiratory process to obtain the operation of the cyanide-resistant respiratory pathway. The OIF value of each respiratory pathway was not affected by the rate of respiration. The results we measured using this method were higher than those determined by the inhibitor method. However, the proportion of contribution values for each respiratory pathway was approximately constant. Therefore, the OIF method could avoid the errors that may occur in the inhibitor method (Fig. 4). The above conclusions demonstrate that the operation of cyanide-resistant respiration during the interaction between potato and Erwinia was accompanied by changes in physiological levels. We have observed the operation of the antioxidant system, the activation of cyanide-resistant respiration, and the increase in cell damage when the potato was infected with Erwinia. Subsequent inhibition of cyanide-resistant respiration with the inhibitor SHAM reversed the relationship between ROS and cyanide-resistant respiration. After the cyanide-resistant respiration was inhibited, the accumulation of H2O2 was further aggravated (Fig. 6). This study have shown that in addition to the antioxidant system, anti-cyanide respiration has positive effects on plant antioxidants. The cyanide-resistant respiration level of potato mitochondria changes with the infection of Erwinia, so it is assumed that the transcription level of the alternate oxidase is also regulated. This study also analyzed the changes in the potato mitochondrial cyanide-resistant respiratory function protein StAOX from a transcriptional level. The molecular evidence confirmed the above conclusion. The transcriptional level of StAOX was rapidly upregulated at the initial stage of interaction, especially 4 h after inoculation (Fig. 5). This is consistent with changes in the rate of production of ROS and the activity of antioxidant enzymes. Most importantly, subsequent low levels of transcriptional reversion indicated that the alternating oxidase has reached a relatively saturated workload, and StAOX was no longer involved in large amounts of transcription and translation. Further, we found that during the addition of exogenous ROS scavenger NAC, the downregulation of StAOX was not obvious (Fig. 7), indicating that endogenous ROS also played an important role in inducing cyanide-
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This work was funded by National Natural Science Foundation of China (Grant No.31571989, Grant No. 31772147) and The Fundamental Research Funds for the Central Universities of China (lzujbky-2018-40, lzujbky-2017-206). 8
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
References
erwinia carotovora, var. Carotovora. Am. Potato J. 58 (11), 585–592. Kobayashi, M., Ohura, I., Kawakita, K., Yokota, N., Fujiwara, M., Shimamoto, K., et al., 2007. Calcium-dependent protein kinases regulate the production of reactive oxygen species by potato nadph oxidase. Plant Cell 19 (3), 1065–1080. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative pcr and the 2(-delta delta c(t)) method. Methods 25 (4), 402–408. Lund, B.M., Wyatt, G.M., 1972. The effect of oxygen and carbon dioxide concentrations on bacterial soft rot of potatoes. I. King edward potatoes inoculated with erwinia carotovora, var. Atroseptica. Potato Res. 15 (2), 174–179. Maher, E.A., Boer, S.H.D., Kelman, A., 1986. Serogroups of erwinia carotovora, involved in systemic infection of potato plants and infestation of progeny tuber. Am. Potato J. 63 (1), 1–11. Mingala, C., 2015. Evaluation of treatment alternatives against respiratory bacterial pathogens of small and large ruminants. Adv. Environ. Biol. 9 (8), 149–155. Ordentlich, A., Linzer, R.A., Raskin, I., 1991. Alternative respiration and heat evolution in plants. Plant Physiol. 97 (4), 1545–1550. Pandey, M., Zeng, Y.R.N., Srivastava, G.C., Zeng, Y.R., 1995. Alternate respiration during ripening of tomato fruits. Indian J. Plant Physiol. 38 (2), 182–183. Raíces, M., Gargantini, P.R., Chinchilla, D., Crespi, M., Télleziñón, M.T., Ulloa, R.M., 2003. Regulation of cdpk isoforms during tuber development. Plant Mol. Biol. 52 (5), 1011–1024. Ribascarbo, M., Aroca, R., Gonzálezmeler, M.A., 2000. The electron partitioning between the cytochrome and alternative respiratory pathways during chilling recovery in two cultivars of maize differing in chilling sensitivity. Plant Physiol. 122 (1), 199–204. Robinson, S.A., Ribascarbo, M., Yakir, D., Giles, L., Reuveni, Y., Berry, J.A., et al., 1995. Beyond sham and cyanide: opportunities for studying the alternative oxidase in plant respiration using oxygen isotope discrimination. Funct. Plant Biol. 22 (3), 487–496. Ross, H., Hunnius, W., 1986. Potato Breeding - Problems and Perspectives. Fortschritte Der Pflanzenzuechtung. Rychter, A.M., Mikulska, M., 2010. The relationship between phosphate status and cyanide-resistant respiration in bean roots. Physiol. Plant. 79 (4), 663–667. Sato, Y., Masuta, Y., Saito, K., Murayama, S., Ozawa, K., 2011. Enhanced chilling tolerance at the booting stage in rice by transgenic overexpression of the ascorbate peroxidase gene, osapxa. Plant Cell Rep. 30 (3), 399–406. Takahashi, S., Kimura, S., Kaya, H., Iizuka, A., Wong, H.L., Shimamoto, K., et al., 2012. Reactive oxygen species production and activation mechanism of the rice nadph oxidase osrbohb. J. Biochem. 152 (1), 37–43. Vanlerberghe, G.C., 2002. Induction of mitochondrial alternative oxidase in response to a cell signal pathway down-regulating the cytochrome pathway prevents programmed cell death. Plant Physiol. 129 (4), 1829–1842. Wang, Y., Tian, H., 2007. The study progress of alterative oxidase in higher plant. Acta Bot. Yunnanica 29 (4), 447–456.
