Reactive oxygen species regulates expression of iron–sulfur cluster assembly protein IscS of Leishmania donovani

Free Radical Biology and Medicine 75 (2014) 195–209

Contents lists available at ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Reactive oxygen species regulates expression of iron–sulfur cluster assembly protein IscS of Leishmania donovani Krishn Pratap Singh a, Amir Zaidi a, Shadab Anwar a, Sanjeev Bimal b, Pradeep Das c, Vahab Ali a,n a Laboratory of Molecular Biochemistry and Cell Biology, Department of Biochemistry, Rajendra Memorial Research Institute of Medical Sciences, Agamkuan, Patna, India 800007 b Department of Immunology, Rajendra Memorial Research Institute of Medical Sciences, Agamkuan, Patna, India 800007 c Department of Molecular Biology, Rajendra Memorial Research Institute of Medical Sciences, Agamkuan, Patna, India 800007

art ic l e i nf o

a b s t r a c t

Article history: Received 8 April 2014 Received in revised form 10 July 2014 Accepted 14 July 2014 Available online 22 July 2014

The cysteine desulfurase, IscS, is a highly conserved and essential component of the mitochondrial iron– sulfur cluster (ISC) system that serves as a sulfur donor for Fe–S clusters biogenesis. Fe–S clusters are versatile and labile cofactors of proteins that orchestrate a wide array of essential metabolic processes, such as energy generation and ribosome biogenesis. However, no information regarding the role of IscS or its regulation is available in Leishmania, an evolving pathogen model with rapidly developing drug resistance. In this study, we characterized LdIscS to investigate the ISC system in AmpB-sensitive vs resistant isolates of L. donovani and to understand its regulation. We observed an upregulated Fe–S protein activity in AmpB-resistant isolates but, in contrast to our expectations, LdIscS expression was upregulated in the sensitive strain. However, further investigations showed that LdIscS expression is positively correlated with ROS level and negatively correlated with Fe–S protein activity, independent of strain sensitivity. Thus, our results suggested that LdIscS expression is regulated by ROS level with Fe–S clusters/ proteins acting as ROS sensors. Moreover, the direct evidence of a mechanism, in support of our results, is provided by dose-dependent induction of LdIscS-GFP as well as endogenous LdIscS in L. donovani promastigotes by three different ROS inducers: H2O2, menadione, and Amphotericin B. We postulate that LdIscS is upregulated for de novo synthesis or repair of ROS damaged Fe–S clusters. Our results reveal a novel mechanism for regulation of IscS expression that may help parasite survival under oxidative stress conditions encountered during infection of macrophages and suggest a cross talk between two seemingly unrelated metabolic pathways, the ISC system and redox metabolism in L. donovani. & 2014 Elsevier Inc. All rights reserved.

Keywords: Iron–sulfur protein Leishmania Reactive oxygen species (ROS) Drug resistance Amphotericin B

Introduction Leishmania donovani is a unicellular parasitic protozoon that causes visceral leishmaniasis (VL), a neglected tropical disease with severe systemic manifestations. If left untreated, it has a high fatality rate, ranked next to malaria as the most deadly protozoan disease [1]. The parasite exists in two host-specific forms: (i) extracellular promastigotes form in the midgut of sandfly (Phlebotomus spp.) vector and (ii) intracellular amastigotes form inside the host macrophages [2]. During its life cycle, Leishmania encounters and readily adapts to survive various hostile conditions

Abbreviations: ISC, iron sulfur cluster; LdIscS, L. donovani IscS; Fe–S, iron–sulfur; PLP, pyridoxal phosphate; ROS, reactive oxygen species; AmpB, amphotericin B; GFP, Green fluorescent protein; H2O2, hydrogen peroxide n Corresponding author. Fax: þ 91 612 2634379. E-mail address: [email protected] (V. Ali). http://dx.doi.org/10.1016/j.freeradbiomed.2014.07.017 0891-5849/& 2014 Elsevier Inc. All rights reserved.

such as oxidative stress due to heme digestion in the blood meal and midgut proteases in the sandfly, complement lysis in the blood upon transmission, and reactive oxygen and nitrogen species (ROS and RNS) generated during phagocytosis by host macrophages [3]. The survival of parasite relies mainly on the unique thiol-redox metabolism [4] and skills to suppress oxidative outbursts of the host defense mechanisms [5]. In recent decades, the parasites have encountered an additional stress imposed by antileishmanial drugs, the majority of which exert ROS-mediated cytotoxic effects [6], but emerging resistance to these drugs [7,8] proves the high adaptive capacity of this dynamic parasitic protozoa. The first line drug sodium stibogluconate is no more preferred for the treatment of VL patients in India because more than 65% cases show resistance or relapse in Bihar which contributes about 90% of the VL cases of India [9]. Thus, the second line drug liposomal preparation of Amphotericin B (AmpB) and miltefosine (first oral drug), alone or in combination, is presently

196

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

used but a recent report of AmpB resistance [10] has raised serious concerns about the future of AmpB treatment against VL. The mechanism of action of AmpB includes an altered lipid profile and a ROS-mediated cytotoxic effect on sensitive parasites, whereas AmpB-resistant isolates resist the cytotoxic change in ROS levels due to their upregulated redox cascade [6,10]. ROS is generally believed to be deleterious for cells. Fe–S clusters/proteins are their well-known vulnerable targets, particularly [4Fe-4S] clusters of proteins such as aconitase and succinate dehydrogenase enzymes, which are frequently used as hallmarks of oxidative stress. However, many studies have revealed that at submicrobicidal levels, ROS may also act as one of the key regulators in signal transduction pathways [11,12]. Recently, the differentiation of L. amazonensis promastigotes to infective amastigote forms has been shown to be mediated by ROS levels regulated by iron availability [13], indicating the importance of ROS in the pathophysiology of Leishmania. Fe–S clusters are susceptible to oxidative damage by ROS but how Leishmania copes with it is still unknown, especially in the context of its highly divergently stressed life cycle. Fe–S clusters are ROS-labile cofactors of proteins that orchestrate a wide range of biochemical machinery and efficiently regulate the metabolic cascades in living organisms for sustainable and fundamental life processes. In yeast, their biosynthesis by mitochondrial iron–sulfur cluster (ISC) machinery requires more than a dozen protein components [14] and among them, the cysteine desulfurase, IscS (yeast Nfs1), is a conserved and indispensable sulfur donor that requires cofactor pyridoxal phosphate (PLP) for binding of the substrate L-cysteine as well as to catalyze the formation of persulfide residue on active site cysteine [15–17]. Each IscS monomer contains two domains, the larger bearing the PLP cofactor binding site and the smaller bearing the active site cysteine residue in the middle of a highly flexible loop involved in catalysis [18–20]. The persulfide formation on IscS has recently been proposed to involve a significant conformational change in the enzyme, induced by interaction with Isd11, to bring the bound substrate and active site cysteine on loop in close proximity [17]. The persulfide is then transferred to acceptor proteins involved in Fe–S cluster biosynthesis or other sulfur-related pathways, which include biotin synthesis, tRNA modifications, and molybdopterin biosynthesis [19,21,22]. Three types of Fe–S cluster biogenesis systems are known, viz. ISC, sulfur utilization factors (SUF), and nitrogen fixation (NIF) systems, which are highly conserved in prokaryotes and eukaryotes. The majority of the protozoan parasites exclusively possess only the ISC system such as Giardia intestinalis, Trichomonas vaginalis [23,24], microsporidians Encephalitozoon cuniculi and Trachipleistophora hominis [25], apicomplexans Cryptosporidium parvum and C. hominis [25]. However, Plasmodium falciparum and anaerobic stramenophile parasite Blastocystis possess SUF systems in their apicoplasts and cytoplasm [26], respectively, along with the canonical ISC system [27,28]. In contrast, parasitic protist E. histolytica possess a NIF system as the sole nonredundant Fe–S cluster biogenesis system for both mitosomal and nonmitosomal Fe–S proteins [29]. Recently, genome-wide analysis of trypanosomatids Trypanosoma brucei, T. cruzi, and Leishmania has indicated the presence of a complete ISC system, whereas SUF and NIF systems are absent [30]. However, some components of the mitochondrial ISC system are characterized in T. brucei [31–35], whereas no work has been done on other trypanosomatids. The T. brucei genome encodes two IscS/Nfs-like proteins, TbIscS and TbSCL, TbIscS of which is the genuine IscS/Nfs homolog, localized in the mitochondria and essential for Fe–S cluster assembly [31], whereas TbSCL is the dispensable eukaryotic selenocysteine lyase homolog (TbSCL) localized in the nucleus and cytoplasm of T. brucei [36]. In T. brucei, RNAi of either the TbIscS or the TbSCL gene shows a decrease in cysteine desulfurase as well as

selenocysteine lyase activities in mitochondria as well as cytosol, suggesting dual localization of these proteins, although TbIscS shows a severe growth phenotype [31,36]. Recently, TbIscS has been shown to be additionally localized in the nucleolus [37], although its precise role in nucleus is still unclear. A previous report on L. enriettii showed an upregulated Fe–S protein activity and higher iron content to be linked to vineblastine resistance [38], but the role of the ISC system was not investigated. To date, to our knowledge, there is no other published report on correlation of Fe–S protein activity with drug resistance in any protozoan parasites, whereas the potential role of the ISC system in relation to Fe–S protein activity and drug resistance has remained to be explored. So, in this study, we characterized LdIscS (IscS of L. donovani) of the ISC system and investigated the relation among LdIscS, Fe–S protein activity, and AmpB resistance in L. donovani. The activity of Fe–S proteins depends on the Fe–S clusters synthesized by the ISC system and hence, we expected an upregulated ISC system for increased Fe–S protein activity. In contrast, we observed that LdIscS is upregulated in the sensitive strain despite lower Fe–S protein activity, as compared to resistant isolates. Further, we provide evidence of a novel ROS-based regulation mechanism for IscS expression in L. donovani using the AmpB-sensitive strain and resistant isolates as a physiologically relevant pathogen model.

