Reactive oxygen species mediates homocysteine-induced mitochondrial biogenesis in human endothelial cells: Modulation by antioxidants

BBRC Biochemical and Biophysical Research Communications 338 (2005) 1103–1109 www.elsevier.com/locate/ybbrc

Reactive oxygen species mediates homocysteine-induced mitochondrial biogenesis in human endothelial cells: Modulation by antioxidants q Karen Perez-de-Arce a,b, Rocio Foncea a,*, Federico Leighton b b

a Departamento de Nutricio´n, Diabetes y Metabolismo, Facultad de Medicina, Pontificia Universidad Cato´lica de Chile, Santiago, Chile Departamento de Biologı´a Celular y Molecular, Facultad de Ciencias Biolo´gicas, Pontificia Universidad Cato´lica de Chile, Santiago, Chile

Received 6 October 2005 Available online 21 October 2005

Abstract It has been proposed that homocysteine (Hcy)-induces endothelial dysfunction and atherosclerosis by generation of reactive oxygen species (ROS). A previous report has shown that Hcy promotes mitochondrial damage. Considering that oxidative stress can affect mitochondrial biogenesis, we hypothesized that Hcy-induced ROS in endothelial cells may lead to increased mitochondrial biogenesis. We found that Hcy-induced ROS (1.85-fold), leading to a NF-jB activation and increase the formation of 3-nitrotyrosine. Furthermore, expression of the mitochondrial biogenesis factors, nuclear respiratory factor-1 and mitochondrial transcription factor A, was significantly elevated in Hcy-treated cells. These changes were accompanied by increase in mitochondrial mass and higher mRNA and protein expression of the subunit III of cytochrome c oxidase. These effects were significantly prevented by pretreatment with the antioxidants, catechin and trolox. Taken together, our results suggest that ROS is an important mediator of mitochondrial biogenesis induced by Hcy, and that modulation of oxidative stress by antioxidants may protect against the adverse vascular effects of Hcy.
2005 Elsevier Inc. All rights reserved. Keywords: Homocysteine; Reactive oxygen species; Antioxidants; Mitochondrial biogenesis; Nuclear respiratory factor-1; Mitochondrial transcription factor A; Gene expression

Elevated plasma homocysteine (Hcy) is an independent risk factor for cardiovascular diseases [1,2]. Experimental evidence indicates that Hcy-induced endothelial dysfunction and atherosclerosis may be mediated by increased generation of reactive oxygen species (ROS) [3] and reduced nitric oxide (NO) availability [4]. Oxidative stress and ROS production have been implicated in the pathophysiology of a variety of chronic diseases and aging [5,6]. Mitochondria are biologically important

q

Abbreviations: HUVECs, human umbilical vein endothelial cells; Hcy, homocysteine; DCF, 2 0 ,7 0 -dichlorofluorescein; mtDNA, mitochondrial DNA; NRF-1, nuclear respiratory factor-1; Tfam, mitochondrial transcription factor A; ROS, reactive oxygen species; COX III, subunit III of human cytochrome c oxidase; NF-jB, nuclear factor-jB. * Corresponding author. Fax: +562 6338298. E-mail address: [email protected] (R. Foncea). 0006-291X/$ - see front matter
2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.10.053

source and target for ROS. Furthermore, increased ROS can mediate mitochondrial DNA (mtDNA) damage, alteration of mitochondrial gene expression, and mitochondrial dysfunction [7–9]. Thereby mtDNA damage contributes to the increase in oxidative stress that may result in impaired cellular functions [10,11]. Moreover, it has been demonstrated that mitochondrial function decline during aging process, was caused, at least in part, by oxidative damage and mutations of mtDNA [12]. Mitochondria contain closed circular, double-stranded DNA. The mitochondrial genome encodes only 13 of more than hundreds of mitochondrial proteins, the rest are encoded by the nucleus [13]. The mitochondrial mass and mtDNA copy number are regulated by biogenesis, a response that depends on physiological and pathogenic factors [10,13–15]. The coordination between the nuclear and mitochondrial genomes is achieved by two transcription