Aranha, M.M., Matos, A.R., Teresa, M.A., Vaz, P.V., Rodrigues, C.M., Arrabaça, J.D., 2007. Dinitro-o-cresol induces apoptosis-like cell death but not alternative oxidase expression in soybean cells. J. Plant Physiol. 164 (6), 675–684. Baker, C.J., Orlandi, E.W., Deahl, K.L., 2001. Oxidative metabolism in plant/bacteria interactions: characterization of a unique oxygen uptake response of potato suspension cells. Physiol. Mol. Plant Pathol. 59 (1), 17–23. Borovik, O.A., Grabelnych, O.I., 2018. Mitochondrial alternative cyanide-resistant oxidase is involved in an increase of heat stress tolerance in spring wheat. J. Plant Physiol. 231, 310. Considine, M.J., Goodman, M., Echtay, K.S., Laloi, M., Whelan, J., Brand, M.D., et al., 2003. Superoxide stimulates a proton leak in potato mitochondria that is related to the activity of uncoupling protein. J. Biol. Chem. 278 (25), 22298–22302. Czajkowski, R., Pérombelon, M.C.M., Veen, J.A.V., Wolf, J.M.V.D., 2011. Control of blackleg and tuber soft rot of potato caused by pectobacterium, and dickeya, species: a review. Plant Pathol. 60 (6), 999–1013. Dahal, K., Vanlerberghe, G.C., 2016. Alternative oxidase respiration maintains both mitochondrial and chloroplast function during drought. New Phytol. 213 (2). Day, D.A., Krab, K., Lambers, H., Moore, A.L., Siedow, J.N., Wagner, A.M., et al., 1996. The cyanide-resistant oxidase: to inhibit or not to inhibit, that is the question. Plant Physiol. 110 (1), 1. Dey, S., Ghose, K., Basu, D., 2009. Fusarium elicitor-dependent calcium influx and associated ros generation in tomato is independent of cell death. Eur. J. Plant Pathol. 126 (2), 217–228. Gómez-Gómez, L., Bauer, Z., Boller, T., 2001. Both the extracellular leucine-rich repeat domain and the kinase activity of fsl2 are required for flagellin binding and signaling in arabidopsis. Plant Cell 13 (5), 1155–1163. Gromadka, R., Cieśla, J., Olszak, K., Szczegielniak, J., Muszyńska, G., PolkowskaKowalczyk, L., 2017. Genome-wide analysis and expression profiling of calcium-dependent protein kinases in potato (solanum tuberosum). Plant Growth Regul. 2, 1–13. Guy, R.D., Berry, J.A., Fogel, M.L., Hoering, T.C., 1989. Differential fractionation of oxygen isotopes by cyanide-sensitive respiration in plants. Planta 177 (4), 483–491. Honda, K., Koguchi, M., Koga, K., Nakajima, K., Kobayashi, F., Migita, K., et al., 2007. Contribution of ca(2+) -dependent protein kinase c in the spinal cord to the development of mechanical allodynia in diabetic mice. Biol. Pharm. Bull. 30 (5), 990–993. Keunen, E., Remans, T., Opdenakker, K., Jozefczak, M., Gielen, H., Guisez, Y., et al., 2013. A mutant of the arabidopsis thaliana lipoxygenase1 gene shows altered signalling and oxidative stress related responses after cadmium exposure. Plant Physiol. Biochem. 63 (4), 272–280. Kloepper, J.W., Harrison, M.D., Brewer, J.W., 1981. Effect of temperature on differential persistence and insect transmission of erwinia carotovora, var. atroseptica, and
9
Contents lists available at ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.com/locate/jplph
Reactive oxygen species induce cyanide-resistant respiration in potato infected by Erwinia carotovora subsp. Carotovora
T
Dong Huaa, Jiangong Duana, Minzhi Maa, Zhongping Lib, Hongyu Lia,* a
School of Life Sciences, Lanzhou University, Lanzhou, 730000, China Key Laboratory of Petroleum Resources Research, Lanzhou Petroleum Resources Research Center, Institute of Geology and Geophysics, Chinese Academy of Sciences, Lanzhou, 730000, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Solanum tuberosum Erwiniacarotovora subsp. carotovora Alternative oxidase Reactive oxygen species
Studies have shown that pathogenic bacteria infections induce the overproduction of reactive oxygen species (ROS) in plants. Cyanide-resistant respiration, an energy-dissipating pathway in plants, has also been induced by a pathogenic bacteria infection. However, it is unknown whether the induction of cyanide-resistant respiration under the pathogenic bacteria infection was caused by ROS. In this study, two pathogenic Erwinia strains were used to infect potato tuber, and membrane lipid peroxidation levels and the cyanide-resistant respiration capacity were determined. In addition, StAOX expression and regulation by ROS in potato tuber were analyzed. Moreover, the role of the Ca2+ pathway in regulating cyanide-resistant respiration was determined. The results showed that ROS induced cyanide-resistant respiration in potato tuber infected by Erwinia. Cyanide-resistant respiration inhibited the production of H2O2. Intracellular Ca2+ regulated the expression of calcium-dependent protein kinase (StCDPK1, StCDPK4, and StCDPK5) in potato, which indirectly controlled intracellular ROS levels. These results indicate that Ca2+ metabolism is involved in ROS-induced cyanide-resistant respiration.
1. Introduction As the fourth key food crop, potato (Solanum tuberosum. L) production has a great impact on world agricultural economic stability and food security (Czajkowski et al., 2011). Potatoes are susceptible to numerous adversities responsible for diseases that result in reduce crop yield such as bacteria, viruses, fungi, pests, and other abiotic and biotic stresses (Ross and Hunnius, 1986). In particular, soft rot caused a 3–5 % decline in annual potato production. The soft rot strains of Erwinia carotovora subsp. carotovora. (Ecc) are pathogens of various plant species such as potato, carrot, and pepper. The cell respiration rate is accelerated, and the tubers gradually rot after potato are infected by Ecc. These symptoms are accompanied by a series of physiological changes in response to bacterial diseases (Lund and Wyatt, 1972; Maher et al., 1986; Kloepper et al., 1981). As research on plant-pathogen interactions continues, some assumptions such as the energy dissipation hypothesis have emerged (Baker et al., 2001). Given the above
pathological changes and hypothesis, this study attempts to systematically study the relationship between plant-pathogen interaction and mitochondrial energy metabolism by examining the interaction between potato and Ecc. Cyanide-resistant respiration as a special energy dissipation metabolic pathway exists on the mitochondrial inner membrane that is extensively present in plants. SHAM-sensitive cyanide-resistant respiration is not just as a substitute for cytochrome respiration pathways; it is independent of complexes III and IV (Ordentlich et al., 1991; Keunen et al., 2013). Plant alternative oxidase (AOX) is important for plants to function under cyanide-resistant respiration, and its expression can be triggered by plant adversities and development processes such as drought (Dahal and Vanlerberghe, 2016), chilling (Ribascarbo et al., 2000), fruit ripening (Pandey et al., 1995), and pollination (Wang and Tian, 2007). Bacterial infection of potatoes results in activation of potato cyanide-resistant respiration (Mingala, 2015). As an active oxygen scavenger involved in plants under stress (Vanlerberghe, 2002), AOX
Abbreviations: APX, aseorbate peroxidase; BSA, albumin from bovine serum; CAT, catalase; DTT, DL-Dithiothreitol; EDTA, ethylene diamine tetraacetic acid; FW, fresh weight; H2O2, hydrogen peroxide; MDA, malondialdehyde; MET, methionine; NAC, N-acetyl-L-cysteine; NBT, nitro blue tetrazolium; NOX, NADPH oxidase; O2−, superoxide anion; POD, peroxidase; PEG, polyethylene glycol; PMSF, phenylmethylsulfonyl fluoride; PVPP, polyvinyl pyrrolidone; ROS, reactive oxygen species; SOD, superoxide dismutase; SHAM, salicylhydroxamic acid; TBA, thiobarbituric acid; TCA, trichloroacetic acid; XTT, 23-bis (2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide sodium salt ⁎ Corresponding author at: School of Life Sciences, Lanzhou University, Tianshui Road No.222, Lanzhou, China. E-mail addresses: [email protected] (D. Hua), [email protected] (H. Li). https://doi.org/10.1016/j.jplph.2020.153132 Received 13 June 2019; Received in revised form 29 January 2020; Accepted 29 January 2020 Available online 07 February 2020 0176-1617/ © 2020 Elsevier GmbH. All rights reserved.