Materials and methods Ethical statement Male rabbit aged 3–4 months was used in the present study for raising antibodies after prior approval of Animal Ethical Committee, Rajendra Memorial Research Institute of Medical Sciences (RMRIMS), Indian Council of Medical Research (ICMR). The RMRIMS, ICMR follows “The Guide for the Care and Use of Laboratory Animals,” 8th edition by the Institute for Laboratory Animal Research. The human splenic aspirate was collected by trained medical specialists after obtaining written informed consent from the patients under the protocol activity approved by the Institutional Human Ethics Committee of the RMRIMS for human ethical guidelines, as reflected in the guidelines of the Medical Ethics Committee, Ministry of Health, India. Clinical isolates and parasites culture Drug-resistant clinical isolates of L. donovani were obtained from the splenic aspirates of VL patients unresponsive to AmpB treatment in the indoor ward facility of RMRIMS, Patna, Bihar, India. The aspirates bearing amastigotes were allowed to transform into promastigotes in biphasic (N,N,N) medium supplemented with Hank’s balanced salt solution (HBSS, Invitrogen) before being transferred to Schneider’s insect medium (pH 7.2) supplemented with 10% heat-inactivated fetal bovine serum (HIFBS). Both the resistant isolates (henceforth designated, R1 and R2) and the reference sensitive L. donovani strain Ag83 (MHOM/IN/83/Ag, henceforth designated S) were finally maintained in M199 medium supplemented with 10% HIFBS, 25 mM HEPES buffer (pH 7.2), 100 units/ml penicillin, and 100 mg/ml streptomycin. The culture was initiated at 1  105 parasites/ml and grown at 2471 1C in a BOD incubator for 4–5 days before subculturing (late log phase). In vitro drug sensitivity assay and culture maintenance at subinhibitory concentration of AmpB The 50% inhibitory concentration (IC50) values of AmpB (Hyclone) for sensitive and resistant isolates were determined by

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

trypan blue exclusion method, as described previously [39]. To sensitize the adaptive response machinery of the parasites, all the isolates were gradually subjected to increasing drug pressure from 1.0 to 20.0 ng/ml through 10 generations where growth rate, cell viability, and morphology were virtually unaffected. Finally, the isolates were maintained at 20 ng/ml of AmpB with periodic removal of drug pressure for two subcultures after every 4–5 subcultures under drug pressure. For all AmpB treatment experiments (blots/assays), the cultures under drug pressure were subjected to an additional 20 ng/ml AmpB treatment for 4 h before harvesting. Cloning, expression, and purification of recombinant LdIscS protein The LdIscS ORF was amplified by PCR from cDNA of L. donovani strain Ag83 using primers 50 CCAGGATCCATGCGGTGCGTGTCGCGTGTCTT30 and 50 AACGGATCCCTAACGCCACTGCACGTCC30 (added BamHI restriction site is underlined, and the translation initiation and termination codons are italicized) and Pfu DNA polymerase (Fermentas). The  1.2 kb amplicon was cloned in vectors pGEX-4 T1 (Amersham Biosciences) and pET28a(þ) (Novagen) to construct plasmids that would yield recombinant LdIscS fusion proteins with a N-terminal glutathione-S-transferase tag (rLdIscS-GST) or histidine tag (rLdIscS-His), respectively, as described previously [40]. The final constructs were designated pLdIscS-GST and pLdIscS-His, respectively. For overexpression of recombinant proteins, Escherichia coli BL21 (DE3) cells harboring pLdIscS-His or pLdIscS-GST plasmid were induced with IPTG, as described previously [40]. Briefly, in case of rLdIscS-GST, 5 ml overnight culture was used to inoculate 500 ml of Luria Broth (LB, Himedia) media supplemented with 50 mg/ml of Ampicillin (Sigma) and expression was induced with 0.2 mM IPTG for 16–20 h at 22 1C/200 rpm. The soluble rLdIscSGST was purified using glutathione agarose resin, according to manufacturer’s (Sigma) recommendations and immediately used for cysteine desulfurase assay, but yield was insufficient for raising antibodies. Similarly, rLdIscS-His expression was induced with IPTG but all the fusion protein was found in inclusion bodies. For purification under denaturing conditions, 500 ml fresh LB medium was inoculated with 5 ml inoculum, induced by 1 mM IPTG for 4 h at 37 1C, and fusion protein-purified from inclusion bodies solubilized in 8 M urea using Ni-nitrilotriacetic acid resin, as per the manufacturer’s (Qiagen) recommendations. Polyclonal antisera raised against rLdIscS in rabbit and immunoblot analysis The rLdIscS-His protein purified under denaturing conditions was used for raising polyclonal antisera against LdIscS. Preimmune sera were collected before immunization and the first dose of 250 mg purified rLdIscS-His protein emulsified in complete Freund’s adjuvant was injected subcutaneously at multiple sites followed by three booster doses of the same quantity emulsified in Freund’s incomplete adjuvant at 2 weeks interval. Anti-LdIscS titer was checked by ELISA using iMark microplate reader (Bio-Rad) after 2 weeks of final immunization. Finally, the rabbit was sacrificed, and serum was collected and stored at  30 1C in small aliquots. Working antibodies were stored at 4 1C. Prior animal ethical committee approval was taken and recommendations were strictly followed. Immunoblot analysis was performed with 50 mg total lysate resolved on 10% SDS-PAGE and electroblotted onto nitrocellulose membrane using Semi-Dry Trans-Blot (Bio-Rad). Anti-LdIscS serum and anti-LdActin serum (kind gift from Dr. Amogh A. Sahasrabuddhe, CDRI, Lucknow, India) were used at 1:5000 dilution, whereas alkaline phosphatase-conjugated goat anti-rabbit IgG antibody (Santa Cruz)

197

was used at 1:2000 dilution. The blots were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Santa Cruz) according to the manufacturer’s recommendations. Densitometry analysis of the immunoblots was performed using ImageJ software (http://imagej.nih.gov/ij) and relative band intensity was plotted. Subcellular localization of LdIscS using digitonin fractionation Cell fractionation was performed as reported previously [41,42] with minor modifications. Briefly, aliquots of 5  108 L. donovani promastigotes were washed twice with ice-cold HBSS (Invitrogen) and resuspended in 350 μl of HBSS containing protease inhibitors cocktail (Roche) and different final concentrations of 0-10 mg digitonin (Calbiochem) per milligram total protein. After incubation at 37 1C for 2 min, the samples were vortexed, centrifuged at 14,000g, 4 1C for 2 min and supernatant fractions collected. The pellet obtained was resuspended in 350 μl 1X HBSS containing 1% Triton X-100, 0.5 mg/ml digitonin, and protease inhibitor cocktail, incubated on ice for 15 min with intermediate vortexing, and centrifuged at 14,000g, 4 1C for 5 min to obtain the pellet fraction. The supernatant and pellet fractions were run on 10% SDS-PAGE and analyzed by Western blot using anti-LdIscS sera. Anti-LdTryS (L. donovani trypanothione synthetase) serum was used as cytosolic marker [39]. LdTryS is a cyotosolic enzyme of the thiol metabolic pathway of L. donovani which catalyzes the biosynthesis of trypanothione, the major redox active thiol in Leishmania, from substrates glutathione and spermidine. Localization of LdIscS using fluorescence microscopy LdIscS with intact mitochondrial targeting sequence was cloned in pXG-GFP þ [43] vector to express LdIscS as fusion proteins with a C-terminal GFP tag. The construct LdIscS-GFP was transfected by electroporation [44] in the L. donovani-sensitive strain promastigotes and transformants selection was achieved with increasing concentrations of G418, up to a final concentration of 400 mg/ml. The culture was finally maintained in 200 mg/ml of G418. L. donovani promastigotes expressing LdIscS-GFP in late log phase were incubated with 500 nM MitoTracker deep red (Invitrogen) in serum-free M199 media for 30 min in BOD at 24.0 71 1C. The cells were harvested, washed twice with PBS, and fixed in 4% formaldehyde for 10 min on ice. Following washing with PBS, the fixed parasites were incubated with DAPI (1:1000, Sigma) for 5 min on ice and washed thrice with cold PBS. The parasites were mounted (Qmount, Invitrogen) and observed under a BX 41 Olympus fluorescence microscope. Image analysis was performed using IPlite software (Olympus). Total lysate preparation and enzymatic assays All the assays were performed with 500 mg total lysate proteins of each strain, with or without AmpB treatment, in late log phase of growth, unless specified. Total lysate was prepared by a modified procedure of Overath et al. [45]. Briefly, promastigotes were harvested and washed twice with PBS and pellet was resuspended in lysis buffer containing PBS (pH 7.4), 1X protease inhibitor cocktail (Roche), and 0.5 mg/ml digitonin. The cell suspension was subjected to 2-3 freeze thaw cycles and 2-3 very brief pulses of sonication. The unlysed cells and cell debris were removed by brief centrifugation at 1000 × g for 5 min and the resulting supernatant was subjected to protein estimation by Bradford reagent (Fermentas) using BSA as standard, according to the manufacturer’s instructions. All the assays were performed on a double beam spectrophotometer (UV-3900 Hitachi, Japan).

198

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

Cysteine desulfurase assay

Flow cytometry analysis

Cysteine desulfurase activity of purified rLdIscS and total lysate proteins was determined by monitoring sulfide release from L-cysteine as described previously [40,46]. Briefly, a reaction mixture of 1.0 ml containing PBS (pH 7.4), 1 mM DTT, 10 mM PLP, 1 mM L-cysteine, 10 mM MgCl2, and with or without 500 mg total lysates was incubated for 1 h, RT. The reaction was then stopped by sequentially adding 20 mM N,N-dimethyl-p-phenylenediamine sulfate dissolved in 7.2 N HCl and 30 mM FeCl3 dissolved in 1.2 N HCl. After further incubation in the dark for 30 min, the protein precipitate was removed by centrifugation and absorption of the supernatant measured at 670 nm. Na2S (0-100 mM) was used as standard for sulphide estimation. Specific cysteine desulfurase activity was calculated as micromoles of sulphide produced per minute per milligram of total lysate.

Promastigotes (1  106 parasites) of each strain, with or without AmpB treatment, were permeabilized-fixed with a BD CytopermCytofix permeabilization kit (BD) according to the manufacturer’s recommendations and stained with anti-LdIscS sera at 1:500 dilution in cytoperm wash buffer at 4 1C, overnight, and secondary antibody goat anti-rabbit IgG-FITC (Santa Cruz) at 1:2000 dilution in cytoperm wash buffer, 1 h, RT. The cells were washed twice with PBS and kept on ice until analysis. Data acquisition and analysis were performed using a FACS Calibur flow cytometer (Becton Dickinson, USA) equipped with the Cell Quest software (Joseph Trotter, Scripps Research Institute, La Jolla, USA). A total of 10,000 events were acquired in the region previously established as corresponding to the parasites. Alterations in the fluorescence for LdIscS were quantified using an index of variation (IV) [49] obtained by the equation (MT-MC)/MC, where MT is the median of fluorescence for treated parasites and MC is the median of control parasites. Positive value indicates upregulation of LdIscS after AmpB treatment.

