- Email: [email protected]
Ready to use dry-reagent PCR assays for the four common bacterial pathogens using switchable lanthanide luminescence probe system
Journal of Microbiological Methods 118 (2015) 64–69
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Ready to use dry-reagent PCR assays for the four common bacterial pathogens using switchable lanthanide luminescence probe system A. Lehmusvuori a,⁎, M. Soikkeli a, E. Tuunainen a, T. Seppä a, A. Spangar a, K. Rantakokko-Jalava b, P. von Lode c, U. Karhunen a, T. Soukka a, S. Wittfooth a a b c
Department of Biochemistry/Biotechnology, University of Turku, 20520 Turku, Finland Clinical Microbiology Laboratory, Turku University Hospital, 20521 Turku, Finland Abacus Diagnostica Oy, 20520 Turku, Finland
a r t i c l e
i n f o
Article history: Received 27 October 2014 Received in revised form 27 August 2015 Accepted 27 August 2015 Available online 3 September 2015 Keywords: Dry-reagent PCR Switchable lanthanide luminescence Bacteria detection
a b s t r a c t Ready to use dry-reagent PCR assays for Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas spp. and for broad-range bacteria detection were developed. The assays were based on novel switchable lanthanide probes that provide sensitive target DNA detection with exceptionally high signal-to-background ratio, thus enabling clear discrimination between positive and negative results. For example, sensitivity of three S. aureus and two S. pneumonia bacteria (colony forming units) per PCR assay was measured with fluorescence signal more than 30 times over the background signal level. The rapid and easy-to-use assays are suitable for routine clinical diagnostics without molecular biology expertise and facilities. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The number of polymerase chain reaction (PCR) assays for the detection of human pathogens and drug resistance causing genes has increased significantly in recent years. PCR assays allow specific and sensitive detection of the target microbe by combining the precise DNA sequence-based detection to the powerful target nucleic acid amplification. Furthermore, real-time and other homogenous PCR assays provide a relatively rapid (less than 1 h) detection of infectious agents in clinical sample and can detect fastidious and uncultivable microbes. In clinical settings rapid and reliable pathogen detection enables fast initiation of the optimal treatment of infectious diseases and, therefore, can improve patient recovery and healthcare outcome (Deshpande and White, 2012; Maurin, 2012). Real-time PCR assays utilize fluorescence reporter technologies that are used for monitoring the amplified target DNA during the amplification reaction. Simultaneous DNA amplification and detection enable rapid and simple-to-use diagnosis that is performed in closed-tube without time-consuming post-PCR processing that requires separate facilities and hands-on laboratory expertise. Furthermore, homogenous closed-tube assays are preferred because of the extremely low risk of contamination of the facilities and thus, the following reactions by the amplified nucleic acids (Kubista, 2012). PCR assays have traditionally been relatively laborious and timeconsuming to perform because the reaction mixture has been ⁎ Corresponding author. E-mail address: artule@utu.fi (A. Lehmusvuori).
http://dx.doi.org/10.1016/j.mimet.2015.08.022 0167-7012/© 2015 Elsevier B.V. All rights reserved.
formulated by combining several reagents prior to testing. This has been found to be challenging in routine clinical diagnostics where easy-to-use and rapid assays are needed for cost-effective daily testing (Bravo et al., 2011; Mothershed and Whitney, 2006; Radstrom et al., 2004). To simplify nucleic acid amplification test procedure, dried PCR reagents have been used in different applications (Hirvonen et al., 2012a; Hirvonen et al., 2012b, Poritz et al., 2011; Raja et al., 2005; Tanriverdi et al., 2010). Dry-reagent closed-tube PCR assays are easy to use by adding the sample in an assay compatible solution making nucleic acid amplification testing possible in the clinics lacking molecular biology laboratory facilities and expertise. Many current dried reagents do not require cold storage and therefore facilitate delivery, storage and use of the assays also outside clinics and in resource poor settings (BioFire Defence, Cepheid). However, with clinical samples, such as urine, blood or sputum, DNA extraction is commonly used to remove PCR inhibitors and release DNA from the microbes. Here we describe for the first time closed-tube PCR assays based on dried switchable lanthanide luminescence probes for the detection of Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas spp. and also a broad-range bacteria detection assay. The switchable probe system involves two non-luminescent oligonucleotide probes, one carrying a lanthanide chelate and the other an organic antenna chromophore. Hybridization of the probes consecutively onto amplified target DNA leads to formation of a luminescent lanthanide chelate complex by self-assembly of the two reporter molecules. The long-lifetime luminescence of the lanthanide chelate complex is measured using time-resolved fluorescence (TRF) measurement mode that collects the signal after the short-lifetime fluorescence has decayed
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