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
2. Materials and methods
PVPP w/v, then the homogenate was centrifuged at 12,000 g for 15 min at 4℃. For each sample, 0.5 mL of the supernatant extract was added to 0.5 mL of 50 mM phosphate buffer (pH 7.8) and 1 mL of 1 mM hydroxylamine hydrochloride and incubated at 25℃ for 1 h. Then, 1 mL of 17 mM p-aminobenzene sulfonate was added. Acid (prepared with glacial acetic acid: water = 3:1) and 1 mL of 7 mM α-naphthylamine (prepared with glacial acetic acid:water = 3:1) were incubated at 25℃ for 20 min, and the wavelength was measured using a spectrophotometer at 530 nm OD value. The rate of O2− production was expressed as 0.001△OD530/min/g FW. The samples were homogenized and 3 mL of cold acetone was added. This was then centrifuged at 12,000 g for 15 min at 4 °C. For each sample, 100 μl of 20 % titanium tetrachloride (dissolved in concentrated hydrochloric acid, v / v) and 100 μl of concentrated aqueous ammonia were added to 1 mL of the supernatant. The solution was precipitated, and the precipitate was washed three times with cold acetone and then resuspended with 2 mL of 1 M sulfuric acid. The absorbance at 410 nm was measured. The measured content was expressed in μmol/g FW.
2.1. Potato tuber and pathogens
2.5. Enzymatic activity assays
The potato (Solanum tuberosum) var. Atlantic was used as the experimental material. Tubers without physical injuries and infection were selected and stored at 8℃. Tubers were washed with sterile water before experiments. Two different pathogenicity E. carotovora subsp carotovora (Ecc) strains were selected and named Ecc S and Ecc L, respectively. The pathogens were inoculated on Luria-Bertani medium (LB) in the dark at 27℃ before use. Slices of potato tuber (6 mm in diameter and approximately 2 mm in thickness) were made with a sterile puncher. The spore suspension was adjusted to a concentration of 108 spores/mL. Five slices of potato tuber were placed in each 2-mL centrifuge tube every 1 h, then 1.5 mL suspension of Ecc S or Ecc L was pipetted into each tube separately. The tubes were incubated at 25℃. After 48 h of continuous operation, potato slices with a different inoculation time were obtained. All experiments were conducted three times with qualitatively similar results.
2.5.1. NOX activity The samples of inoculated potato slices were were homogenized in 6 mL of 50 mM Tris−HCl (pH 7.5), 0.25 M sucrose, 1 mM EDTA, 3 mM DTT, 0.6 % PVPP (w/v), and 1 mM PMSF. The mixture was centrifuged at 600 g for 2 min, and the supernatant was removed by filtration. The supernatant was centrifuged at 20,000 g for 40 min at 4 °C. The pellet was suspended in 1 mL of 0.25 M sucrose, 1 mM DTT, 5 mM K phosphate (pH 7.8). The test solution (1 mL; 50 mM Tris−HCl (pH 7.5), 0.5 mM XTT) was mixed with 20 μl of the suspension. The reaction was initiated by the addition of NADPH at a final concentration of 100 μM. NOX activity was expressed as △OD470/min/g FW. Each experiment included three samples, and each sample was measured three times.
has an effect on inhibiting apoptosis (Aranha et al., 2007). This physiological phenomenon and mechanism has been widely accepted. In this study, we investigated changes in ROS and lipid peroxidation during the infection of potato slices with two different pathogenic Ecc strains. The activity of nicotinamide adenine dinucleotide phosphate oxidase (NOX) and antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), and aseorbate peroxidase (APX) of potato slices was examined, and the activity of cyanide-resistant respiration and the relative expression of alternative oxidase genes were determined. In addition, the effects of the treatment of H2O2 and ROS scavengers on the relative expression of alternative oxidase genes were examined. Transcription levels of potato CDPKs were detected simultaneously. Finally, a tentative study on the regulation of cyanide-induced respiration in Ca2+ metabolism was conducted. This study expected an in-depth discovery of cyanide-resistant respiration during plant-bacteria interactions.
2.5.2. SOD activity The samples were homogenized in 5 mL of 50 mM phosphate buffer pH 7.8. The mixture was centrifuged at 12,000 g for 20 min at 4℃ to obtain supernatant. The supernatant (0.5 mL) was mixed in 1.5 mL of 50 mM phosphate buffer (pH 7.8), 0.3 mL of 130 mM MET, 100 mM EDTA, 750 mM NBT, and 0.3 mL of 20 mM riboflavin. The absorbance at 560 nm was measured. The SOD activity was expressed as U/g FW. One unit of SOD activity is defined as the amount of enzyme that causes 50 % inhibition of NBT. Each experiment included three samples, and each sample was measured three times.
2.2. Determination of cell membrane integrity The bacterial suspension was aspirated from the centrifuge tube, and 1.5 mL of deionized water was added to the centrifuge tube. Conductivity was measured using a conductivity meter (DDS-510), and it was recorded as C1. The conductivity of deionized water without potato slices was determined and recorded as C0. The tube was placed in boiling water for 30 min and then removed and kept at 25 °C. The conductivity of each tube was measured again and recorded as C1*. The conductivity of deionized water without potato slices was measured under the same conditions and recorded as C0*. Cell membrane integrity = [1-(C1- C0)/(C1*- C0*)]×100 %
2.5.3. CAT activity The samples were homogenized in 6 mL of 50 mM phosphate buffer (pH 7.5) containing 1 % PVPP w/v and 5 mM DTT. The mixture was centrifuged at 12,000 g for 30 min at 4℃. After preheating at 25℃, 0.3 mL of 0.1 mM H2O2 was added. The absorbance was measured at 240 nm, and readings were performed once every 1 min for 4 min. CAT activity was expressed as △0.01OD240/min/g FW. Each experiment included three samples, and each sample was measured three times.