Aconitase assay Aconitase activity was assayed by monitoring NADP þ reduction with 500 mg total lysate proteins in a 1.0 ml reaction mixture containing 30 mM sodium citrate, 0.2 mM NADP þ , 0.5 mM MnCl2, 1 unit of isocitrate dehydrogenase in HEPES buffer (pH 7.4). The kinetics of NADPH production was measured by the increase in absorbance at 340 nm for 5 min after addition of protein, assuming an extinction coefficient of NADPH equal to 6200 M  1 cm  1. The specific aconitase activity was calculated in nanomoles per minute per milligram of total lysate for all the strains [47]. Iron assay Total iron content in total lysate proteins was estimated using the o-phenanthroline method, as described previously [40]. Briefly, 500 mg total lysates was acidified by addition of a few drops of conc HCl, diluted with PBS to a final volume of 200 ml for all lysates, and heated at 80 1C for 10 min. The samples were cooled and mixed with 0.6 ml PBS, 40 ml 10% hydroxylamine hydrochloride, and 0.2 ml 0.1% o-phenanthroline. The reaction mixture was incubated for 30 min, RT, and absorbance measured at 512 nm. Succinate dehydrogenase assay The succinate dehydrogenase activity in 500 mg total lysate proteins was measured as described previously [48], with minor modifications. Briefly, a 1.0 ml reaction mixture containing PBS buffer (pH 7.4), 10 mM sodium succinate, 1 mM potassium ferricyanide, and with or without 500 mg total lysate was incubated at 24 1C for 1.0 h. The decrease in absorbance at 415 nm was measured with respect to control samples (without protein). The succinate dehydrogenase specific activity was calculated in nanomoles per minute per milligram of total lysate, assuming an extinction coefficient of 1040 M  1 cm  1 for potassium ferricyanide. Quantitation of reactive oxygen species Intracellular ROS of each strain, with or without AmpB treatment, was quantified using 2,7,-dichlorodihydrofluorescein diacetate (H2DCFDA, Sigma) as described previously [39]. Briefly, 2  106 parasites/well were incubated with 20 mM H2DCFDA in PBS for 30 min, in the dark, in a 24-well plate. Fluorescence was measured using an LS55 spectrofluorimeter (Perkin Elmer) at excitation and emission wavelength of 492 and 529 nm, respectively. The fluorescence intensity is directly proportional to the accumulated ROS and expressed in relative fluorescence unit (RFU). The reagent blank was prepared with 20 mM H2DCFDA in PBS.

LdIscS-GFP induction study LdIscS-GFP overexpressing sensitive strain parasites were seeded at 1  106 cells/ml in 6-well plate without G418 and treated with different doses of H2O2 (10, 20, 50 mM) or menadione (1, 2.5, 7.5 mM) or AmpB (1, 10, 30 ng/ml) for 4 h in a BOD at 2471 1C. The parasites were harvested, washed twice with PBS, and used immediately for FACS analysis or immunoblot using polyclonal anti-LdIscS sera. The uninduced parasites served as negative control, whereas 100 mg/ml G418-treated parasites served as a positive control. Anti-myosin 21 antibody (a kind gift from Dr. Amogh A. Sahasrabuddhe) was used as a loading control for densitometric analysis. The experiment was repeated thrice and a representative result is shown.

Statistical analysis Statistical analysis was carried out using GraphPad Prism 6.0 software (GraphPad Software Inc., La Jolla, CA, USA). Student’s t test was used to estimate the statistical significance of the differences between groups. Differences between groups were considered statistically significant when P value was less than 0.05 (nP o0.05; nnP o0.01; nnnP o0.001).

Results IscS homolog of L. donovani The BLAST search of the L. donovani genome data base (www. sanger.ac.uk/) using E. coli IscS, SufS, S. cerevisiae Nfs1, and amoebic NifS as query sequences identified only one homologue of IscS, LdIscS, accession number LDBPK_270930, present on chromosome 27. All other genes of ISC system including export and CIA machineries are also present in the majority of Leishmania species (L. donovani, L. infantum, L. major, and L. braziliensis), whereas SUF and NIF system components are absent, as reported previously [30]. LdIscS has an ORF of 1323 nucleotides which encodes a 440 amino acid polypeptide with predicted molecular weight of 47.73 kDa as determined by SWISS-PROT online proteomics tool. Additionally, it also encodes for an IscS/Nfs-like protein, LdSCL, which is a putative selenocysteine lyase homolog and shows 55% identity (70% similarity) to TbSCL (data not shown).

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

Expression and purification of rLdIscS protein and raising polyclonal antibodies in rabbit E. coli BL21 (DE3) cells harboring either pLdIscS-GST or pLdIscSHis plasmid was used for expression of recombinant LdIscS. The expression of rLdIscS-GST was very high but most of the protein (4 95%) was found in the inclusion bodies. A small amount of protein under the native conditions was purified for enzymatic activity, approximately 100 μg/L of E. coli culture. The purified rLdIscS-GST protein revealed two apparently homogeneous bands of  72 and 26 kDa on 10% SDS-PAGE (Fig. 1A), which was consistent with the predicted size of LdIscS protein (48 kDa) fused with a 26 kDa GST tag. The other band of 26 kDa was confirmed to be GST protein by immunoblot using polyclonal anti-GST antibody (data not shown). The purified rLdIscS-GST was active and showed optimum cysteine desulfurase activity at pH 7.5–8.0 (data not shown) similar to other eukaryotes [16]. The rLdIscS-His protein expression was also high but all the proteins were invariably present in the inclusion bodies under every expression condition tried. The rLdIscS-His was purified from inclusion bodies under denaturing conditions and an apparently homogeneous band of purified rLdIscS-His ( 52 kDa) was observed in pH 5.9 and pH 4.5 elute fractions (Fig. 1B, lanes 7 and 8) on Coomassie-stained 10% SDS-PAGE. The two major bands observed in wash fraction of pH 6.3 (Fig. 1B, lanes 4 and 5) probably represents the loosely bound rLdIscS-His protein (  52 kDa) and the other band (o50 kDa) is a bacterial protein eluted under mild acidic pH conditions. The yield of purified protein was  4-5 mg/L of E. coli culture and 499% pure. The purified protein was used for raising polyclonal antibodies in rabbit.

M

250 130 95 72 55

1

2

3

4

199

IscS is localized in the mitochondria of L. donovani promastigotes MitoProt analysis of the LdIscS amino acid sequence predicted high probability (0.93) of mitochondrial targeting. To verify the in silico predicted mitochondrial targeting of LdIscS, differential permeabilization of parasites by increasing concentrations of digitonin was carried out, followed by immunoblot analysis of resulting supernatant and pellet fractions, using specific polyclonal antibodies raised against rLdIscS-His in rabbit (anti-LdIscS sera, 1:5000 dilution) and anti-LdTryS sera (1:2500 dilution) as cytosolic marker. As shown in Fig. 2A, LdIscS was released in the supernatant fraction at a higher concentration of digitonin (0.5 mg digitonin/mg total protein) as compared to cytosolic protein LdTryS which was released at much lower concentrations of digitonin (0.05 mg digitonin/mg total protein). Similarly, in the pellet fractions, a higher concentration of digitonin (1.0 mg digitonin/mg total protein) was required to completely release LdIscS, whereas cytosolic protein LdTryS was completely released at 0.2 mg digitonin. Since the release pattern of LdIscS was significantly different from the cytosolic control LdTryS [39] in both the supernatant and the pellet fractions, we can conclude that IscS has noncytosolic/organellar localization in L. donovani promastigotes [50]. To confirm the subcellular localization of LdIscS, LdIscS-GFP overexpressing L. donovani promastigotes was processed as described under Materials and methods and analyzed by fluorescence microscopy. As evident in Fig. 2B, the LdIscS-GFP completely overlays the image obtained with MitoTracker Red and the merged image clearly suggests that LdIscS is colocalized with MitoTracker Red and distributed throughout the single reticulated mitochondria of the parasite. However, in contrast to recent reports for T. brucei IscS [37] and human Nfs1 [51], we were unable to detect LdIscS signal in either the DAPI-labeled nucleus or the cytosol, as evident from the merged image. Thus, the results indicate a predominant mitochondrial localization of LdIscS.

5

IscS expression is upregulated whereas Fe–S protein activity is downregulated in AmpB-sensitive L. donovani strain

36 28

17

pH 6.3

M

1

2

3

4

5

pH 5.9

6

pH 4.5

7

8

118 90 50 34 26 19

Fig. 1. Expression and purification of recombinant LdIscS protein: (A) rLdIscS-GST purification under native conditions using GSH-agarose. The total cell lysate and samples at each purification step were electrophoresed on 10% SDS-PAGE gel and stained with Coomassie brilliant blue. Lane M, mol. wt. marker; Lane 1, uninduced supernatant (Control); Lane 2, induced supernatant of cells expressing LdIscS-GST; Lane 3, flowthrough; Lane 4, final wash; Lane 5, fraction eluted with 10 mM glutathione. (B) rLdIscS-His purification under denaturing conditions using Ni NTAagarose: The total cell lysate and samples at each purification step were electrophoresed on 10% SDS-PAGE gel and stained with Coomassie brilliant blue. Lane M, mol. wt. marker; Lane 1, total lysate; Lane 2, solubilized inclusion bodies in 8 M urea; Lane 3, flowthrough; Lanes 4 and 5, wash with pH 6.3 buffer; Lane 6, fraction eluted with pH 5.9 buffer; Lanes 7 and 8, fractions eluted with pH 4.5 buffer.