1104

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109

factors: nuclear respiratory factor-1 (NRF-1) and mitochondrial transcription factor A (Tfam). NRF-1 regulates the transcription of nuclear-encoded mitochondrial genes and the expression of Tfam, while Tfam regulates mitochondrial transcription [16–18]. We have previously shown that endogenous mitochondrial ROS generation enhances the expression of nuclear mitochondrial biogenesis genes NRF-1 and Tfam [19]. Previous results have shown that Hcy promotes mitochondrial damage and alters mitochondrial gene expression and function, suggesting the participation of oxidative stress [20]. However, it remains unclear if Hcy-induced ROS regulates the mitochondrial biogenesis in vascular endothelial cells. The aim of the present study was to determine whether ROS induced by Hcy could directly increase mitochondrial biogenesis in endothelial cells. For this purpose, we determined, using human endothelial cells in culture, whether (1) Hcy exposure causes the formation of ROS and increases oxidative stress, (2) ROS can directly cause mitochondrial biogenesis, and (3) if antioxidants can modulate this effect. Our results suggest that ROS is a key mediator of mitochondrial biogenesis induced by Hcy, and that modulation of oxidative stress with antioxidants can protect against the adverse vascular effects of Hcy. Materials and methods Cell culture. Human umbilical vein cells (HUVECs) were isolated by collagenase digestion and were cultured (37 C, 5% CO2) in low glucose– DMEM containing 10% fetal bovine serum (Invitrogen), 50 lg/mL heparin, 100 U/mL penicillin–streptomycin, and 10 ng/mL basic fibroblast growth factor (bFGF) [21]. Twelve hours before an experiment, the incubation medium was changed to serum-free medium. Experiments were performed before confluence between passages 2 and 4. ROS measurements by DCF assay. In order to measure the ROS production, we used the probe 2 0 -7 0 -dichlorodihydrofluorescein diacetate (H2DCF-DA; Molecular Probes) as previously described [22]. This probe is accumulated by cells and hydrolyzed by cytoplasmic esterases to become 2 0 -7 0 -dichlorodihydrofluorescein, which then reacts with ROS to generate fluorescent product 2 0 -7 0 -dichlorofluorescein (DCF). HUVECs were grown to confluence in 96-well plates and loaded with 10 lM H2DCF-DA for 30 min at 37 C, washed and incubated with homocysteine (Hcy) (100 lM) for 30 min or pretreated with antioxidants (catechin, 10 lM or trolox, 10 lM) (Sigma) for 30 min before exposure to Hcy (100 lM). Fluorescence was monitored in a spectrofluorimeter plate reader (LS 50B, Perkin Elmer) at excitation and emission wavelengths of 485 and 530 nm, respectively. The measured fluorescence values were expressed as a relative fold increase of the fluorescence in control cells.

Electrophoretic mobility shift assay. NF-jB binding activity was assessed in nuclear extracts [23] by electrophoretic mobility shift assay (EMSA) using the Gel Shift Assay System (Promega) according to the manufacturerÕs instructions. A double-stranded oligonucleotide for NFjB (5 0 -AGTTGAGGGGACTTTCCCAGGC-3 0 ) (Promega) was end-labeled with [c-32P]ATP and used as a probe. The binding reaction containing 10 lg of nuclear proteins and 32P-labeled probe was performed in incubation buffer for 20 min at room temperature. Specific binding was confirmed by using a 100-fold excess of unlabeled probe as specific competitor. Protein–DNA complexes were separated in a nondenaturing 6% polyacrylamide gel and visualized by autoradiography. Total RNA isolation and reverse transcription polymerase chain reaction (RT-PCR). Total RNA was isolated using a Qiagen RNeasy kit. Quantification and purity of the RNA was assessed by A260/A280 absorption. Aliquots (3 lg) of total RNA were reverse-transcribed into cDNA using dNTPs plus random hexamer primers and SuperScript II reverse transcriptase (Invitrogen). PCR amplification was performed as described [19]. Briefly, the reaction was carried out in a total volume of 25 ll containing 0.6 U/ll Taq DNA polymerase (Invitrogen) and sequence-specific oligonucleotide primers for human NRF-1, Tfam, and COXIII (50 pmol) (Table 1). Amplification of human GAPDH gene was used as a reference value. To avoid unspecific annealing between different probes and to minimize the background, amplification was performed separately for each gene. PCR products were separated on a 1.2% agarose gel and were detected under UV transillumination after ethidium bromide staining. The band intensity of the PCR products was analyzed with scanning densitometer software and normalized with GAPDH band intensity. Determination of mitochondrial mass. The fluorescent probe MitoTracker Green FM (Molecular Probes), which is preferentially accumulated in mitochondria regardless of mitochondrial membrane potential status, was used to determine the mitochondrial mass of HUVEC. Cells seeded and grown on coverslips were treated with Hcy (100 lM) or pretreated with antioxidants (catechin, 10 lM, or trolox, 10 lM) for 30 min before exposure to Hcy for 24 h. The cells were then incubated with MitoTracker Green FM (50 nM) for 30 min at 37 C in 5% CO2. At the end of incubation the cells were washed three times in PBS and examined by Zeiss confocal microscopy. Digital images were recorded and the quantification of fluorescence intensity was performed using Image-Pro Plus software. The fluorescence intensity was calculated by dividing the total integrated optical density by the total number of cells in each field and expressed as relative fluorescence intensity. Immunocytochemistry. HUVECs were seeded and cultured onto coverslips in 24-well plates. After 24 h of stimulation with the indicating conditions, the cells were fixed with 4% formaldehyde and permeabilized with phosphate-buffered saline (PBS) containing 0.3% Triton X-100. Nonspecific binding was blocked with 3% bovine serum albumin (BSA) in PBS containing 0.05% Tween 20 for 30 min at room temperature. Cells were incubated with monoclonal anti-cytochrome c oxidase subunit III (COX III, Molecular Probes) or polyclonal anti-3-nitrotyrosine (Upstate Biotechnology) antibodies at 4 C overnight (antibodies were diluted 1/50 in 1% BSA in PBS containing 0.05% Tween 20). They were then washed three times in PBS and were incubated with fluorescein (FITC)-conjugated secondary antibody (Bio-Rad) (1/250 in 1% BSA in PBS) for 1 h at room temperature. After washing three times with PBS containing 0.05% Tween 20 the coverslips were mounted in fluorescent mounting medium (Vecta-