2.3. Determination of MDA content For the determination of MDA content, one gram of inoculated tissue was homogenized with a mortar and pestle in 1.5 mL of 10 % TCA (w/v) and 1 mL of 0.5 % TBA w/v. The homogenate was then centrifuged at 10,000 g for 20 min at 4℃. The supernatant was heated in a 95℃ water bath for 30 min and rapidly cooled. It was then centrifuged at 8000 g for 10 min. The absorbances of supernatant were separately measured at 532 nm, 450 nm, and 600 nm. The supernatant was used for MDA determination according to Sato et al. (2011). The MDA concentration unit was used as μmol/g fresh weight (FW).
2.5.4. POD activity The samples were homogenized in 6 mL of 1 mM PEG, 1 mM PMSF, 2 % PVPP (w/v), and 0.01 % Triton X-100 v/v. The mixture was centrifuged at 12,000 g for 30 min at 4℃. The supernatant (0.5 mL) was mixed in 0.5 mL of 0.05 M guaiacol and 1 mL of 2 % H2O2. The absorbance at 470 nm was measured. POD activity was expressed as △OD470/min/g FW. Each experiment included three samples, and each sample was measured three times.
2.4. O−2 production rate and H2O2 content assay 2.5.5. APX activity The samples were homogenized in 6 mL of 50 mM PBS. The homogenate was centrifuged at 4000 g for 10 min, and 0.1 ml of the
Inoculated potato slices were homogenized with a mortar and pestle in 3 mL of 100 mM phosphate buffer (pH 7.8) amended with 0.1 % 2
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
3. Results
supernatant was mixed with 3 ml of the reaction solution (50 mM PBS (pH 7.0), 0.1 mM EDTA-Na2, 0.3 mM AsA, 0.06 mM H2O2). The change in absorbance at 290 nm was determined rapidly, within 10−30 s. APX activity was expressed as △OD290/min/g FW.
3.1. Effects of two strains of Erwinia on cell membrane integrity and MDA content There was a negative correlation between the degree of cell membrane integrity and the trend of MDA content generally when cells were exposed to various stresses. The cell membrane integrity of the potato slices inoculated with the strongly pathogenic strain Ecc S decreased rapidly for 4 h after inoculation. The cell membrane integrity of the potato slices inoculated with the weak pathogenic strain Ecc L and the control group showed a similar downward trend during the 24-h inoculation period. The cell membrane integrity of slices at 48 h after inoculation with Ecc S and Ecc L was 67.3 % and 55.8 % lower than that of the control (Fig. 1A). The results of the assessment of MDA content showed a converse tendency to that of the assessment of cell membrane integrity. The MDA content tended to be the same during the initial period after inoculation. The MDA content of the Ecc S group was higher than that of the Ecc L group and the control group by 38.9 % and 63.9 %, respectively, 12 h after inoculation. The potato slices in the strongly pathogenic strain group showed a higher MDA content than that of the weak pathogenic strain group during the 48-h period after inoculation, and the control group showed the lowest value (Fig. 1B). These findings suggest that potato slices inoculated with Erwinia will induce cell damage and exacerbate membrane lipid peroxidation.
2.6. Extraction and separation of mitochondria Mitochondria were extracted according to a method previously described (Considine et al., 2003). Thirty grams of inoculated potato slices and abstract solution (400 mM mannitol, 1 mM EDTA, 0.1 g/L bovine serum albumin (BSA), 0.05 g/L cysteine) were mixed in a 1:2 ratio (w/v) and the adjusted pH to 7.2. The filtrate was collected by filtration through a 200 mesh sieve and centrifuged at 1000 g for 15 min. The pellet was discarded, and the supernatant was centrifuged at 10,000 g for 15 min. The pellet was centrifuged at 250 g for 10 min with washing solution (400 mM mannitol, 1 mM EDTA, 0.1 g/L BSA, pH 7.2) Supernatant was taken and centrifuged at 6000 g for 15 min. The supernatant was discarded, and the precipitate was added to the same amount of washing solution. The mitochondria suspension was used for determination of cyanide-resistant respiration rate.
2.7. Determination of cyanide-resistant respiration rate Oxygen isotope content was measured using the oxygen isotope fractionation method (OIF) according to previous descriptions (Robinson et al., 1995; Guy et al., 1989). Mitochondria were heated at 27℃ under constant temperature. The oxygen isotope content ([16O], [18O]) was measured using the mass spectrometer vacuum system in the MAT-253 gas isotope mass spectrometer. Cytochrome respiration was inhibited by 1 mM KCN, and the OIF value (Da) of the cyanideresistant respiration was measured. Anti-cyanide respiration was inhibited by 5 mM of salicylhydroxamic acid (SHAM), and the OIF value (Dc) of the cytochrome respiration was measured. The OIF value (Dt) of the total breadth of the slice was measured without any inhibitor. The OIF value of 200 μL gas was calculated. [O2] 0 represents the total oxygen content in the air, [O2] represents the total oxygen content in the gas sample taken from the reaction chamber, R0 and R represent the air and gas samples in the [18O] / [16O] values, respectively. In the function, set f = [O2] / [O2] 0, -lnf as abscissa. Set 1000 ln (R / R0) as ordinate. Through the origin of a linear regression, the slope of the resulting line was the OIF value. The total respiration rate is expressed as Vt. The cyanide-resistant respiration rate is expressed as Valt. The contribution of cyanide-resistant respiration to total respiration A, was calculated by Valt/ Vt. Valt/ Vt = 100 % - (Dt-Dc) / (Da-Dc).