and thus, decreases the background signal level (Karhunen et al., 2010; Lehmusvuori et al., 2012). All the assays also contained an internal amplification control (IAC) that was co-amplified and used to verify negative results. The assay principle is illustrated in Fig. 1. 2. Materials and methods 2.1. PCR target sequences The 16S ribosomal RNA plays essential role in translation of mRNA to protein. The 16S rRNA gene is universal in bacteria and it contains highly conservative sequence regions (Clarridge, 2004; Woese, 1987). Several broad-range PCR assays for pathogenic bacteria based on the 16S rRNA gene have been published (Rampini et al., 2011). Our broad-range bacteria PCR assay primers and probes were targeted to the conservative 16S rRNA gene region. Certain sites in the 16S rRNA show also variation between different bacteria and our amplicon contained also a mutated site which was utilized in the design of Pseudomonas genus bacteria specific probes. Therefore, the broad-range and Pseudomonas spp. PCR assays utilized same primer sequences and different probe sequences with an amplicon length of 236 nucleotides. Although the 16S rRNA gene contain variations, the E. coli, S. aureus and S. pneumoniae PCR assays were targeted to recognize different genes to ensure specificity. The DNA gyrase enzyme is found in bacteria and it has a critical role in DNA replication and gene expression as the enzyme is involved in the DNA supercoiling (Collin et al., 2011; Naughton et al., 2013). The DNA gyrase is made up of two A and two B subunits coded by the gyrA and gyrB genes. Due to relatively high genetic variation between different bacterial species the gyrB has been used previously in PCR assays for identification of pathogenic bacteria (Kim et al., 2013; Persson et al., 2015). We used gyrB gene for the detection of S. aureus and E. coli with PCR amplicon size of 139 and 137 nucleotides, respectively. N-acetylmuramoyl-L-alanine amidase is an autolysin enzyme that degrades peptidoglycan and is associated to the microorganism's cell wall synthesis (Whatmore and Dowson, 1999). The lytA gene of the S. pneumonia codes the autolysin enzyme and has been used as a PCR target gene. It has been shown that lytA targeted PCR is sensitive and specific and also able to distinguish S. pneumoniae from its close relative Streptococcus mitis (Greve and Moller, 2012). Our S. pneumoniae PCR assay was based on lytA gene and the primers amplified a 114 base pair amplicons.
65
2.2. Oligonucleotide primers and probes Oligonucleotide primer and probe sequences (Table 1) for E. coli, S. aureus, S. pneumoniae, Pseudomonas spp. and broad-range bacteria PCR assays were designed using sequence information from the GenBank of the National Center for Biotechnology Information (NCBI) (U.S. National Library of Medicine, MD, USA). The assays were designed to recognize the selected target gene variant (mentioned in Chapter 2.1) specific to the target bacteria species. Several variants of 16S rRNA (n = 119), gyrB (n = 157) and lytA (n = 34) genes from 22 sepsis causing bacteria were aligned (listed in Supplementary material) using Vector NTI software (Thermo). Oligonucleotide primer and probe sequences were manually designed using OligoAnalyzer 3.1 from the Integrated DNA Technologies (IA, USA) to identify the melting temperatures and secondary structures. Oligonucleotide sequence dimers were identified using Oligo Analyzer (Kuulasmaa, T., University of Kuopio, Finland). Furthermore, artificial internal amplification control primer, probe and target sequences were designed. Primer and probe specificities to the target microbes were revised by an in silico specificity screen using the Basic Local Alignment Search Tool (BLAST) at the NCBI website. The bacteria specific probes and IAC probes were labeled with switchable europium and terbium labels (Lehmusvuori et al., 2013), respectively, as described previously (Karhunen et al., 2010). Oligonucleotide probes and primers were purchased from the biomers.net (Germany) and Thermo Fisher Scientific (MA, USA), respectively, except the E. coli specific primers that were purchased from the Exiqon (Denmark). The synthetic ssDNA IAC PCR template was purchased from TAQ Copenhagen (Denmark). 2.3. Ready to use dry-reagent PCR assay chips Closed-tube duplex dry-reagent PCR assays for the detection of target bacteria (or broad-range bacteria) and IAC were prepared in the plastic GenomEra reaction chips (Nurmi et al., 2004) (Abacus Diagnostica Oy, Finland). The reagents were dispensed into the reaction chamber in three separated drops and dried as described previously (Korpimäki et al., 2004). The base reagents calculated for a 35 μL PCR reaction included Tris–HCl 10 mM (pH 8.3), Trehalose 25 g/L, NaN3 0.005%, BSA 1 g/L (Gemini, CA, USA) and dNTPs 400 μM (Larova, Germany). These reagents were divided into two aliquots. The following reagents were included into one portion: MgCl2 1.5 mM, IAC forward and reverse primers 250 nM, IAC Tb chelate probe 50 nM, broad-range
Fig. 1. Illustration of (A) the duplex PCR assay principle based on the switchable probes. The non-luminescent probes form a luminescent lanthanide chelate complex when hybridized to the amplified target DNA at the measurement temperature of 30 °C. Internal amplification control (IAC) is used to verify PCR functionality when no bacteria is observed. (B) The dry-reagent PCR chips (n = 4) are placed into the holder that is compatible with the GenomEra PCR thermocycler containing time-resolved fluorescence measurement unit.