The IC50 values of AmpB for all strains/isolates used in this study were found to be 45 77, 235714, and 250 78 ng/ml for the sensitive strain, S, and resistant isolates, R1 and R2, respectively. The results showed 5- to 6-fold higher values for resistant isolates as compared to the sensitive strain. To check whether LdIscS expression has any correlation with drug resistance, we performed cysteine desulfurase (CDES) assay with total lysate of the AmpBsensitive and -resistant isolates, as explained under Materials and methods. As shown in Fig. 3A, the sensitive strain, S, displayed a significant  45-50% higher CDES activity as compared to either of the resistant isolates, R1 (P ¼0.0132) and R2 (P ¼0.0285). To verify that the observed CDES activity variation is indeed due to variations in LdIscS protein level, immunoblot analysis of the same lysates (50 mg protein of each strain) with anti-LdIscS sera was performed. As shown in Fig. 3B, the immunoblot revealed a pattern of LdIscS expression which correlates well with observed CDES activity, reflecting the inherent variations in LdIscS expression in different strains. Anti-LdActin antibody was used as loading control. Thus, both these results qualitatively as well as quantitatively confirmed the upregulation of IscS in the AmpB-sensitive L. donovani strain. Furthermore, Coomassie-stained gel (Fig. 3B) shows that an equal amount of protein was loaded in each well and all the strains had apparently similar protein profiles. IscS is an integral catalytic component of Fe–S cluster assembly machinery; thus upregulation in LdIscS is expected to be manifested by an increased activity of Fe–S proteins in the AmpBsensitive strain. To check this, we performed aconitase assay, succinate dehydrogenase (SDH) assay, and total free iron content

200

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

mg digitonin / mg total protein 0.05

0.1

0.2

0.5

1

5

αLdTryS αLdIscS

pellet

αLdTryS αLdIscS

Phase

10 supernatant

0

DAPI

IscS-GFP

Mitotracker

Merge

Fig. 2. Localization of LdIscS protein in L. donovani promastigotes: (A) Subcellular localization of LdIscS by digitonin fractionation. Supernatant and pellet fractions obtained after permeabilization of L. donovani promastigotes with increasing digitonin concentrations were analyzed by immunoblot using α-LdIscS sera. α-LdTryS was used as cytosolic marker. (B) Immunofluorescence analysis of LdIscS-GFP overexpressing L. donovani promastigotes. The cells were stained with MitoTracker (red) and DAPI (blue). LdIscS-GFP protein was detected in mitochondria as confirmed by colocalization with the MitoTracker signal (merged image).

assay with total lysates of each strain. Unexpectedly, as shown in Fig. 3C, aconitase activity in the sensitive strain, S, was found to be 50-60% of R1 (P ¼0.0420) and  40% of R2 (P¼ 0.0569). The specific aconitase activity (μmol/min/mg total lysate) in S was  2to 3-fold lower than either of the resistant isolates, R1 or R2 (Fig. 3D). Similarly, as shown in Fig. 3E, the observed SDH activity in S was 20-25% of R1 (P¼ 0.0362) and  60-70% of R2 (P ¼0.0013). The specific SDH activity (μmol/min/mg total lysate) in S was  2- to 3-fold lower than either R1 or R2 (Fig. 3F). Moreover, the difference in the aconitase and SDH activity between R1 and R2 was found to be statistically insignificant. Promptly, malate dehydrogenase assay used as a control for a non Fe–S mitochondrial protein yielded insignificant differences between the three isolates under identical assay conditions (data not shown). Thus, the results show that Fe–S protein activity is upregulated in resistant isolates which is in conformity with the previous report on resistant strains of L. enriettii [38] but in contrast to our expectations based on LdIscS upregulation in the sensitive strain. Further experiments were carried out to explain the underlying mechanism behind this anomaly. Since, iron is one of the essential precursors for Fe–S cluster assembly, we tried to find out any differences in the iron level between sensitive and resistant isolates. The total iron content in both the resistant isolates R1 and R2 was found to be marginally but significantly (  15-20%) higher than S, which also agrees with the previous report on resistant isolates of L. enriettii [38] (Fig. 3G). This marginal increase is significant given the tightly regulated iron homeostasis as well as a recent report of iron-dependent promastigotes to amastigotes differentiation in L. amazonensis [13]. AmpB treatment induces LdIscS expression in the sensitive strain only AmpB exerts its cytotoxic effect on L. donovani parasites through ROS generation [6,10] and ROS are known to cause

oxidative damage to Fe–S clusters. To observe the effect of a sublethal dose AmpB treatment on LdIscS expression in sensitive vs resistant strains, we performed immunoblot analysis as well as CDES assay after identical in vitro AmpB treatment of all the three strains, as described under Materials and methods. As shown in Fig. 4A, the anti-LdIscS sera probed immunoblot of total lysates of different strains post-AmpB treatment and its comparison with untreated control shows a visible change in the expression level of LdIscS post-AmpB treatment in sensitive strains only. The densitometry analysis of immunoblot (Fig. 4B) using Coomassie-stained SDS-PAGE gel (not shown) for normalization of data shows a 2.5fold increase in the LdIscS expression level after AmpB treatment in the sensitive strain, whereas the resistant isolates did not show significant variation. The immunoblot results were verified by functional CDES assay using the same lysates and as shown in Fig. 4C, the CDES activity was found to be  75% higher in AmpBtreated sensitive parasites as compared to untreated sensitive parasites (P ¼0.0184), whereas resistant isolates showed insignificant variations on similar treatment. Furthermore, the upregulated CDES activity of AmpB-treated sensitive parasites was found to be significantly higher than either of the AmpB-treated resistant isolates, R1 (P ¼0.0134) and R2 (P ¼0.0082), as calculated by Sidak’s multiple comparison test using Graphpad Prism 6. To further confirm this change in LdIscS expression on AmpB treatment, FACS analysis using anti-LdIscS/FITC-labeled parasites was performed. The histogram plot analysis showed two distinct populations in AmpB-treated sensitive parasites (peaks M1 and M2 of S (D), Fig. 4D) comprising 47.81% (peak M1) and 43.33% (peak M2) of gated parasites, with the latter having a significantly higher fluorescence intensity, indicating an upregulated LdIscS expression. Furthermore, on AmpB treatment, only the sensitive strain showed  3-fold increase in mean fluorescence intensity of LdIscS as compared to untreated control (Fig. 4E). Surprisingly, resistant isolates showed a slight decrease in LdIscS level on

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

M

S

R1

201

R2

αLdIscS αLdActin

Fig. 3. LdIscS is upregulated but Fe–S protein activity downregulated in the sensitive L. donovani strain as compared to resistant isolates: (A) The cysteine desulfurase specific activity in total lysates of the sensitive strain (S) and resistant isolates (R1 and R2) is shown as percentage activity of S. Data are expressed as means 7standard error of means (SEM) of five independent experiments and statistical significance was calculated by Student’s t test using Graphpad Prism 6. * indicates significant difference relative to the sensitive strain (Po 0.05); (B) SDS-PAGE gel (above) and immunoblot analysis (below) of same total lysates using α-LdIscS sera. α-LdActin was used as a protein loading control. (C–G) Marker Fe–S proteins (aconitase and succinate dehydrogenase) activities and iron content measured in the same lysate. The percentages of total aconitase specific activity (C), succinate dehydrogenase (SDH) activity, (E) and total iron content (G) in total lysates of sensitive strain (S) and resistant isolates (R1 and R2) are shown relative to resistant isolate R2. The specific activities of aconitase (D) and succinate dehydrogenase (F) represent (μmol/min/mg total lysate proteins) of S, R1, and R2 are shown in the bar graph. Data are expressed as means 7SEM of five independent experiments. (n Po 0.05; nn P o0.01 by Student’s t test using GraphPad Prism 6.).

202

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

Fig. 4. AmpB treatment induces further upregulation of LdIscS in the sensitive strain only. (A) Immunoblot analysis of LdIscS in total lysates of the sensitive strain (S) and resistant isolates (R1 and R2) after AmpB treatment. Equal amount of protein was loaded in each well. Lane S, R1 and R2–total lysates of respective strain/isolates without AmpB treatment (control); Lane S (D), R1 (D), and R2 (D)–total lysates of respective strain/isolates after AmpB treatment. (B) Densitometry analysis of immunoblot after normalization using imageJ tool. The data shown are representative of five independent experiments performed. (C) The percentages of specific cysteine desulfurase activity in the same lysates used for immunoblot. Data are expressed as means 7SEM of five independent experiments. (n P o0.05; nn P o 0.01; ns, nonsignificant by Student’s t test using GraphPad Prism 6). (D) Flow cytometry analysis of parasites after AmpB treatment. Promastigotes of S, R1, and R2 strain/isolates after AmpB treatment (S (D), R1 (D), and R2 (D)) or without treatment (S, R1, and R2) were labeled with α-LdIscS sera and α-rabbit IgG-FITC. Data acquisition and analysis were performed using a FACSCalibur flow cytometer (equipped with the Cell Quest software). A total of 10,000 events were acquired in the regions previously established as those corresponding to each strain of L. donovani. One representative experiment out of three performed is shown here. (E) A histogram plot of mean fluorescence intensity after FACS analysis is shown.

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

203

similar AmpB treatment. Moreover, the basal LdIscS level in the untreated sensitive strain was  2-fold higher as compared to untreated resistant isolates, supporting our previous results. The quantification of these changes was evaluated by unit index of variance (IV). The AmpB-treated sensitive strain led to IV of 2.04, whereas AmpB-treated resistant isolates showed a negative IV, -0.56 for R1 and -0.30 for R2. Therefore, we concluded that the sensitive strain has a higher basal level LdIscS expression as compared to resistant isolates and on AmpB treatment, only the sensitive strain shows a significant upregulation in LdIscS expression. AmpB treatment induces a ROS-mediated damage to Fe–S protein activity in the sensitive strain Further, we carried out Fe–S protein assay under similar AmpB treatment conditions to check whether this increase in LdIscS expression in the sensitive strain has any correlation with Fe–S protein activity status. Interestingly, aconitase activity decreased to 40% of the untreated control in the sensitive strain, whereas both resistant isolates, R1 and R2, did not show significant variations on identical AmpB treatment (Fig. 5A). Similarly, SDH activity was also found to be significantly lower and remained to 10% of the untreated control in the sensitive strain (P ¼0.0303), whereas in the case of resistant isolates, the loss in activity was comparatively much less,  40% for R1 and  30% for R2 (Fig. 5B). The reason behind the apparent loss of SDH activity but unaffected aconitase activity in R1 and R2 may lie in the susceptibility and accessibility of Fe–S clusters in the individual enzymes. Also, SDH is a mitochondrial enzyme, whereas aconitase has dual localization, as reported previously in T. brucei [42]. So, the loss in activity may represent the way in which AmpB interacts with mitochondria and cytosol, as well as the redox homeostasis machinery operative in respective compartments. Nevertheless, the results indicate that on AmpB treatment, the sensitive strain displays a significant loss in Fe–S protein activity with a concomitant upregulation of LdIscS expression. Apart from the anomalous observation of negative correlation between Fe–S protein activity and LdIscS expression, the key questions that remained unanswered were why LdIscS expression is higher in the sensitive strain and why only the sensitive strain shows a further upregulation of LdIscS on AmpB treatment? The basic factor differentiating an AmpB-sensitive strain from an AmpB-resistant isolate is the net ROS level and its regulation. So, the intracellular ROS content in the AmpB-sensitive strain and resistant isolates with or without AmpB treatment was measured using H2DCFDA dye. As obvious in Fig. 5C, AmpB treatment induced ROS in all three strain/isolates but the net posttreatment ROS level was markedly higher in the sensitive strain than in either of the resistant isolates, in agreement with previous reports [6,10]. The sensitive strain displayed  3- to 4-fold increase in ROS content on AmpB treatment as compared to their untreated controls (P ¼0.0009), whereas identical treatment on resistant isolates elicited a marginal increase in ROS, which was not found to be significant for both R1 and R2, as compared to their respective untreated controls. Furthermore, the basal endogenous ROS level was also found to be slightly higher in the sensitive strain as compared to both resistant isolates. Treatment with 20 mM N-acetyl-L-cysteine (ROS scavenger) significantly decreased the ROS level in the AmpB-treated sensitive parasites, confirming that the ROS is indeed induced by AmpB (data not shown) as reported previously [10,39]. A comparison of ROS levels and Fe–S protein activity observed under similar conditions clearly indicates a strong negative correlation between them, which is aptly supported by the fact that ROS can cause oxidative damage to Fe–S clusters and hence the resultant loss of Fe–S protein activity.