3.2. Effect of two strains of Erwinia on O2− production and H2O2 content The increase in the degree of oxidation of potato slices is inevitably accompanied by the accumulation of reactive oxygen species and H2O2. The rates of O2− production of the potato slices inoculated with the strongly pathogenic strain Ecc S increased 2 h after inoculation. It was higher than that of the potato slices inoculated with the weak pathogenic strain Ecc L. After 48 h of inoculation, the rate of O2− production of the Ecc S group was 43.8 % higher than that of the Ecc L group, and 65.2 % higher than that of the aging tuber control group (Fig. 2A). The content of H2O2 in potato slices inoculated with Ecc S increased rapidly during the initial period after inoculation. The rate of increase was faster than those of the Ecc L group and the control group. The platform period was reached at 4 h inoculation. The content of H2O2 in the Ecc L group simultaneously reached a peak 48 h after inoculation. The content of H2O2 in potato slices in the control group rose slowly throughout the inoculation period (Fig. 2B). These results indicated the accumulation of ROS when potato slices were inoculated with Erwinia, and the strongly pathogenic strain were more likely to cause accumulation of cellular ROS than the weak pathogenic strain. 3.3. Effect of two strains of Erwinia on activity of NOX, SOD, CAT, POD, and APX
2.8. RNA extraction, cDNA synthesis, and quantitative RT-PCR (qRT-PCR) analysis
To reveal whether the oxidative aggravation in potato slices activated the operation of the antioxidant system, we determined changes in the activity of NADPH oxidase and antioxidant enzymes. The NOX activity of the potato slices inoculated with the strongly pathogenic strain Ecc S increased more rapidly than that of the potato slices inoculated with weak pathogenic strains Ecc L and the aging tuber control group. After 48 h of inoculation, NOX activity of the potato slices inoculated with Ecc S reached a peak and was 2.36 times higher than that of the Ecc L group (Fig. 3A). The SOD activity of the potato slices inoculated with Ecc S increased more rapidly than those of the potato slices inoculated with Ecc L and the control group. SOD activity rose rapidly during the initial phase after inoculation and peaked at 48 h. It was 1.84 times and 3.78 times higher than those of the Ecc L and control groups, respectively, 48 h after inoculation (Fig. 3B). There was no significant difference in CAT activity between the experimental group and the control group during the 12-h inoculation. After 12 h of
Total RNA was extracted using the RNA extract kit (Sangon Biotech Co., Shanghai). Reverse transcriptions were used from the M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech Co., Shanghai). To examine the expression of potato genes, real-time PCR analysis was performed.The Real-PCR Detection System 2 × SG Fast qPCR Master Mix (Sangon Biotech Co., Shanghai) was used and performed with an iCycler iQ Multicolor Real-PCR Detection System (Bio-Rad, Hercules, CA, U.S.A.). Each reaction (20-μl total volume) consisted of 10 μl of SYBR Green Supermix, 0.1 μM of diluted cDNA, and 0.1 μM each of forward and reverse primers. The elongation factor 1-alpha(EF1α) (LOC102577640) was used as an internal reference control gene. Relative gene expression was calculated as described for the 2−ΔΔCt method (Livak and Schmittgen, 2001), Table 1.
3
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Table 1 A list of primer sets for qRT-PCR analysis. Gene
Gene annotation
Forward primer (5′- 3′)
Reverse primer (5′- 3′)
StAOX StCDPK1 StCDPK4 StCDPK5 StEF1α
Alternative oxidase calcium-dependent protein kinase 1 calcium-dependent protein kinase 4 calcium-dependent protein kinase 5 Elongation factor 1-alpha
AGCAACAAGGATGACCCGAG TGGCTCAAGGTAGGTGGAGT AGTGGCGGTGAGTTGTTTGA ATGCCGTGGATCTTTCGGAG ATTGGAAACGGATATGCTCCA
CGATGGATTCGCCGGAAAAC ATCCAAGTCTGGCCAATCCG GAGAATGACACGCCTCCACA TTCATGGTGACGAGGGGTTG TCCTTACCTGAACGCCTGTCA
Fig. 1. Effect of two strains of Erwinia carotovora subsp. carotovora on cell membrane integrity, aging potato tuber as control(A). MDA content in inoculated slices of potato tuber(B).
3.4. Effect of two strains of Erwinia on contribution to cyanide-resistant respiration
inoculation, the CAT activity of the Ecc S group increased rapidly and peaked at 48 h. It was 32.6 % and 39.5 % higher than those of the Ecc L and control groups, respectively, 48 h after inoculation (Fig. 3C). There was no significant difference in POD activity between the experimental group and the control group during the period 8 h after inoculation, and 8 h after inoculation, the POD activity of both the Ecc S group and Ecc L group increased rapidly and peaked at 48 h after inoculation (Fig. 3D). The potato APX activity in the Ecc S group increased rapidly during the initial period of interaction, and the rate was higher than that in the Ecc L group. The APX activity of the aging control group increased slowly throughout the 48-h monitoring period (Fig. 3E). These results indicate that potato slices inoculated with two different pathogenic Erwinia caused an accumulation of H2O2 and increase in the activity of antioxidant enzymes. These results indicate that infection by Erwinia results in the efficient functioning of antioxidant systems and the continuous clearance of ROS by antioxidant enzymes.
In order to accurately determine the capacity of cyanide-resistant respiration after potato were inoculated with Erwinia, the oxygen isotope fractionation was used to measure accurate cyanide-resistant respiration values. The oxygen isotope fractionation values of potato slices inoculated with the strongly pathogenic strain Ecc S were 2.52 % for cyanide-resistant respiration, 1.77 % for cytochrome respiration, and 2.13 % for total respiration (Fig. 4A). The oxygen isotope fractionation values of potato slices inoculated with the weak pathogenic strain Ecc L were 2.36 % for cyanide-resistant respiration, 1.80 % for cytochrome respiration, and 2.02 % for total respiration (Fig. 4B). The oxygen isotope fractionation values of aging potato slices in the control group were 2.50 % for cyanide-resistant respiration, 1.74 % for cytochrome respiration, and 1.96 % for total respiration (Fig. 4C). In addition, the actual contribution values of cyanide-resistant respiration were calculated (Table 2). The contribution value of potato slices inoculated with Ecc S was 48.30 ± 1.41 %, for potato slices inoculated
Fig. 2. O2− production (A) and H2O2 content (B) in slices of potato tuber inoculated with two Erwinia carotovora subsp. strains carotovora. 4
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 3. Activity of NOX (A), SOD (B), CAT (C), POD (D), and APX (E)in slices of potato tuber inoculated with two Erwinia carotovora subsp. strains carotovora.
groups inoculated with Ecc S and Ecc L showed StAOX levels 7.8 times and 6.1 times higher than those in the control group 4 h after inoculation. The transcription level of StAOX was then rapidly downregulated. The degree of upregulation was not significant during the 4 h–24 h period after inoculation (Fig. 5). These results indicate that whether potato slices were infected with different pathogenicity of Erwinia or the aging process, StAOX up-regulation were triggered. The sharp up-regulation of transcriptional levels in a short period of time suggests that potatoes respond rapidly to cyanide respiration after infection with Erwinia.
with Ecc L the contribution value was 38.55 ± 1.18 %, and for aging potato slices in the control group it was 29.42 ± 1.09 %. All of these results were measured 4 h after inoculation. These results indicate that the infection of Erwinia accelerates the operation of cyanide-resistant respiration in potatoes and is more severe for strongly pathogenic bacteria. 3.5. Effect of two strains of Erwinia on relative transcript level of StAOX To investigate the operation of cyanide-resistant respiration after inoculation with two strains of Erwinia in potato slices, we first analyzed the mRNA transcript level of the functional protein StAOX of the potato cyanide-resistant respiration. The mRNA transcript level of potato slices inoculated with the strongly pathogenic strain Ecc S was rapidly upregulated at 4 h after inoculation, and the highest transcript level of StAOX was observed 4 h after inoculation. The experimental
3.6. Effect of cyanide-resistant respiration on the production of H2O2 In order to further verify the relationship between H2O2 and cyanide-resistant respiration during the interaction between potato and Erwinia, the potato slices were treated with 5 mM SHAM to inhibit 5
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 4. Oxygen isotope fractionation values (D) for respiration of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains. A: DSa: D values through cyanide-resistant respiration of potato tuber inoculated with Ecc S, DSc: D values through cytochrome respiration of potato tuber inoculated with Ecc S, Ds: D values through total of potato tuber inoculated with Ecc S. B: DLa: D values through cyanide-resistant respiration of potato tuber inoculated with Ecc L, DLc: D values through cytochrome respiration of potato tuber inoculated with Ecc L, DL: D values through total of potato tuber inoculated with Ecc L. C: Dca: D values through cyanide-resistant respiration with aging potato tuber, Dcc: D values through cytochrome respiration with aging potato tuber, Dc: D values through total of aging potato tuber. Table 2 Oxygen isotope fractionation D (%) and the actual contribution of cyanide-resistant respiration A (%).