66
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
Table 1 Oligonucleotide primer and probe sequences, and internal amplification control artificial single-stranded DNA template sequence. Oligonucleotide
Sequence 5′ to 3′
Gene
Broad-range primer 1a Broad-range primer 2a S. aureus primer 1 S. aureus primer 2 E. coli primer 1 E. coli primer 2 S. pneumoniae primer 1 S. pneumoniae primer 2 IAC primer 1 IAC primer 2 Broad-range EuIII probe mix
TCCTACGGGAGGCAGC CTTTACGCCCARTAAWTCCG GGTTCATCAGTTGTAAACGCAT TACCTGTCTTATCAGTTGTGCC GGTGTTTCGGTAGTAAACGCC CCGGTTTTTTCAGTCTCGCC ACGCAATCTAGCAGATGAAGCb TGGTCTGAGTGGTTGTTTGG CGACTTCAGGACCAACATCAGAC GTGTGCGCCGACGTCC CGGCTAACTCCGTGC CGGCTAACTTCGTGC CGGCTAACTACGTGC CGGCTAACTCTGTGC CCGCTAACTAAGTGC CAGCCGCGGTAATAC GAAGGGCAGTAAGTTAAT CCTTGCTGTTTTGACG CACAAGACTTAGAAGTATATG CACAGAAATGAGACTATATATC GGTAAAATTCACCGTCA CGAACACGGTGTACC GCTTGATACAGGGAGTT GGAATTAAAACGCACGAGTA GGTTCTAGTACGACAT CAGAGACATTCTTTAGA CCGACTTCAGGACCAACATCAGAC CCTCTTGCTAAGTTCTAAAGAATGT CTCTGTATGTCGTACTAGAACCTGC GGTGGATGGACGTCGGCGCACAC AGATT
16S rRNA 16S rRNA gyrB gyrB gyrB gyrB lytA lytA Artificial Artificial 16S rRNA
Broad-range antenna probe Pseudomonas spp. EuIII probe Pseudomonas spp. antenna probe S. aureus EuIII probe S. aureus antenna probe E. coli EuIII probe E. coli antenna probe S. pneumoniae EuIII probe S. pneumoniae antenna probe IAC TbIII probe IAC antenna probe IAC PCR template
16S rRNA 16S rRNA 16S rRNA gyrB gyrB gyrB gyrB lytA lytA Artificial Artificial Artificial
GenBank accession number and position AB269763 AB269763 AB084059 AB084059 AB083953 AB083953 AM113494 AM113494 – – AB269763 AF094719 AM980864 Z93435 AF076036 AB269763 AF094719 AF094719 AB084059 AB084059 AB083953 AB083953 AM113494 AM113494 – – –
332–347 548–567 41–62 158–179 41–61 158–177 478–498 572–591 – – 496–510 473–487 485–499 482–496 511–525 514–528 419–436 438–453 66–86 89–110 98–114 121–135 514–530 536–555 – – –
The lanthanide chelates (EuIII and TbIII) and antenna chromophores were attached to the oligonucleotide probes by the six-carbon amino modified linker located at the 3′-end of the EuIII and TbIII probes and 5′-end of the antenna probes. The antenna probes contained a 3′-terminal phosphate. a The broad-range primers were used in the broad-range bacteria and Pseudomonas spp. assays. b The S. pneumonia primer 1 sequence is identical to the sequence introduced by McAvin et al., 2001.