Table 1 Primer sequences and annealing temperatures for RT-PCR amplifications Gene

Sequence 5 0 –3 0

Product Size (bp)

Annealing temperature (C)

NRF-1

Sense GGAGTGATGTCCGCACAGAA Antisense CGCTGTTAAGCGCCATAGTG Sense TATCAAGATGCTTATAGGGC Antisense ACTCCTCAGCACCATATTTT Sense CAAAAAAGGCCTTCGATACG Antisense CAAAATGCCAGTATCAGGCG Sense CACCACCATGGAGAAGGCTGG Antisense GGCAGTGATGGCATGGACTGTG

495

60

440

55

509

57

244

57

Tfam COX III GAPDH

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109 Mount Permanent Mounting Medium, Vector Laboratories). Images were acquired by Zeiss confocal microscopy and the intensity of immunoreactivity was quantified using Image-Pro Plus software. Statistical analysis. Results are expressed as means ± SD for the number of independent experiments indicated (n) or as representative experiments performed at least three separate times. Statistical analysis was performed using two-tailed unpaired StudentÕs t test. Differences were considered significant at p < 0.05.

Results Participation of ROS in Hcy-induced NF-jB activation To determine whether Hcy treatment resulted in an increase in oxidative stress in endothelial cells leading to NF-jB activation, the level of intracellular ROS was measured. There was a significant elevation of ROS levels in Hcy-treated cells (Fig. 1A). After incubation with 100 lM Hcy for 30 min, the relative DCF intensity increased 1.85 ± 0.25-fold over control cells (p < 0.01). This increase of ROS levels was significantly reversed by preincubation with the antioxidants catechin (flavonoid antioxidant) and trolox (synthetic cell-permeable analogue of a-tocopherol) for 30 min, reached basal values (1.1 ± 0.1 and

1105

1.2 ± 0.16-fold over control, respectively) (p < 0.05 vs Hcy alone) (Fig. 1A). Hcy also induced NF-jB binding to DNA, which was detected after 45 min of exposure to Hcy, with about a 2-fold increase compared to control cells (Fig. 1B). In order to determine whether Hcy-induced NFjB activation is mediated by ROS production, the cells were preincubated with catechin (10 lM) or trolox (10 lM) for 30 min. Preincubation with the antioxidants abolished Hcy-induced NF-jB activation and reaching similar levels with respect to untreated control cells (Fig. 1B). These results show that Hcy-induced elevation of ROS level in endothelial cells contributed to NF-jB activation. Nitrotyrosine formation induced by Hcy is inhibited by catechin Peroxynitrite can nitrate protein tyrosine residues to form 3-nitrotyrosine [24]. To determine the effect of Hcy on the intracellular formation of nitrotyrosine, HUVECs were exposed to 100 lM Hcy for 24 h and nitrotyrosine was detected using a polyclonal antibody that specifically recognized protein-bound 3-nitrotyrosine. Fig. 2 shows a marked increase in fluorescence intensity in cells incubated with Hcy, reflecting an increase in the intracellular content of nitrotyrosine. Such increase returned to the basal levels when the cells were pretreated with catechin, a flavonoid antioxidant, suggesting that ROS are involved in Hcy-induced nitrotyrosine formation in endothelial cells. Hcy increases mitochondrial mass in endothelial cells In order to determine whether Hcy leads to a modification in mitochondrial mass, we used a mitochondrial fluorescent specific dye, MitoTracker Green FM, to label and quantify the mitochondria in HUVEC [14]. Both the intensity and the perinuclear distribution pattern of the fluorescence staining were indistinguishable in these cells (Fig. 3, top). After treatment with Hcy (100 lM) for 24 h, the relative fluorescence intensity was significantly higher (1.5 ± 0.14-fold) than that of the control cells (p < 0.05)