+KCN +SHAM No inhibitor A(%)
Ecc S
Ecc L
Aging
2.521 ± 0.026 1.767 ± 0.032 2.131 ± 0.015 48.30 ± 1.41
2.364 ± 0.017 1.801 ± 0.024 2.018 ± 0.019 38.55 ± 1.18
2.504 ± 0.011 1.735 ± 0.014 1.960 ± 0.018 29.42 ± 1.09
Fig. 6. H2O2 content in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of added SHAM(gray bar) and treated with nothing (white bar) at 4-h postinoculated time.
3.7. Effects of ROS scavenger and ROS on the relative transcript level of StAOX Fig. 5. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains at different times. Black bar graph represents potato inoculated with Ecc S; gray bar graph represents potato inoculated with Ecc L; white bar graph represents aging potato tuber.
In order to further explore the effect of the ROS level on cyanideresistant respiration in potato, we treated H2O2 and ROS scavenger NAC in the experimental group to analyze changes in transcriptional level of StAOX 4 h after inoculation. The selection of 4 h was based on StAOX being most upregulated 4 h after inoculation (Fig. 6). The relative transcript level of StAOX on the NAC treatment group was downregulated compared with the non-treatment group both in the Ecc S and Ecc L group 4 h after inoculation. The relative transcript level of StAOX on the H2O2 treatment group was upregulated compared with the nontreatment group. However, the downregulation and upregulation were not obvious. The level of StAOX transcription in each treatment in the experimental group was higher than that in the corresponding control group (Fig. 7). These results showed that treatment of exogenous ROS triggered the upregulation of StAOX transcription levels, further leading to the operation of cyanide-resistant respiration. In addition to the treatment of ROS scavengers, NAC’s downregulation of the transcription level of StAOX was limited. These results indicate that the presence of ROS was a factor affecting the operation of potato cyanide-resistant respiration at the transcriptional level.
cyanide-resistant respiration for 4 h. The results showed that in both the potato inoculated with Erwinia and the aging control group, the treatment of 5 mM SHAM caused more accumulation of H2O2 than that in the untreated group. In the Ecc L inoculated group, the H2O2 content under the SHAM treatment was 47.7 % higher than that in the untreated group. In the Ecc S inoculated group, the H2O2 content under the SHAM treatment was 29.3 % higher than that of the untreated group. Both were higher than the 22.7 % of the control group (Fig. 6). These results indicate the operation of cyanide-resistant respiration was negatively correlated with the accumulation of H2O2 during the interaction between potato and Erwinia. The operation of cyanide-resistant respiration inhibited the peroxidation of the potato tubers.
6
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
Fig. 7. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of treated NAC (white bar), under the condition of treated H2O2 (black bar) and treated with nothing (gray bar) at 4-h postinoculated time.
Fig. 9. Relative expression of StAOX gene in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains under the condition of treated EGTA (gray bar) and treated with nothing (black bar) at 4-h postinoculated time. Aging tuber as control.
3.8. Relative transcript level of StCDPKs and effect of Ca2+ on relative transcript level of StAOX
EGTA, and then detected changes in the transcription level of the StAOX gene 4 h after inoculation. The results showed that the relative expression levels of the StAOX gene were upregulated. After treatment with Ca2+ chelating agent EGTA, the relative expression of the StAOX gene was 81.5 %, 68.2 %, and 50.3 % higher in tubers with Ecc S inoculation, Ecc L inoculation and the aging tuber than that without EGTA treatment (Fig. 9). These results suggest that the concentration of Ca2+ and the regulation of calmodulin play a regulatory role in the operation of cyanide-resistant respiration.
Ca2+ metabolism regulates the occurrence of many physiological processes in plant cells. In order to explore the effect of the Ca2+ regulatory pathway on the cyanide-resistant respiration of potato, we designed primers to detect changes in the transcriptional level of the potato CDPK gene family after the inoculation of Erwinia. The relative transcription level of StCDPK1 was continuously downregulated from the initial inoculation period to 24 h after inoculation (Fig. 8A). We hypothesized that StCDPK1 played a negative regulatory role in the regulation of ROS-induced cyanide-resistant respiration. This result was opposite to StCDPK4 and StCDPK5. The relative transcription level of StCDPK4 and StCDPK5 showed similar upregulation 4 h after inoculation (Fig. 8B and C). The results were similar to the trend seen in the transcriptional level change of the StAOX gene. This suggests that Ca2+ may regulate the action of cyanide-resistant respiration. In order to verify the regulation of Ca2+ concentration on the cyanide-resistant respiration of potato, we set up treatment with 10 mM
4. Discussion Potatoes can be wounded by insect bites, strong wind erosion, and hail damage during the growth process. Moreover, harvesting and transportation also cause mechanical damage. Potatoes are susceptible to pathogenic microorganisms that enter the body through wounds and stomata. This research was based on the interaction between potato and
Fig. 8. Relative expression of StCDPK1, StCDPK4, and StCDPK5 genes in slices of potato tuber inoculated with two Erwinia carotovora subsp. carotovora strains at 4=h postinoculated time. Black ba represents potato inoculated with Ecc S; gray bar represents potato inoculated with Ecc L; white bar represents aging potato tuber. 7
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
resistant respiration. This research explored the regulation process of ROS-induced cyanide-resistant respiratory operation. Existing studies have shown that Ca2+ plays an important regulatory role in the plant defense response and autophagy. ROS as an important signal substance, plays a role in regulating the intracellular Ca2+ concentration (Honda et al., 2007). We designed experiments to detect the transcription levels of Ca2+related proteins StCDPK1, StCDPK4, and StCDPK5 during the interaction between potato and Erwinia within 24 h after inoculation. The relative transcription level of StCDPK1 was continuously downregulated from the initial inoculation period to 24 h (Fig. 8A). We hypothesized that StCDPK1 plays a negative regulatory role in the regulation of ROSinduced cyanide-resistant respiration. This result was opposite to StCDPK4 and StCDPK5. Relative transcription levels of StCDPK4 and StCDPK5 showed upregulation 4 h after inoculation (Fig. 8B and C), and this result was similar to the upregulation trend in the transcriptional level of the StAOX gene. We have reason to assume that the Ca2+ signaling pathway indirectly regulated the operation of potato mitochondrial cyanide-resistant