Fig. 5. AmpB treatment induces a ROS-mediated damage to Fe–S proteins in the sensitive strain. The percentage change in specific activity of total aconitase (A) and succinate dehydrogenase (B) after AmpB treatment in the sensitive strain (S) and resistant isolates (R1 and R2). Sensitive strain shows significant decrease in marker Fe–S protein activity on AmpB treatment as compared to resistant isolates. S, R1, and R2 indicate untreated parasites and S (D), R1 (D), and R2 (D) indicate AmpBtreated strain/isolates. Data are expressed as means7 SEM of three independent experiments. n P o0.05; ns, nonsignificant (Student’s t test using GraphPad Prism 6). (C) AmpB induces significantly higher ROS in the sensitive strain as compared to either of the resistant isolates. Untreated parasites and AmpB-treated parasites were incubated with 20 mM H2DCFDA and analyzed by spectrofluorimetry. Representative data from three independent experiments are shown. (n Po 0.05; nn P o 0.01; nnn Po 0.001; ns, nonsignificant by Student’s t test using GraphPad Prism 6.).

The sensitive strain shows higher CDES activity than resistant isolates in both logarithmic and stationary stages of growth Leishmania has a digenetic life cycle and many genes are differentially expressed and/or regulated depending on the growth

204

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

followed by its densitometry analysis with bands normalized to myosin 21 used as a loading control. As expected, LdIscS-GFP protein induction correlated well with mean fluorescence intensity changes observed by FACS analysis and a dose-dependent increase in the relative band intensity of LdIscS-GFP (Fig. 7E, F) was evident with all three ROS inducers except at a high dose of menadione (7.5 mM). Furthermore, endogenous LdIscS (Fig. 7E and G) also showed an overall similar pattern of induction as LdIscSGFP, although the magnitude of induction was highest on H2O2 treatment as compared to other ROS inducers. So, altogether the results provide conclusive evidence of a ROS-regulated IscS expression in L. donovani parasites.

Discussion Fig. 6. Stationary phase (infective stage) promastigotes have higher cysteine desulfurase activity than logarithmic phase promastigotes irrespective of strain sensitivity. The percentage change in cysteine desulfurase specific activity in logarithmic (log) vs stationary (stat) stage of growth is higher in the sensitive strain (S) as compared to the resistant isolates (R1 and R2). Data are expressed as means 7 SEM of three independent experiments. (nn Po 0.01 by Student’s t test using GraphPad Prism 6.).

stage of the parasite. To check any growth stage-specific variations in the expression level of LdIscS in sensitive and resistant isolates, CDES assay was performed with total lysate of logarithmic or stationary phase promastigotes of both sensitive and resistant isolates. As shown in Fig. 6, a slightly higher CDES activity was observed in the stationary stage as compared to logarithmic stage promastigotes irrespective of the strain/isolates sensitivity, which was significant only for the sensitive strain (P ¼0.0025). Furthermore, the sensitive strain showed a consistently higher CDES activity in both the logarithmic and the stationary stage as compared to either of the resistant isolates of respective stage. Additionally, the results also show that stage-specific variations in LdIscS expression are not responsible for our preceding results (this study). ROS induces LdIscS-GFP expression in a dose-dependent manner To check whether the observed modulation of LdIscS expression on AmpB treatment is a general mechanism for LdIscS expression regulation in response to ROS, LdIscS-GFP overexpressing sensitive strain parasites were treated with various doses of different ROS inducers: H2O2, menadione, and AmpB, for 4 h. Fluorescence microscopic analysis of treated parasites (Fig. 7A) showed a visible dose-dependent induction of LdIscS-GFP with H2O2 and AmpB, whereas with menadione, the induction decreased at the highest dose of 7.5 mM. FACS analysis of the same samples showed a similar pattern of dose-dependent induction, as shown by the histogram overlay plots (Fig. 7B) of parasites after each treatment and deduced percentage change in mean fluorescence intensity of the treated parasites as compared to the uninduced ones, with G418 (100 mg/ml)-treated parasites serving as a positive control (Fig. 7D). Notably, the magnitude of induction observed with either ROS inducer was higher than G418 (positive control), being highest with AmpB. The dot plots shown in Fig. 7C illustrate a significant decrease in the negative population (lower left quadrant of each plots) from 12.1% in the uninduced parasites to 3.3, 4.5, and 2.7% in parasites treated with 50 mM H2O2, 5 mM menadione, and 30 ng/ml AmpB, respectively, the doses corresponding to maximum increase in mean fluorescence intensity observed with each ROS inducer. Further, to correlate the observed fluorescence changes with LdIscS-GFP protein induction as well as to check the effect on endogenous LdIscS protein expression, immunoblot of the posttreatment parasite lysate with anti-LdIscS sera was performed,

Previously, we reported the presence of all the components of a classical eukaryotic prototype ISC system for mitochondrial Fe–S cluster biogenesis in Leishmania [30]. In this study, we characterized one of its major component LdIscS which is present as a single homolog and predominantly localized in the mitochondrion of L. donovani promastigotes. We observed an upregulated LdIscS expression despite lower Fe–S protein activity in the sensitive strain as compared to AmpB-resistant isolates of L. donovani and demonstrated that the net ROS level in Leishmania is one of the key determinants of LdIscS expression probably mediated by the oxidatively labile Fe–S clusters of Fe–S proteins. Furthermore, our results provide the first direct evidence of a ROS-regulated mechanism of LdIscS expression in this protozoan parasite. As reported previously for the related trypanosomatid parasite T. brucei [31], L. donovani genome also encodes two IscS/NifS-like proteins, LdIscS and LdSCL, among which LdIscS is the genuine IscS/Nfs homolog of ISC system, whereas LdSCL is the putative selenocysteine lyase homolog which had been previously shown to form a clade with eukaryotic SCL homologs including TbSCL in the deduced phylogenetic tree indicating its functional conservation [36]. Since, both LdIscS and LdSCL belong to the IscS/Nfs-like group of proteins which have characteristic CDES activity [52,53], LdSCL is also expected to have CDES activity as reported previously for TbSCL, although the later has been shown to be dispensable under in vitro culture conditions [36]. Nevertheless, we used antiLdIscS immunoblot in addition to CDES assay to ensure prompt reflection of qualitative as well as quantitative variations in LdIscS protein. Higher intracellular iron content and upregulated Fe–S protein activity were observed in both of our AmpB-resistant isolates, R1 and R2, associated with a downregulated LdIscS (Fig. 3). A similar observation was previously reported [38] for vinblastine-resistant L. enrietti promastigotes where the drug resistance was shown to be associated with an upregulated aconitase activity and a higher intracellular iron content, but these authors did not investigate the role of the ISC pathway. So, it remains to be determined whether L. enrietti and other species of Leishmania, which differ significantly in their geographical distribution and clinical manifestation, show a similar association as observed in this study on L. donovani. Also, Wong and Chow [38] had considered aconitase activity as an indirect indicator of intracellular iron content, assuming an eukaryotic mechanism of IRP/IRE-based iron regulatory mechanism in Leishmania rather than it being a Fe–S protein. However, to our knowledge, this mechanism has not been elucidated in Leishmania, whereas in T. brucei, a closely related trypanosomatid, this mechanism has been reported to be nonfunctional [54]. The negative correlation observed between ROS level and Fe–S protein (aconitase or succinate dehydrogenase) activity in L. donovani aptly justifies the use of the later as a functional indicator of intracellular ROS levels sensed by the oxidative lability of their

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

205

Fig. 7. ROS induces dose-dependent LdIscS-GFP as well as endogenous LdIscS expression in the sensitive strain of L. donovani. G418 selected LdIscS-GFP overexpressing promastigotes were cultured without G418 for at least 7–8 generations until the fluorescence intensity reduced to less than 50% (termed uninduced parasites). Numbers of 1  106 cells/ml were treated with different doses of ROS inducers 10, 20, and 50 mM H2O2 (H10, H20, and H50, respectively); 1.0, 2.5, and 7.5 mM menadione (M1, M2.5, and M7.5, respectively); and 1, 10, and 30 ng/ml AmpB (A1, A10, and A30, respectively). Data acquisition and analysis were performed using a FACSCalibur flow cytometer (equipped with the Cell Quest software). A total of 10,000 events were acquired in the regions previously established as those corresponding to parasites. The experiments were performed thrice and only one representative result is shown here. (A) A fluorescence microscopy image of each treated parasites. (B) The histogram overlay plots obtained after FACS analysis of treated parasites. For H2O2, black, blue and yellow lines represent H10, H20, and H50, respectively; menadione, black, blue, and yellow lines represent M1, M2.5, and M7.5, respectively; AmpB, black, green, and pink lines represent A1, A10, and A30, respectively. (C) The FACS analysis dot plots of a selected dose of each inducer (H50, M2.5, and A30) which displayed maximum induction are shown for comparison along with uninduced parasites (negative) and 100 mg/ml G418-treated uninduced parasites (G418, positive control). The percentage of gated cells found in the previously demarcated negative quadrant (lower left quadrant of each plot) is depicted for each plot. (D) A histogram graph showing percentage change in mean fluorescence intensity of gated parasites following treatment as compared to uninduced control is shown. þ ve (G418), positive control, uninduced parasites treated with 100 mg/ml G418. (E) Immunoblot of parasite lysates after each treatment probed with polyclonal anti-IscS sera and anti-myosin 21 (116 kDa, upper panel) as loading control. Both IscS-GFP (  73 kDa, middle panel) and endogenous IscS (  47 kDa, lowest panel) are recognized by anti-IscS sera. (E and F) Densitometry analysis of IscS-GFP (E) and endogenous IscS (F) bands normalized to loading control myosin 21 using ImageJ tool. The relative intensity of bands corresponding to different doses of each inducer is expressed relative to band corresponding to minimum dose for each inducer, the minimum dose of each inducer corresponding to one.