Fig. 1. Effects of antioxidants on Hcy-induced ROS production and NFjB activation in endothelial cells. (A) Intracellular ROS production was determined by DCF fluorescence. HUVECs were loaded with DCF (10 lM) for 30 min and preincubated for 30 min with antioxidants catechin (10 lM) or trolox (10 lM) followed by the stimulation with Hcy (100 lM) for 30 min and analyzed on a fluorescent plate reader as described in Materials and methods. Results are expressed as fold increase of the fluorescence intensity over untreated control cells. Values are means ± SD of the results from four independent experiments performed in triplicate. *p < 0.01 vs control, **p < 0.05 vs Hcy alone. (B) HUVECs were incubated for 45 min with Hcy (100 lM) or preincubated with antioxidants catechin (10 lM) or trolox (10 lM) for 30 min and then with Hcy (100 lM) for 45 min. Nuclear proteins extracts were isolated, and EMSA was performed to determine NF-jB binding activity as indicated in Materials and methods. Gel is representative of at least three independent experiments.

Fig. 2. Hcy-induced nitrotyrosine formation is inhibited by catechin. HUVECs were incubated for 24 h in the absence (control) or presence of Hcy (100 lM). One set of cells were preincubated with catechin (10 lM) for 30 min followed by incubation with Hcy (100 lM) for 24 h. At the end of incubation immunofluorescence staining was performed to detect intracellular formation of nitrotyrosine with polyclonal anti-3-nitrotyrosine antibody. Immunoreactivity was visualized using a confocal microscopy at a magnification of 400·. Photomicrographs are representative of three separate experiments.

1106

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109

transcription factor A (Tfam) in endothelial cells was examined by RT-PCR. Expression of NRF-1 and Tfam was markedly higher at 3 h in Hcy-stimulated cells. A significant 2.4 ± 0.3- and 1.9 ± 0.2-fold increase was observed for NRF-1 and Tfam genes, respectively, when compared with control cells (p < 0.05) (Figs. 4A and B). However, preincubation with antioxidants prevented Hcy-induced NRF-1 and Tfam mRNA expression. We found that cate-

Fig. 3. Increase of mitochondrial mass in endothelial cells treated with Hcy: role of antioxidants. HUVECs were stimulated with Hcy (100 lM) or preincubated with antioxidants catechin (Cat, 10 lM) or trolox (10 lM) for 30 min and then with Hcy (100 lM). After 24 h, the mitochondrial mass was estimated by MitoTracker (50 nM) staining using confocal microscopy. (Top) Photomicrographs shown are representative of MitoTracker fluorescence intensity of control cells (A), Hcy-stimulated cells (B), Hcy-stimulated cells preincubated with catechin (C), and trolox (D) from three independent experiments (magnification 400·). (Bottom) Quantitative analysis of fluorescence intensity. Results are expressed graphically as fold increase of the fluorescence intensity over untreated control cells. The fluorescence intensity was calculated by dividing the total integrated optical density by the total number of cells in each field. Values are means ± SD from three independent experiments. *p < 0.05 vs Control, **p < 0.05 vs Hcy alone.

(Fig. 3, bottom). To evaluate if the Hcy-induced increase in mitochondrial mass was mediated by ROS, cells were preincubated with the antioxidants catechin or trolox for 30 min and stimulated with Hcy for 24 h. We observed that both antioxidants provoked a significant decrease in the relative fluorescence intensity, compared with the Hcytreated cells (0.98 ± 0.07 and 0.95 ± 0.06-fold, respectively. p < 0.01) (Fig. 3, bottom). These results indicate that the oxidative stress induced by Hcy can lead to an increase in mitochondrial mass in endothelial cell. Expression of mitochondrial biogenesis genes induced by Hcy is mediated by ROS In order to provide insight into the cellular mechanism by which mitochondrial mass is increased by Hcy, we examined the changes in the mRNA transcripts of the genes that are involved in mitochondrial biogenesis. The relative abundance of mRNA transcripts encoding for nuclear respiratory factor-1 (NRF-1) and mitochondrial