respiration by regulating ROS production. Relevant experiments have verified the above hypothesis. The intracellular Ca2+ concentration cannot be changed easily. However, we changed the extracellular Ca2+ concentration and treated the Ca2+ chelator EGTA during the interaction between potato and Erwinia. Changes in the transcription level of StAOX were observed (Fig. 9). Treatment with EGTA resulted in a decrease in extracellular Ca2+ concentration, and the transcription level of StAOX was also reduced to correspond with that of the non-treated group. This change was not obvious compared with the results presented in Fig. 5. Therefore, we suspected that there are other ways to participate in the regulation of cyanide-resistant respiration. A regulatory pathway for the anti-cyanide respiration of plants caused by bacterial infection can be attempted to be established. Potatoes are highly susceptible to soft rot bacteria during the growth stage and storage. The threonine-protein kinase FLS2 on the cell wall first responds to the flagellin of the pathogen (Gómez-Gómez et al., 2001). Signals are transmitted through ion channels to cyclic nucleotide gated channels (CNGC), whose conformational changes mediate the transfer of calcium ions inside and outside the cell wall (Raíces et al., 2003; Gromadka et al., 2017). Increased intracellular calcium ion concentration activates phosphorylation of CDPKs. It was well known that phosphorylation of CDPKs in plant cells activates reactive burst oxidase (RBOH) and accelerate the oxidation of NAD(P)H to NAD(P)+, as well as the accumulation of ROS (Takahashi et al., 2012; Kobayashi et al., 2007). The accumulation of reactive oxygen species (ros) and electrons in the mitochondrial respiratory electron transport chain (mETC) promotes the conformational change and active activation of the alternant oxidase, which relieves the metabolic pressure of ATP on the mETC. However, the high adaptability formed in the process of plant evolution means that there are many metabolic regulatory pathways in plant cells. Thereby it is reasonable to speculate that mitochondrial anti-cyanide respiration is regulated by other signaling molecules and metabolic regulatory pathways, which need further study.
the soft rot pathogen Erwinia. This study found an increase in the production of ROS, loss of cell membrane integrity, change of MDA content, and rise in antioxidative enzyme activity in Erwinia inoculated slices. ROS was found to be a factor causing lipid peroxidation and cell membrane integrity when comparing the outcome of inoculation with the weakly pathogenic Ecc L and strongly pathogenic Ecc S. This study proved that the strongly pathogenic Ecc S inoculation caused an earlier and higher level of ROS production, loss of cell membrane integrity, and a rise in NADH oxidase activity and antioxidative enzyme activity (Fig. 1, 2 and 3). These findings are similar to those in a previous tomato study (Dey et al., 2009). Existing studies have shown that the above physiological phenomena take place when plants are harmed, leading to a general acceleration of anti-cyanide respiration (Rychter and Mikulska, 2010; Borovik and Grabelnych, 2018). Because the activity of anti-cyanide respiration is closely related to the internal and external conditions of the tissue, the activity of anti-cyanide respiration depends on the need of the plant tissue to perform specific physiological functions. Therefore, to accurately determine the activity of the pathway under different physiological and environmental conditions, it is necessary to understand its regulatory mechanism and physiological significance. The determination of cyanide-resistant respiration activity using the oxygen isotope fractionation method (OIF) is more accurate and effective than the hydroxamate inhibition method. Compared with previous studies (Day et al., 1996), a disadvantage of the hydroxamate inhibition method was that the inhibition of the cyanide respiratory pathway would lead to a partial flow of respiratory electrons from this pathway to the cytochrome pathway. In addition, the oxonic acid inhibitor in the inhibition method has a certain promoting effect on total mitochondrial respiration. The above reasons lead to a lower value of cyanide-resistant respiratory activity than actual activity. The OIF method used the oxygen isotope fractionation effect in the respiratory process to obtain the operation of the cyanide-resistant respiratory pathway. The OIF value of each respiratory pathway was not affected by the rate of respiration. The results we measured using this method were higher than those determined by the inhibitor method. However, the proportion of contribution values for each respiratory pathway was approximately constant. Therefore, the OIF method could avoid the errors that may occur in the inhibitor method (Fig. 4). The above conclusions demonstrate that the operation of cyanide-resistant respiration during the interaction between potato and Erwinia was accompanied by changes in physiological levels. We have observed the operation of the antioxidant system, the activation of cyanide-resistant respiration, and the increase in cell damage when the potato was infected with Erwinia. Subsequent inhibition of cyanide-resistant respiration with the inhibitor SHAM reversed the relationship between ROS and cyanide-resistant respiration. After the cyanide-resistant respiration was inhibited, the accumulation of H2O2 was further aggravated (Fig. 6). This study have shown that in addition to the antioxidant system, anti-cyanide respiration has positive effects on plant antioxidants. The cyanide-resistant respiration level of potato mitochondria changes with the infection of Erwinia, so it is assumed that the transcription level of the alternate oxidase is also regulated. This study also analyzed the changes in the potato mitochondrial cyanide-resistant respiratory function protein StAOX from a transcriptional level. The molecular evidence confirmed the above conclusion. The transcriptional level of StAOX was rapidly upregulated at the initial stage of interaction, especially 4 h after inoculation (Fig. 5). This is consistent with changes in the rate of production of ROS and the activity of antioxidant enzymes. Most importantly, subsequent low levels of transcriptional reversion indicated that the alternating oxidase has reached a relatively saturated workload, and StAOX was no longer involved in large amounts of transcription and translation. Further, we found that during the addition of exogenous ROS scavenger NAC, the downregulation of StAOX was not obvious (Fig. 7), indicating that endogenous ROS also played an important role in inducing cyanide-
Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This work was funded by National Natural Science Foundation of China (Grant No.31571989, Grant No. 31772147) and The Fundamental Research Funds for the Central Universities of China (lzujbky-2018-40, lzujbky-2017-206). 8