206

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

Fig. 7. (continued)

Fe–S clusters as reported previously [55–58]. Furthermore, ISC and heme biosynthesis pathways are the major consumers of mitochondrial iron that also maintains iron homeostasis in most eukaryotes [14,59,60]. Since Leishmania lacks a complete heme

biosynthetic pathway [61], the ISC system may be the major determinant of iron homeostasis. Intracellular iron deficiency has been associated with increased ROS generation and a highly oxidative cellular state [62] along with a dysfunctional respiratory

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

chain due to loss of Fe–S clusters [63], conditions almost replicating our observations in the sensitive strain. In this context, the upregulated LdIscS in the sensitive strain may be the synergistic effect of all the above noted parameters; an upregulated ISC system for iron homeostasis as well as for de novo synthesis or repair of ROS damaged Fe–S clusters. The sublethal dose AmpB treatment induced a 2-fold upregulation in LdIscS expression in the sensitive strain only (Fig. 4) which is intriguing given the magnitude of variation and its dependence on strain sensitivity. The underlying mechanism is explained by the upregulated thiol redox metabolism and hence the resultant lower ROS level in resistant isolates as compared to the sensitive strain. Several proteins of the thiol metabolic pathway, viz. trypanothione synthetase, trypanothione reductase, tryparedoxin peroxidase, etc. were previously reported to be upregulated in AmpB-resistant isolates [6,10,39] accounting for their net lower ROS level (this study) as compared to the sensitive strain. Thus, a higher ROS induced by AmpB in the sensitive strain is responsible for lower Fe–S protein activity as well as upregulation of LdIscS expression in the sensitive strain, whereas resistant isolates adaptively neutralizes the effect of AmpB by thiol-based scavenging of ROS generated on AmpB treatment. Whether ROS directly initiates a signaling mechanism for LdIscS expression or ROS damaged Fe–S clusters/proteins induce LdIscS expression cannot be ascertained here because a concomitantly decreased Fe–S protein activity was also observed in the AmpB-treated sensitive strain (Fig. 5). It is plausible that the iron released from damaged clusters can enter Fenton’s reaction to generate ROS which in turn may signal LdIscS expression for homeostasis (repair/de novo synthesis) of Fe–S clusters. Nevertheless, our results highlight the complex interplay between the ISC pathway and the thiol metabolic pathway in maintaining cellular homeostasis as well as imparting AmpB resistance in L. donovani. As expected by the presence of a putative N-terminal mitochondrial targeting sequence, the differential digitonin fractionation analysis using anti-LdIscS antibodies as well as fluorescence microscopy of LdIscS-GFP overexpressing parasites (Fig. 2) revealed the predominant mitochondrial localization of LdIscS in L. donovani, as previously reported in related kinetoplastid T. brucei [31] as well as other higher eukaryotes, yeast [64], and mammals [65]. Even in amitochondriate parasitic protozoans, IscS was shown to be localized in the mitochondrion-related hydrogenosomes and mitosomes of the T. vaginalis and G. intestinalis, respectively [66–68]. However, studies on human cells and S. cereviseae IscS homologs (Nfs1) had confirmed an additional localization of IscS in the nucleus and/or cytosol [16,69]. Recently, T. brucei IscS was also shown to be localized in the nucleolar compartment [37], whereas a dual localization of TbIscS was suggested based on RNAi depletion studies of TbSCL [36]. Although L. donovani IscS possess nuclear localization sequence, we were unable to detect LdIscS in nuclear or cytosolic compartments of the parasite by immunofluorescence which may be due to extremely low abundance of LdIscS in these compartments below the detection limit aptly termed as eclipsed distribution [69]. Additionally, the mitochondrial localization of LdIscS further confirmed it as a IscS/ NifS homolog of the ISC system of L. donovani rather than LdSCL because LdSCL lacks a mitochondrial targeting sequence (data not shown). In closely related trypanosomatid T. brucei, TbSCL has been previously shown to be localized in cytoplasm and nucleus [36]. The stationary phase of L. donovani is a stage of differentiation into infective metacyclics accompanied by metabolic adjustments and phenotypic changes as a preadaptation for survival in its new microenvironment postinfection. In this context, the marginally upregulated cysteine desulfurase activity observed during this stage (Fig. 6), irrespective of strain sensitivity, may represent an upregulated ISC machinery postulated to be required for maturation of Fe–S proteins associated with upregulated mitochondrial respiration and energy metabolism in the stationary phase of

207

growth [70] as well as the intracellular amastigotes stage [71–73]. A similar upregulation of ISC machinery was recently reported during transformation of T. brucei from the blood stream to the procyclic stage for serving the high energy demands [74]. Intriguingly, ROS is an inevitable by-product of energy metabolism [75,76] that may be responsible for induced LdIscS expression observed in the above noted stages, either by direct signaling or mediated by ROS damaged Fe–S clusters of Fe–S proteins, with a certain role of upregulated thiol metabolism observed during these stages [70] in regulating ROS and hence LdIscS expression. The direct evidence of a ROS-based signaling mechanism for LdIscS expression is provided by coherent and congruent induction of LdIscS-GFP as well as endogenous LdIscS in the sensitive strain of L. donovani, by various ROS inducers including AmpB (Fig. 7). The coupled LdIscS-GFP as well as endogenous LdIscS analysis gives insight into both forms of IscS in the LdIscS-GFP transfected wild-type parasite, essential for prompt reflection of the overall effect of each dose of either ROS inducers. The dosedependent induction with either of the inducers correlated well with each other at physiological low doses, whereas a decrease in LdIscS-GFP as well as endogenous LdIscS expression was observed at 7.5 mM menadione, probably due to poisoning of adaptive SOS machinery of the parasite by the intoxicating amount of ROS generated at such a high dose [77]. However, the magnitude of induction varied with each inducer, probably due to different types of reactive species generated: peroxide by H2O2, superoxide by menadione, and ROS by AmpB. The mechanism of action of AmpB has been proposed to be multifactorial [10] and involvement of other factor/s apart from ROS cannot be ruled out. Earlier, the E. coli ISC system has been reported to be inactivated by H2O2 treatment with the SUF system replacing its functions for de novo Fe–S cluster assembly under oxidative stress, although the ISC system is essential for cluster repair under similar conditions. The inactivation of the ISC system was proposed to be mediated through damage to nascent Fe–S clusters on IscU or transsulfuration intermediates [78,79]. Nevertheless, E. coli has alternative SUF machinery specialized for Fe–S cluster assembly under oxidative stress conditions. But Leishmania has only the ISC system and lacks an alternative SUF system, analogous to most other eukaryotes. So, the repair as well as de novo synthesis of Fe–S clusters, either under normal or oxidative stress conditions, must be performed by the ISC system with precise regulation of its components. Our results strongly suggest a role of ROS (endogenous or exogenous) as signaling molecules for regulation of LdIscS expression with Fe–S clusters acting as sensors, supported by the fact that Fe–S proteins are required for maintaining various essential functions in eukaryotes specially energy generation. Hence, minimizing the ROS-mediated damage to Fe–S proteins by upregulating the LdIscS, either for repair or de novo synthesis of clusters, would be a prime adaptive response to oxidative stress in this unique protozoan parasite. This is supported by a previous report [78] that a decrease in the rate of Fe–S cluster inactivation by H2O2 was observed on overexpression of the ISC system in E. coli. Additionally, in the context of the Leishmania life cycle, a picture emerges where ROS induces LdIscS as well as an infective amastigote stage [13], suggesting an important role of LdIscS in virulence and survival (adaptation) of amastigotes, although a thorough investigation impedes this justification. In conclusion, our study provides insight into the mechanism of ROS-based signaling for LdIscS expression in an evolving pathogen model, having unique thiol-based ROS regulation machinery and adaptation capabilities. The complex intertwinement of LdIscS expression with redox metabolism, drug sensitivity, and growth stage reveals the complex biology of this yet poorly characterized parasite. Whether our findings represent a general mechanism of IscS regulation in other organisms remains to be explored.

208

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209

Acknowledgments This work was supported by a grant from Indian Council of Medical Research (ICMR), Ministry of Health and Family Welfare, and Department of Science and Technology (DST/INT/JSPSP-117), New Delhi, India. We extend our sincere thanks to Prof. S.M. Beverley, Department of Molecular Microbiology, Washington University School of Medicine, for providing pXG-GFP þ vector. We also thank Dr. C.M. Gupta and Dr. Amogh A. Sahasrabuddhe, Laboratory of Structural Biology, CDRI, Lucknow, India, for the kind gift of anti-LdActin and anti-Ldmyosin 21 antibodies. K. P. Singh (DST INSPIRE SRF-P), Amir Zaidi (CSIR-SRF), and Shadab Anwar (DBT-SRF) acknowledge the financial assistance in the form of fellowship support from DST, CSIR, and DBT New Delhi, India. The authors declared no conflicts of interest.