Fig. 4. Hcy increased expression of genes that regulate mitochondrial biogenesis is inhibited by antioxidants. HUVECs were preincubated for 30 min with or without antioxidants catechin (Cat, 10 lM) or trolox (10 lM) followed by the stimulation with Hcy (100 lM) for 3 h. Total RNA was isolated and mRNA levels of NRF-1 (A) and Tfam (B) were detected by RT-PCR, as described in Materials and methods. Amplification products of NRF-1, Tfam, and GAPDH were separated on a 1.2% agarose gels and visualized after ethidium bromide staining. Data shown are from a representative gel of three independent RT-PCR amplifications (Top). Densitometric quantification for each gene is shown as a relative fold change of NRF-1 and Tfam mRNA expression, compared to control cells. Results are represented graphically as the optical density ratio of each transcript to GAPDH mRNA, used as internal control of sample loading (Bottom). Values shown are means ± SD of the results from three independent experiments. *p < 0.05 vs control and **p < 0.01 vs Hcy alone.

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109

1107

chin and trolox significantly inhibited the relative mRNA expression of NRF-1 and Tfam compared to Hcy-treated cells reaching the mean value of 1.2-fold over control (p < 0.05), without significant differences with respect to control untreated cells. The above results demonstrate that Hcy-induced ROS are involved in the mRNA expression levels of the genes involved in mitochondrial biogenesis in endothelial cells. Effect of Hcy on COX III mRNA and protein levels in endothelial cells In order to investigate whether Hcy increases the expression of mitochondrial-encoded proteins, the relative mRNA expression and protein level of mitochondrial-encoded subunit III of cytochrome c oxidase (COX III) were analyzed by RT-PCR and immunocytochemistry, respectively. At 6 h after Hcy, significant increases were found in mRNA COX III expression (2.04 ± 0.2-fold) compared to control (p < 0.01) (Fig. 5A). In contrast, the expression of COX III decreased and reached the value of 0.97 ± 0.1fold and 0.99 ± 0.12-fold compared to control, when the cells were preincubated with catechin and trolox, respectively (p < 0.01) (Fig. 5A). We next analyzed COX III protein content after treatment for 24 h with 100 lM Hcy using anti-COX III antibody in HUVEC. The COX III immunoreactivity of Hcy-treated cells was higher than untreated control cells. Quantification of the fluorescence shows a statistically significant (p = 0.036) 1.32-fold increase of the COX III protein level with respect to control (Fig. 5B). Antioxidants, catechin or trolox, decreased Hcy-induced COX III protein content which reached basal levels (1.0 ± 0.07 and 1.06 ± 0.04-fold, respectively, p < 0.05) (Fig. 5B). Taking together, these results show that ROS contributed to a significant increase in mtDNA-encoded protein COX III in Hcy-treated endothelial cells. Discussion In this study, we demonstrate that Hcy increases mitochondrial biogenesis in human endothelial cells. It has been previously reported that Hcy promotes mitochondrial damage in vivo [1,25] and alters mitochondrial gene expression and function in vitro [20], suggesting that oxidative stress may participate in this damage. However, the molecular mechanisms have not been clearly elucidated. Our results showed that Hcy stimulates the expression of NRF-1 and Tfam, two factors involved in the regulation of mitochondrial biogenesis. The ability of Hcy to increase intracellular levels of ROS is essential for Hcy-induced mitochondrial biogenesis because the pretreatment with antioxidants abolishes this effect. Taken together, these results described for the first time that ROS is a key mediator in the increase of mitochondrial biogenesis induced by Hcy in endothelial cells.