Journal of Plant Physiology 246–247 (2020) 153132
D. Hua, et al.
References
erwinia carotovora, var. Carotovora. Am. Potato J. 58 (11), 585–592. Kobayashi, M., Ohura, I., Kawakita, K., Yokota, N., Fujiwara, M., Shimamoto, K., et al., 2007. Calcium-dependent protein kinases regulate the production of reactive oxygen species by potato nadph oxidase. Plant Cell 19 (3), 1065–1080. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative pcr and the 2(-delta delta c(t)) method. Methods 25 (4), 402–408. Lund, B.M., Wyatt, G.M., 1972. The effect of oxygen and carbon dioxide concentrations on bacterial soft rot of potatoes. I. King edward potatoes inoculated with erwinia carotovora, var. Atroseptica. Potato Res. 15 (2), 174–179. Maher, E.A., Boer, S.H.D., Kelman, A., 1986. Serogroups of erwinia carotovora, involved in systemic infection of potato plants and infestation of progeny tuber. Am. Potato J. 63 (1), 1–11. Mingala, C., 2015. Evaluation of treatment alternatives against respiratory bacterial pathogens of small and large ruminants. Adv. Environ. Biol. 9 (8), 149–155. Ordentlich, A., Linzer, R.A., Raskin, I., 1991. Alternative respiration and heat evolution in plants. Plant Physiol. 97 (4), 1545–1550. Pandey, M., Zeng, Y.R.N., Srivastava, G.C., Zeng, Y.R., 1995. Alternate respiration during ripening of tomato fruits. Indian J. Plant Physiol. 38 (2), 182–183. Raíces, M., Gargantini, P.R., Chinchilla, D., Crespi, M., Télleziñón, M.T., Ulloa, R.M., 2003. Regulation of cdpk isoforms during tuber development. Plant Mol. Biol. 52 (5), 1011–1024. Ribascarbo, M., Aroca, R., Gonzálezmeler, M.A., 2000. The electron partitioning between the cytochrome and alternative respiratory pathways during chilling recovery in two cultivars of maize differing in chilling sensitivity. Plant Physiol. 122 (1), 199–204. Robinson, S.A., Ribascarbo, M., Yakir, D., Giles, L., Reuveni, Y., Berry, J.A., et al., 1995. Beyond sham and cyanide: opportunities for studying the alternative oxidase in plant respiration using oxygen isotope discrimination. Funct. Plant Biol. 22 (3), 487–496. Ross, H., Hunnius, W., 1986. Potato Breeding - Problems and Perspectives. Fortschritte Der Pflanzenzuechtung. Rychter, A.M., Mikulska, M., 2010. The relationship between phosphate status and cyanide-resistant respiration in bean roots. Physiol. Plant. 79 (4), 663–667. Sato, Y., Masuta, Y., Saito, K., Murayama, S., Ozawa, K., 2011. Enhanced chilling tolerance at the booting stage in rice by transgenic overexpression of the ascorbate peroxidase gene, osapxa. Plant Cell Rep. 30 (3), 399–406. Takahashi, S., Kimura, S., Kaya, H., Iizuka, A., Wong, H.L., Shimamoto, K., et al., 2012. Reactive oxygen species production and activation mechanism of the rice nadph oxidase osrbohb. J. Biochem. 152 (1), 37–43. Vanlerberghe, G.C., 2002. Induction of mitochondrial alternative oxidase in response to a cell signal pathway down-regulating the cytochrome pathway prevents programmed cell death. Plant Physiol. 129 (4), 1829–1842. Wang, Y., Tian, H., 2007. The study progress of alterative oxidase in higher plant. Acta Bot. Yunnanica 29 (4), 447–456.
Aranha, M.M., Matos, A.R., Teresa, M.A., Vaz, P.V., Rodrigues, C.M., Arrabaça, J.D., 2007. Dinitro-o-cresol induces apoptosis-like cell death but not alternative oxidase expression in soybean cells. J. Plant Physiol. 164 (6), 675–684. Baker, C.J., Orlandi, E.W., Deahl, K.L., 2001. Oxidative metabolism in plant/bacteria interactions: characterization of a unique oxygen uptake response of potato suspension cells. Physiol. Mol. Plant Pathol. 59 (1), 17–23. Borovik, O.A., Grabelnych, O.I., 2018. Mitochondrial alternative cyanide-resistant oxidase is involved in an increase of heat stress tolerance in spring wheat. J. Plant Physiol. 231, 310. Considine, M.J., Goodman, M., Echtay, K.S., Laloi, M., Whelan, J., Brand, M.D., et al., 2003. Superoxide stimulates a proton leak in potato mitochondria that is related to the activity of uncoupling protein. J. Biol. Chem. 278 (25), 22298–22302. Czajkowski, R., Pérombelon, M.C.M., Veen, J.A.V., Wolf, J.M.V.D., 2011. Control of blackleg and tuber soft rot of potato caused by pectobacterium, and dickeya, species: a review. Plant Pathol. 60 (6), 999–1013. Dahal, K., Vanlerberghe, G.C., 2016. Alternative oxidase respiration maintains both mitochondrial and chloroplast function during drought. New Phytol. 213 (2). Day, D.A., Krab, K., Lambers, H., Moore, A.L., Siedow, J.N., Wagner, A.M., et al., 1996. The cyanide-resistant oxidase: to inhibit or not to inhibit, that is the question. Plant Physiol. 110 (1), 1. Dey, S., Ghose, K., Basu, D., 2009. Fusarium elicitor-dependent calcium influx and associated ros generation in tomato is independent of cell death. Eur. J. Plant Pathol. 126 (2), 217–228. Gómez-Gómez, L., Bauer, Z., Boller, T., 2001. Both the extracellular leucine-rich repeat domain and the kinase activity of fsl2 are required for flagellin binding and signaling in arabidopsis. Plant Cell 13 (5), 1155–1163. Gromadka, R., Cieśla, J., Olszak, K., Szczegielniak, J., Muszyńska, G., PolkowskaKowalczyk, L., 2017. Genome-wide analysis and expression profiling of calcium-dependent protein kinases in potato (solanum tuberosum). Plant Growth Regul. 2, 1–13. Guy, R.D., Berry, J.A., Fogel, M.L., Hoering, T.C., 1989. Differential fractionation of oxygen isotopes by cyanide-sensitive respiration in plants. Planta 177 (4), 483–491. Honda, K., Koguchi, M., Koga, K., Nakajima, K., Kobayashi, F., Migita, K., et al., 2007. Contribution of ca(2+) -dependent protein kinase c in the spinal cord to the development of mechanical allodynia in diabetic mice. Biol. Pharm. Bull. 30 (5), 990–993. Keunen, E., Remans, T., Opdenakker, K., Jozefczak, M., Gielen, H., Guisez, Y., et al., 2013. A mutant of the arabidopsis thaliana lipoxygenase1 gene shows altered signalling and oxidative stress related responses after cadmium exposure. Plant Physiol. Biochem. 63 (4), 272–280. Kloepper, J.W., Harrison, M.D., Brewer, J.W., 1981. Effect of temperature on differential persistence and insect transmission of erwinia carotovora, var. atroseptica, and
9