References [1] W.H.O. World Health Organization control of the Leishmaniases. World Health Org. Tech. Rep. Ser. Xii-Xiii:1–186; 2010. [2] Bates, P. A.; Rogers, M. E. New insights into the developmental biology and transmission mechanisms of Leishmania. Curr. Mol. Med. 4:601–609; 2004. [3] Santos, D. O.; Coutinho, C. E.; Madeira, M. F.; Bottino, C. G.; Vieira, R. T.; Nascimento, S. B.; Bernardino, A.; Bourguignon, S. C.; Corte-Real, S.; Pinho, R. T.; Rodrigues, C. R.; Castro, H. C. Leishmaniasis treatment—a challenge that remains: a review. Parasitol. Res. 103:1–10; 2008. [4] Krauth-Siegel, R. L.; Comini, M. A. Redox control in trypanosomatids, parasitic protozoa with trypanothione-based thiol metabolism. Biochim. Biophys. Acta 1780:1236–1248; 2008. [5] Bhardwaj, S.; Srivastava, N.; Sudan, R.; Saha, B. Leishmania interferes with host cell signaling to devise a survival strategy. J. Biomed. Biotechnol. 2010:109189; 2010. [6] Moreira, W.; Leprohon, P.; Ouellette, M. Tolerance to drug-induced cell death favours the acquisition of multidrug resistance in Leishmania. Cell Death Dis. 2:e201; 2011. [7] Rijal, S.; Chappuis, F.; Singh, R.; Bovier, P. A.; Acharya, P.; Karki, B. M.; Das, M. L.; Desjeux, P.; Loutan, L.; Koirala, S. Treatment of visceral leishmaniasis in south-eastern Nepal: decreasing efficacy of sodium stibogluconate and need for a policy to limit further decline. Trans. R. Soc. Trop. Med. Hyg. 97:350–354; 2003. [8] Sundar, S.; More, D. K.; Singh, M. K.; Singh, V. P.; Sharma, S.; Makharia, A.; Kumar, P. C.; Murray, H. W. Failure of pentavalent antimony in visceral leishmaniasis in India: report from the center of the Indian epidemic. Clin. Infect. Dis. 31:1104–1107; 2000. [9] Sinha, P. K.; Ranjan, A.; Singh, V. P.; Das, V. N.; Pandey, K.; Kumar, N.; Verma, N.; Lal, C. S.; Sur, D.; Manna, B.; Bhattacharya, S. K. Visceral leishmaniasis (kala-azar)—the Bihar (India) perspective. J. Infect. 53:60–64; 2006. [10] Purkait, B.; Kumar, A.; Nandi, N.; Sardar, A. H.; Das, S.; Kumar, S.; Pandey, K.; Ravidas, V.; Kumar, M.; De, T.; Singh, D.; Das, P. Mechanism of amphotericin B resistance in clinical isolates of Leishmania donovani. Antimicrob. Agents Chemother. 56:1031–1041; 2012. [11] D'Autreaux, B.; Toledano, M. B. ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell. Biol. 8:813–824; 2007. [12] Fialkow, L.; Chan, C. K.; Rotin, D.; Grinstein, S.; Downey, G. P. Activation of the mitogen-activated protein kinase signaling pathway in neutrophils. Role of oxidants. J. Biol. Chem. 269:31234–31242; 1994. [13] Mittra, B.; Cortez, M.; Haydock, A.; Ramasamy, G.; Myler, P. J.; Andrews, N. W. Iron uptake controls the generation of Leishmania infective forms through regulation of ROS levels. J. Exp. Med. 210:401–416; 2013. [14] Lill, R. Function and biogenesis of iron-sulphur proteins. Nature 460:831–838; 2009. [15] Flint, D. H. Escherichia coli contains a protein that is homologous in function and N-terminal sequence to the protein encoded by the nifS gene of Azotobacter vinelandii and that can participate in the synthesis of the Fe–S cluster of dihydroxy-acid dehydratase. J. Biol. Chem. 271:16068–16074; 1996. [16] Muhlenhoff, U.; Balk, J.; Richhardt, N.; Kaiser, J. T.; Sipos, K.; Kispal, G.; Lill, R. Functional characterization of the eukaryotic cysteine desulfurase Nfs1p from Saccharomyces cerevisiae. J. Biol. Chem. 279:36906–36915; 2004. [17] Pandey, A.; Golla, R.; Yoon, H.; Dancis, A.; Pain, D. Persulfide formation on mitochondrial cysteine desulfurase: enzyme activation by a eukaryote-specific interacting protein and Fe–S cluster synthesis. Biochem. J. 448:171–187; 2012. [18] Cupp-Vickery, J. R.; Urbina, H.; Vickery, L. E. Crystal structure of IscS, a cysteine desulfurase from Escherichia coli. J. Mol. Biol. 330:1049–1059; 2003. [19] Shi, R.; Proteau, A.; Villarroya, M.; Moukadiri, I.; Zhang, L.; Trempe, J. F.; Matte, A.; Armengod, M. E.; Cygler, M. Structural basis for Fe–S cluster assembly and tRNA thiolation mediated by IscS protein-protein interactions. PLoS Biol. 8: e1000354; 2010.

[20] Kaiser, J. T.; Clausen, T.; Bourenkow, G. P.; Bartunik, H. D.; Steinbacher, S.; Huber, R. Crystal structure of a NifS-like protein from Thermotoga maritima: implications for iron sulphur cluster assembly. J. Mol. Biol. 297:451–464; 2000. [21] Kessler, D. Enzymatic activation of sulfur for incorporation into biomolecules in prokaryotes. FEMS Microbiol. Rev. 30:825–840; 2006. [22] Zhang, W.; Urban, A.; Mihara, H.; Leimkuhler, S.; Kurihara, T.; Esaki, N. IscS functions as a primary sulfur-donating enzyme by interacting specifically with MoeB and MoaD in the biosynthesis of molybdopterin in Escherichia coli. J. Biol. Chem. 285:2302–2308; 2010. [23] Tachezy, J.; Sanchez, L. B.; Muller, M. Mitochondrial type iron–sulfur cluster assembly in the amitochondriate eukaryotes Trichomonas vaginalis and Giardia intestinalis, as indicated by the phylogeny of IscS. Mol. Biol. Evol. 18:1919–1928; 2001. [24] Carlton, J. M.; Hirt, R. P.; Silva, J. C.; Delcher, A. L.; Schatz, M.; Zhao, Q.; Wortman, J. R.; Bidwell, S. L.; Alsmark, U. C.; Besteiro, S.; Sicheritz-Ponten, T.; Noel, C. J.; Dacks, J. B.; Foster, P. G.; Simillion, C.; Van de Peer, Y.; MirandaSaavedra, D.; Barton, G. J.; Westrop, G. D.; Muller, S.; Dessi, D.; Fiori, P. L.; Ren, Q.; Paulsen, I.; Zhang, H.; Bastida-Corcuera, F. D.; Simoes-Barbosa, A.; Brown, M. T.; Hayes, R. D.; Mukherjee, M.; Okumura, C. Y.; Schneider, R.; Smith, A. J.; Vanacova, S.; Villalvazo, M.; Haas, B. J.; Pertea, M.; Feldblyum, T. V.; Utterback, T. R.; Shu, C. L.; Osoegawa, K.; de Jong, P. J.; Hrdy, I.; Horvathova, L.; Zubacova, Z.; Dolezal, P.; Malik, S. B.; Logsdon Jr. J. M.; Henze, K.; Gupta, A.; Wang, C. C.; Dunne, R. L.; Upcroft, J. A.; Upcroft, P.; White, O.; Salzberg, S. L.; Tang, P.; Chiu, C. H.; Lee, Y. S.; Embley, T. M.; Coombs, G. H.; Mottram, J. C.; Tachezy, J.; FraserLiggett, C. M.; Johnson, P. J. Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis. Science 315:207–212; 2007. [25] LaGier, M. J.; Tachezy, J.; Stejskal, F.; Kutisova, K.; Keithly, J. S. Mitochondrialtype iron–sulfur cluster biosynthesis genes (IscS and IscU) in the apicomplexan Cryptosporidium parvum. Microbiology 149:3519–3530; 2003. [26] Tsaousis, A. D.; Ollagnier de Choudens, S.; Gentekaki, E.; Long, S.; Gaston, D.; Stechmann, A.; Vinella, D.; Py, B.; Fontecave, M.; Barras, F.; Lukes, J.; Roger, A. J. Evolution of Fe/S cluster biogenesis in the anaerobic parasite Blastocystis. Proc. Natl. Acad. Sci. USA 109:10426–10431; 2012. [27] Wilson, R. J. Progress with parasite plastids. J. Mol. Biol. 319:257–274; 2002. [28] Seeber, F. Biogenesis of iron-sulphur clusters in amitochondriate and apicomplexan protists. Int. J. Parasitol. 32:1207–1217; 2002. [29] Ali, V.; Hashimoto, T.; Shigeta, Y.; Nozaki, T. Molecular and biochemical characterization of D-phosphoglycerate dehydrogenase from Entamoeba histolytica. A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways. Eur. J. Biochem. 271:2670–2681; 2004. [30] Ali, V.; Nozaki, T. Iron-sulphur clusters, their biosynthesis, and biological functions in protozoan parasites. Adv. Parasitol. 83:1–92; 2013. [31] Smid, O.; Horakova, E.; Vilimova, V.; Hrdy, I.; Cammack, R.; Horvath, A.; Lukes, J.; Tachezy, J. Knock-downs of iron–sulfur cluster assembly proteins IscS and IscU down-regulate the active mitochondrion of procyclic Trypanosoma brucei. J. Biol. Chem. 281:28679–28686; 2006. [32] Long, S.; Jirku, M.; Ayala, F. J.; Lukes, J. Mitochondrial localization of human frataxin is necessary but processing is not for rescuing frataxin deficiency in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 105:13468–13473; 2008. [33] Long, S.; Vavrova, Z.; Lukes, J. The import and function of diatom and plant frataxins in the mitochondrion of Trypanosoma brucei. Mol. Biochem. Parasitol. 162:100–104; 2008. [34] Long, S.; Changmai, P.; Tsaousis, A. D.; Skalicky, T.; Verner, Z.; Wen, Y. Z.; Roger, A. J.; Lukes, J. Stage-specific requirement for Isa1 and Isa2 proteins in the mitochondrion of Trypanosoma brucei and heterologous rescue by human and Blastocystis orthologues. Mol. Microbiol. 81:1403–1418; 2011. [35] Paris, Z.; Changmai, P.; Rubio, M. A.; Zikova, A.; Stuart, K. D.; Alfonzo, J. D.; Lukes, J. The Fe/S cluster assembly protein Isd11 is essential for tRNA thiolation in Trypanosoma brucei. J. Biol. Chem. 285:22394–22402; 2010. [36] Poliak, P.; Van Hoewyk, D.; Obornik, M.; Zikova, A.; Stuart, K. D.; Tachezy, J.; Pilon, M.; Lukes, J. Functions and cellular localization of cysteine desulfurase and selenocysteine lyase in Trypanosoma brucei. FEBS J. 277:383–393; 2010. [37] Kovarova, J.; Horakova, E.; Changmai, P.; Vancova, M.; Lukes, J. Mitochondrial and nucleolar localization of cysteine desulfurase Nfs and the scaffold protein Isu in Trypanosoma brucei. Eukaryot. Cell 13:353–362; 2014. [38] Wong, I. L.; Chow, L. M. The role of Leishmania enriettii multidrug resistance protein 1 (LeMDR1) in mediating drug resistance is iron-dependent. Mol. Biochem. Parasitol. 150:278–287; 2006. [39] Equbal, A.; Suman, S. S.; Anwar, S.; Singh, K. P.; Zaidi, A.; Sardar, A. H.; Das, P.; Ali, V. Stage-dependent expression and up-regulation of trypanothione synthetase in amphotericin B resistant Leishmania donovani. PLoS One 9: e97600; 2014. [40] Ali, V.; Shigeta, Y.; Tokumoto, U.; Takahashi, Y.; Nozaki, T. An intestinal parasitic protist, Entamoeba histolytica, possesses a non-redundant nitrogen fixation-like system for iron-sulfur cluster assembly under anaerobic conditions. J. Biol. Chem. 279:16863–16874; 2004. [41] Hausler, T.; Stierhof, Y. D.; Blattner, J.; Clayton, C. Conservation of mitochondrial targeting sequence function in mitochondrial and hydrogenosomal proteins from the early-branching eukaryotes Crithidia, Trypanosoma and Trichomonas. Eur. J. Cell Biol. 73:240–251; 1997. [42] Saas, J.; Ziegelbauer, K.; von Haeseler, A.; Fast, B.; Boshart, M. A developmentally regulated aconitase related to iron-regulatory protein-1 is localized in the cytoplasm and in the mitochondrion of Trypanosoma brucei. J. Biol. Chem. 275:2745–2755; 2000.