Fig. 5. Effect of Hcy on COX III mRNA and protein levels in endothelial cells. (A) COX III mRNA expression was monitored by RT-PCR as described in Materials and methods. HUVECs were preincubated with antioxidants catechin (Cat, 10 lM) or trolox (10 lM) for 30 min and then exposed to Hcy (100 lM) for 6 h. Total RNA was isolated and COX III transcript levels were amplified by RT-PCR and visualized on a 1.2% agarose gel. Data shown are from a representative gel of three independent amplifications (Top). The band intensities were analyzed by scanning densitometry and COX III mRNA level was normalized to that of GAPDH mRNA amplified in the same sample. It is expressed graphically as relative fold increase of COX III mRNA in comparison with untreated cells (Bottom). Values are means ± SD of three independent experiments. *p < 0.05 vs Control, **p < 0.01 vs Hcy alone. (B) HUVECs were cultured on coverslips and preincubated for 30 min with or without antioxidants catechin (10 lM) or trolox (10 lM) before treatment with Hcy (100 lM) for 24 h. Intracellular levels of COX III protein were detected with monoclonal anti-COX III antibody, as described in Materials and methods. Quantitative analysis of COX III immunoreactivity was determined by measuring the optical density of the labeled cells and is graphically represented. Results are expressed as fold increase of fluorescence intensity in the Hcy-treated cells normalized to untreated control cells. Data are means ± SD of three independent experiments. *p < 0.05 vs Control, **p < 0.05 vs Hcy.

Oxidative stress has been proposed to be an important mechanism of Hcy-induced endothelial dysfunction and damage [3,26–28]. In our work, Hcy produced a significant increase in ROS as early as 30 min of exposure. To demonstrate the relative importance of Hcy-induced ROS in the oxidative stress cell response, we investigated the activation of NF-jB, a transcription factor that is activated by the intracellular generation of ROS [19] and has been detected in activated endothelial cells in human atherosclerotic

1108

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109

lesions [29]. Our results, together with those recently found by Au-Yeung et al. [27], demonstrate that Hcy induces activation of NF-jB in endothelial cells. However the pretreatment with the antioxidants, catechin (flavonoid antioxidant) and trolox (synthetic cell-permeable analogue of a-tocopherol), restores the basal levels found in untreated cells, confirming that ROS production was responsible of the Hcy-induced NF-jB activation. Furthermore, ROS and oxidative stress could be also detected by the formation of nitrotyrosine, an indicator of the NO and superoxide radical reaction, resulting in peroxynitrite formation, a strong oxidant. Tyrosine nitration may alter protein function, and therefore, induce cellular dysfunction [24]. Zhang et al. [4] indicate that the reduction in NO levels in endothelial cells treated with Hcy is through increased formation of peroxynitrite, detected by the formation of nitrotyrosine. Here, we also observed that Hcy increase the formation of nitrotyrosine-modified proteins in endothelial cells at 24 h. On the other hand, pretreatment with catechin, a flavonoid antioxidant which reduces ROS levels, decreased Hcy-dependent formation of nitrotyrosine. Mitochondria and mtDNA can be damaged by ROS. Peroxynitrite can directly damage the electron transport chain and thereby induce mitochondrial dysfunction [6,24]. This mitochondrial damage and dysfunction can play a role in the pathogenesis of atherosclerosis [6,9]. Mitochondria are semi-autonomous organelles containing a resident genome. However, the replication and transcription of the mtDNA depend entirely on the nuclear-encoded proteins, such as NRF-1 and Tfam [16]. Alterations in the expression of these factors have been shown to modulate mitochondrial biogenesis [16–19]. A large number of evidence links the production of ROS with mitochondrial biogenesis [10,11,15,30]. Our results showed that the increase of the intracellular ROS content, through treatment with Hcy, resulted in a significant increase in the mitochondrial mass of endothelial cells. The increase in ROS production plays a critical role, because the pretreatment with antioxidants inhibits the Hcy-induced increase of mitochondrial mass. These results are consistent with those of others which showed in cardiac myocytes [8], human fibroblasts [14], leukocytes [15], and in mice brains [30], that the increase of oxidative stress leads to an increase in mtDNA damage and mitochondrial biogenesis. Of particular relevance are reports which showed that ROS-induced mtDNA damage leads to further mitochondrial dysfunction and oxidative generation that contributes to cellular dysfunction and development of age-related chronic diseases [9,30]. Additionally, our findings in this study and those of another report [19] clearly indicate that oxidative stress leads to increased expression of specific nuclear-encoded transcription factors deeply involved in the regulation of mitochondrial biogenesis. This is the first report which demonstrates that Hcy increases the expression of NRF-1 and Tfam in endothelial cells. The 2.4-fold increase of the NRF-1 mRNA level follow an almost 2-fold increase of the Tfam mRNA level after 3 h of treatment with Hcy. Furthermore, Hcy induces the mRNA expression and protein

level of the mitochondrial-encoded subunit III of cytochrome c oxidase (COX III), which is a component of the respiratory chain. However, the upregulation of the NRF1, Tfam, and COX III genes appears to be dependent on an increased production of ROS, because the pretreatment with the antioxidants significantly decreased their mRNA expression, compared to Hcy-treated cells, and reached basal conditions. These last results suggested that ROS were involved in the Hcy-induced mitochondrial biogenesis in endothelial cells. We have demonstrated that mitochondrial mass is increased in Hcy-treated endothelial cells in response to increased intracellular ROS production and through the expression of nuclear transcription factors, NRF-1 and Tfam. In conclusion, our results suggest that ROS is an important mediator of mitochondrial biogenesis induced by Hcy. This will then contribute to the development of endothelial dysfunction. Finally, the modulation of oxidative stress with antioxidants can protect against the adverse vascular effects of Hcy. Acknowledgments This work was supported by FONDECYT Grant 1020486 (R.F.), and by PUC-PBMEC. References [1] K.S McCully, Homocyst(e)ine and vascular disease, Nat. Med. 2 (1996) 386–389. [2] P.B. Duell, M.R. Malinow, Homocyst(e)ine: an important risk factor for atherosclerosis vascular disease, Curr. Opin. Lipidol. 8 (1997) 28–34. [3] P.M. Kanani, C.A. Sinkey, R.L. Browning, M. Allaman, H.R. Knapp, W.G. Haynes, Role of oxidant stress in endothelial dysfunction produced by experimental hyperhomocyst(e)inemia in humans, Circulation 100 (1999) 1161–1168. [4] X. Zhang, H. Li, H. Jin, Z. Ebin, S. Brodsky, M.S. Goligorsky, Effects of homocysteine on endothelial nitric oxide production, Am. J. Physiol. Renal Physiol. 279 (2000) F671–F678. [5] T. Finkel, N.J. Holbrook, Oxidants, oxidative stress and the biology of ageing, Nature 408 (2000) 239–247. [6] A. Ramachadran, A.L. Levonen, P.S. Brookes, E. Ceaser, S. Shiva, M.C. Barone, V. Darley-Usmar, Mitochondria, nitric oxide, and cardiovascular dysfunction, Free Radic. Biol. Med. 33 (2002) 1465–1474. [7] T. Ide, H. Tsutsui, S. Hayashidani, D. Kang, N. Suematsu, K. Nakamura, H. Utsumi, N. Hamasaki, A. Takeshita, Mitochondrial DNA damage and dysfunction associated with oxidative stress in failing hearts after myocardial infarction, Circ. Res. 88 (2001) 529– 535. [8] N. Suematsu, H. Tsutsui, J. Wen, D. Kang, M. Ikeuchi, T. Ide, S. Hayashidani, T. Shiomi, T. Kubota, N. Hamasaki, A. Takeshita, Oxidative stress mediates tumor necrosis factor-a-induced mitochondrial DNA damage and dysfunction in cardiac myocytes, Circulation 107 (2003) 1418–1423. [9] S.W. Ballinger, C. Patterson, C.A. Knight-Lozano, D.L. Burow, C.A. Conklin, Z. Hu, J. Reuf, C. Horaist, R. Lebovitz, G.C. Hunter, K. McIntyre, M.S. Runge, Mitochondrial integrity and function in atherogenesis, Circulation 106 (2002) 544–549. [10] Y.H. Wei, C.F. Lee, H.C. Lee, Y.S. Ma, C.W. Wang, C.Y. Lu, C.Y. Pang, Increases of mitochondrial genome is association with

K. Perez-de-Arce et al. / Biochemical and Biophysical Research Communications 338 (2005) 1103–1109

[11]

[12] [13] [14]

[15]

[16] [17]

[18]

[19]

[20]

[21]