K. Pratap Singh et al. / Free Radical Biology and Medicine 75 (2014) 195–209 [43] Ha, D. S.; Schwarz, J. K.; Turco, S. J.; Beverley, S. M. Use of the green fluorescent protein as a marker in transfected Leishmania. Mol. Biochem. Parasitol. 77:57–64; 1996. [44] Beverley, S. M.; Clayton, C. E. Transfection of Leishmania and Trypanosoma brucei by electroporation. Methods Mol. Biol. 21:333–348; 1993. [45] Overath, P.; Czichos, J.; Haas, C. The effect of citrate/cis-aconitate on oxidative metabolism during transformation of Trypanosoma brucei. Eur. J. Biochem. 160:175–182; 1986. [46] Flint, D. H.; Tuminello, J. F.; Miller, T. J. Studies on the synthesis of the Fe-S cluster of dihydroxy-acid dehydratase in Escherichia coli crude extract. Isolation of O-acetylserine sulfhydrylases A and B and beta-cystathionase based on their ability to mobilize sulfur from cysteine and to participate in Fe–S cluster synthesis. J. Biol. Chem. 271:16053–16067; 1996. [47] Fasler, B.; Lowenstein, J. M. Aconitase from pig heart. Methods Enzymol. 13:26–30; 1969. [48] Hanstein, W. G.; Davis, K. A.; Ghalambor, M. A.; Hatefi, Y. Succinate dehydrogenase. II. Enzymatic properties. Biochemistry 10:2517–2524; 1971. [49] Fonseca-Silva, F.; Inacio, J. D.; Canto-Cavalheiro, M. M.; Almeida-Amaral, E. E. Reactive oxygen species production and mitochondrial dysfunction contribute to quercetin induced death in Leishmania amazonensis. PLoS One 6:e14666; 2011. [50] Castro, H.; Sousa, C.; Novais, M.; Santos, M.; Budde, H.; Cordeiro-da-Silva, A.; Flohe, L.; Tomas, A. M. Two linked genes of Leishmania infantum encode tryparedoxins localised to cytosol and mitochondrion. Mol. Biochem. Parasitol. 136:137–147; 2004. [51] Marelja, Z.; Mullick Chowdhury, M.; Dosche, C.; Hille, C.; Baumann, O.; Lohmannsroben, H. G.; Leimkuhler, S. The L-cysteine desulfurase NFS1 is localized in the cytosol where it provides the sulfur for molybdenum cofactor biosynthesis in humans. PLoS One 8:e60869; 2013. [52] Mihara, H.; Kurihara, T.; Yoshimura, T.; Soda, K.; Esaki, N. Cysteine sulfinate desulfinase, a NIFS-like protein of Escherichia coli with selenocysteine lyase and cysteine desulfurase activities. Gene cloning, purification, and characterization of a novel pyridoxal enzyme. J. Biol. Chem. 272:22417–22424; 1997. [53] Mihara, H.; Esaki, N. Bacterial cysteine desulfurases: their function and mechanisms. Appl. Microbiol. Biotechnol. 60:12–23; 2002. [54] Fast, B.; Kremp, K.; Boshart, M.; Steverding, D. Iron-dependent regulation of transferrin receptor expression in Trypanosoma brucei. Biochem. J. 342(Pt 3):691– 696; 1999. [55] Lill, R.; Muhlenhoff, U. Maturation of iron–sulfur proteins in eukaryotes: mechanisms, connected processes, and diseases. Annu. Rev. Biochem. 77:669–700; 2008. [56] Rouault, T. A.; Klausner, R. D. Iron–sulfur clusters as biosensors of oxidants and iron. Trends Biochem. Sci. 21:174–177; 1996. [57] Fleischhacker, A. S.; Kiley, P. J. Iron-containing transcription factors and their roles as sensors. Curr. Opin. Chem. Biol. 15:335–341; 2011. [58] Basu Ball, W.; Kar, S.; Mukherjee, M.; Chande, A. G.; Mukhopadhyaya, R.; Das, P. K. Uncoupling protein 2 negatively regulates mitochondrial reactive oxygen species generation and induces phosphatase-mediated anti-inflammatory response in experimental visceral leishmaniasis. J. Immunol. 187:1322–1332; 2011. [59] Richardson, D. R.; Lane, D. J.; Becker, E. M.; Huang, M. L.; Whitnall, M.; Suryo Rahmanto, Y.; Sheftel, A. D.; Ponka, P. Mitochondrial iron trafficking and the integration of iron metabolism between the mitochondrion and cytosol. Proc. Natl. Acad. Sci. USA 107:10775–10782; 2010. [60] Adams, M. L.; Ostapiuk, I.; Grasso, J. A. The effects of inhibition of heme synthesis on the intracellular localization of iron in rat reticulocytes. Biochim. Biophys. Acta 1012:243–253; 1989. [61] Krishnamurthy, G.; Vikram, R.; Singh, S. B.; Patel, N.; Agarwal, S.; Mukhopadhyay, G.; Basu, S. K.; Mukhopadhyay, A. Hemoglobin receptor in Leishmania is

[62]

[63] [64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74] [75] [76]

[77]

[78]

[79]

209

a hexokinase located in the flagellar pocket. J. Biol. Chem. 280:5884–5891; 2005. Nagababu, E.; Gulyani, S.; Earley, C. J.; Cutler, R. G.; Mattson, M. P.; Rifkind, J. M. Iron-deficiency anaemia enhances red blood cell oxidative stress. Free Radic. Res. 42:824–829; 2008. Levi, S.; Rovida, E. The role of iron in mitochondrial function. Biochim. Biophys. Acta 1790:629–636; 2009. Kispal, G.; Csere, P.; Prohl, C.; Lill, R. The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins. EMBO J. 18:3981–3989; 1999. Land, T.; Rouault, T. A. Targeting of a human iron–sulfur cluster assembly enzyme, nifs, to different subcellular compartments is regulated through alternative AUG utilization. Mol. Cell 2:807–815; 1998. Sutak, R.; Dolezal, P.; Fiumera, H. L.; Hrdy, I.; Dancis, A.; Delgadillo-Correa, M.; Johnson, P. J.; Muller, M.; Tachezy, J. Mitochondrial-type assembly of FeS centers in the hydrogenosomes of the amitochondriate eukaryote Trichomonas vaginalis. Proc. Natl. Acad. Sci. USA 101:10368–10373; 2004. Tovar, J.; Leon-Avila, G.; Sanchez, L. B.; Sutak, R.; Tachezy, J.; Van Der Giezen, M.; Hernandez, M.; Muller, M.; Lucocq, J. M. Mitochondrial remnant organelles of Giardia function in iron-sulphur protein maturation. Nature 426:172–176; 2003. Dolezal, P.; Smid, O.; Rada, P.; Zubacova, Z.; Bursac, D.; Sutak, R.; Nebesarova, J.; Lithgow, T.; Tachezy, J. Giardia mitosomes and trichomonad hydrogenosomes share a common mode of protein targeting. Proc. Natl. Acad. Sci. USA 102:10924–10929; 2005. Naamati, A.; Regev-Rudzki, N.; Galperin, S.; Lill, R.; Pines, O. Dual targeting of Nfs1 and discovery of its novel processing enzyme, Icp55. J. Biol. Chem. 284:30200–30208; 2009. Berg, M.; Vanaerschot, M.; Jankevics, A.; Cuypers, B.; Maes, I.; Mukherjee, S.; Khanal, B.; Rijal, S.; Roy, S.; Opperdoes, F.; Breitling, R.; Dujardin, J. C. Metabolic adaptations of Leishmania donovani in relation to differentiation, drug resistance, and drug pressure. Mol. Microbiol. 90:428–442; 2013. Biyani, N.; Madhubala, R. Quantitative proteomic profiling of the promastigotes and the intracellular amastigotes of Leishmania donovani isolates identifies novel proteins having a role in Leishmania differentiation and intracellular survival. Biochim. Biophys. Acta 1824:1342–1350; 2012. Naderer, T.; Ellis, M. A.; Sernee, M. F.; De Souza, D. P.; Curtis, J.; Handman, E.; McConville, M. J. Virulence of Leishmania major in macrophages and mice requires the gluconeogenic enzyme fructose-1,6-bisphosphatase. Proc. Natl. Acad. Sci. USA 103:5502–5507; 2006. Tsigankov, P.; Gherardini, P. F.; Helmer-Citterich, M.; Zilberstein, D. What has proteomics taught us about Leishmania development? Parasitology 139:1146–1157; 2012. Alfonzo, J. D.; Lukes, J. Assembling Fe/S-clusters and modifying tRNAs: ancient co-factors meet ancient adaptors. Trends Parasitol. 27:235–238; 2011. Hamanaka, R. B.; Chandel, N. S. Mitochondrial reactive oxygen species regulate hypoxic signaling. Curr. Opin. Cell Biol. 21:894–899; 2009. Hamanaka, R. B.; Chandel, N. S. Mitochondrial reactive oxygen species regulate cellular signaling and dictate biological outcomes. Trends Biochem. Sci. 35:505–513; 2010. Sardar, A. H.; Kumar, S.; Kumar, A.; Purkait, B.; Das, S.; Sen, A.; Kumar, M.; Sinha, K. K.; Singh, D.; Equbal, A.; Ali, V.; Das, P. Proteome changes associated with Leishmania donovani promastigote adaptation to oxidative and nitrosative stresses. J. Proteomics 81:185–199; 2013. Jang, S.; Imlay, J. A. Hydrogen peroxide inactivates the Escherichia coli Isc ironsulphur assembly system, and OxyR induces the Suf system to compensate. Mol. Microbiol. 78:1448–1467; 2010. Dai, Y.; Outten, F. W. The E. coli SufS-SufE sulfur transfer system is more resistant to oxidative stress than IscS-IscU. FEBS Lett. 586:4016–4022; 2012.