enhanced oxidative stress in human cells harboring 4,977 bp-deleted mitochondrial DNA, Ann. N. Y. Acad. Sci. 928 (2001) 97–112. H.B. Suliman, K.E. Welty-Wolf, M.S. Carraway, L. Tatro, C.A. Piantadosi, Lipopolysaccharide induces oxidative cardiac mitochondrial damage and biogenesis, Cardiovasc. Res. 64 (2004) 279–288. Y.H. Wei, Oxidative stress and mitochondrial DNA mutations in human aging, Proc. Soc. Exp. Biol. Med. 217 (1998) 53–63. G. Attardi, G. Shatz, Biogenesis of mitochondria, Annu. Rev. Cell Biol. 4 (1988) 289–333. H.C. Lee, P.H. Yin, C.W. Chi, Y.H. Wei, Increase in mitochondrial mass in human fibroblast under oxidative stress and replicative cell senescence, J. Biomed. Sci. 9 (2002) 517–526. C.S. Liu, C.S. Tsai, C.L. Kuo, H.W. Chen, C.K. Lii, Y.S. Ma, Y.H. Wei, Oxidative stress-related alterations of the copy number of mitochondrial DNA in human leukocytes, Free Radic. Res. 37 (2003) 1307–1317. R.C. Scarpulla, Nuclear activators and coactivators in mammalian mitochondrial biogenesis, Biochim. Biophys. Acta 1576 (2002) 1–14. H.B. Suliman, M.S. Carraway, K.E. Welty-Wolf, A.R. Whorton, C.A. Piantadosi, Lipopolysaccharide stimulates mitochondrial biogenesis via activation of nuclear respiratory factor-1, J. Biol. Chem. 278 (2003) 41510–41518. A. Lezza, V. Pesce, A. Cormio, F. Fracasso, J. Vecchiet, G. Felzani, P. Cantatore, M.N. Gadaleta, Increased expression of mitochondrial transcription factor A and nuclear respiratory factor-1 in skeletal muscle from aged human subjects, FEBS Lett. 501 (2001) 74–78. S. Miranda, R. Foncea, J. Guerrero, F. Leighton, Oxidative stress and upregulation of mitochondrial biogenesis in mitochondrial DNAdepleted HeLa cells, Biochem. Biophys. Res. Commun. 258 (1999) 44–49. R.C. Austin, S.K. Sood, A.M. Dorward, G. Singh, S.G. Shaughnessy, S. Pamidi, P.A. Outinen, J.I. Weitz, Homocysteine-dependent alterations in mitochondrial gene expression, function and structure, J. Biol. Chem. 273 (1998) 30808–30817. E.A. Jaffe, R.L. Nachman, C.G. Becker, C.R. Minick, Culture of human endothelial cells derived from umbilical veins. Identification

[22]

[23]

[24] [25]

[26]

[27]

[28]

[29]

[30]

1109

by morphologic and immunologic criteria, J. Clin. Invest. 52 (1973) 2745–2756. S. Miranda-Rottmann, A.A. Aspillaga, D.D. Perez, L. Vasquez, A.L. Martinez, F. Leighton, Juice and phenolic fractions of the berry Aristotelia chilensis inhibit LDL oxidation in vitro and protect human endothelial cells against oxidative stress, J. Agric. Food Chem. 50 (2002) 7542–7547. J.D. Dignam, P.L. Martin, B.S. Shastry, R.G. Roeder, Eukaryotic gene transcription with purified components, Methods Enzymol. 101 (1983) 582–598. I.V. Turko, F. Murad, Protein nitration in cardiovascular diseases, Pharmacol. Rev. 54 (2002) 619–634. S. Lim, M.S. Kim, K.S. Park, J.H. Lee, G.H. An, M.J. Yim, J. Song, Y.K. Pak, H.K. Lee, Correlation of plasma homocysteine and mitochondrial DNA content in peripheral blood in healthy women, Atherosclerosis 158 (2001) 399–405. Z. Ungvari, A. Csiszar, J.G. Edwards, P.M. Kaminski, M.S. Wolin, G. Kaley, A. Koller, Increased superoxide production in coronary arteries in hyperhomocysteinemia. Role of tumor necrosis factor-a, NAD(P)H oxidase, and inducible nitric oxide synthase, Arterioscler. Thromb. Vasc. Biol. 23 (2003) 418–424. K.K.W. Au-Yeung, C.W.H. Woo, F.L. Sung, J.C.W. Yip, Y.L. Siow, K. O, Hyperhomocysteinemia activates nuclear factor-jB in endothelial cells via oxidative stress, Circ. Res. 94 (2004) 28–36. J.S. Becker, A. Adler, A. Schneeberger, H. Huang, Z. Wang, E. Walsh, A. Koller, T.H. Hintze, Hyperhomocysteinemia, a cardiac metabolic disease. Role of nitric oxide and the p22 phox subunit of NADPH oxidase, Circulation 111 (2005) 2112–2118. K. Brand, S. Page, G. Rogler, A. Bartsch, R. Brandl, R. Knuechel, M. Page, C. Kaltschmidt, P.A. Bauerle, D. Neumeier, Activated transcription factor nuclear factor-jB is present in the atherosclerotic lesions, J. Clin. Invest. 97 (1996) 1715–1722. M. Manczak, Y. Jung, B.S. Park, D. Partovi, P.H. Reddy, Timecourse of mitochondrial gene expressions in mice brains: implications for mitochondrial dysfunction, oxidative damage, and cytochrome c in aging, J. Neurochem. 92 (2005) 494–504.