bacteria or one of the bacteria specific forward and reverse primers 500 nM and either 250 nM of broad-range bacteria EuIII probe mix (50 nM each of the five different probe sequences) or 150 nM of one of the target bacteria specific EuIII probe. In addition to the base reagents, the other aliquot also contained DTPA 30 μM, IAC antenna probe 50 nM, 5000 copies of IAC single stranded oligonucleotide target and 150 nM of broad-range antenna probe or one of the bacteria specific antenna probe, except 200 nM of E. coli antenna probe was used. Both reagent mixtures were dispensed and dried as separate drops into reaction chamber. A stabilized DNA polymerase containing 1 μL of Phire Hot Start II DNA polymerase (Thermo Fisher Scientific) was dried as a third drop into the reaction chamber. KCl (100 mM) was added with the sample when starting the reaction. 2.4. Specificity testing of the PCR assays Preliminary specificity of the E. coli, S. aureus, S. pneumonia and Pseudomonas spp. PCR assays, and sensitivity of the broad-range PCR assay were tested in 96-well PCR plate format without drying the reagents. Reactions contained same reagent compositions as the dry-reagent assays except the IAC reagents were not used and Phire Hot Start II DNA polymerase 0.8 μL/reaction was used. Similarly to the dry-reagent assays, 100 mM KCl was used in every reaction. DNA was extracted from 21 different sepsis causing bacteria (Table 2) by picking 3–5 colonies from plate cultures and using NucleoSpin Tissue Kit and extraction protocol from Macherey-Nagel (Germany). The concentration of the extracted DNA samples was determined by the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific). The PCR reactions contained 0 or 10,000 copies of the extracted genomic DNA and testing was performed using two parallel reactions. The thermal cycling was
performed with Bio-Rad C1000 touch thermal cycler (CA, USA) and it consisted of 150 s initial denaturation at 98 °C followed first by 10 cycles of 98 °C for 10 s, 62 °C for 15 s and 72 °C for 10 s and then 34 cycles of 98 °C for 10 s, 62 °C for 15 s or 25 °C for 35 s in every second cycle and 72 °C for 10 s. The europium fluorescence signal was measured using timeresolved mode (excitation 340 nm, emission 615 nm, delay 400 μs and counting time 400 μs) after 30 s incubation at the 25 °C with PerkinElmer Wallac Victor X4 multilabel plate reader (Finland). No template control (NTC) reactions of broad-range PCR assay were sequenced. The amplified DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Nerherlands). The sequencing was performed using the broad-range assay primers and ABI PRISM BigDye Terminator v3.1 Ready Reaction Cycle Sequencing Kit (Thermo Fisher Scientific, MA, USA) with Applied Biosystems 3130xl Genetic Analyzer (Thermo Fisher Scientific) at the Finnish Microarray and Sequencing Centre (Finland).
2.5. Evaluation of the dry-reagent PCR assays Liquid E. coli (ATCC 25922) and S. aureus (ATCC 29213) Brain Heart Infusion Broth cultures were incubated at +37 °C in 500 rpm shaking until the optical density at 600 nm (OD600 nm) reached the value of 0.5. The S. pneumoniae (ATCC 49619) was cultured in Brain Heart Infusion Broth in anaerobic conditions until OD600 nm value was 0.4. The cultures were centrifuged (2000 g, 2 min), supernatants were discarded and the bacteria pellets were suspended to phosphate buffered saline (PBS). Bacteria concentrations were determined by cultivating the bacteria solution in the Luria Agar (LA) plates except the S. pneumoniae that was cultivated in the Blood Agar plates in anaerobic conditions. Aliquots of the bacteria in PBS solution were complemented with 0.05% NaN3 to
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69 Table 2 Bacteria strains used for PCR assay testing. Bacteria strains originated from the American Type Culture Collection (ATCC) or Culture Collection University of Göteborg (CCUG). Bacteria
ATCC
Escherichia coli Streptococcus pneumoniae Staphylococcus aureus Pseudomonas aeruginosa Klebsiella pneumoniae Staphylococcus epidermidis Enterobacter cloacae Morganella morganii Proteus mirabilis Acinetobacter baumannii Streptococcus mitis Streptococcus mutans Streptococcus pyogenes Enterococcus faecalis Enterococcus faecium Clostridium perfringens Klebsiella oxytoca Bacteroides fragilis Fusobacterium nucleatum Citrobacter freundii Salmonella enteriditis
25922 49619 25923 27853 13883 14990 700323 25829 43071 BAA-747 6249 25175 19615 29212 35667 13124 700324 25285 25586 8090 13076 CCUG
Streptococcus pseudopneumoniae
49455 62647 63747 63793 34062
inhibit the bacteria growth and dilution series of these bacteria solutions were used for PCR testing. Performance of the dry-reagent assays was tested in real-time PCR measurements using a prototype GenomEra PCR device (Abacus Diagnostica) (Hagren et al., 2008). E. coli, S. aureus or S. pneumoniae intact bacteria of 0–400,000 colony forming units (cfu) per PCR reaction in 100 mM KCl were used (35 μL reaction volume). Pseudomonas spp. assay was tested using genomic DNA extracted from Pseudomonas aeruginosa (ATCC 27853) 0–1000 copies per PCR reaction in KCl 100 mM. The GenomEra PCR device consists of four thermal blocks, which are set to different constant temperatures, and a time-resolved fluorescence measurement unit. The PCR amplification is performed by transferring the reaction chips between the thermal blocks by a conveyor. A total of 44 PCR amplification cycles were performed while europium and terbium TRF were measured every second cycle after the cycle 10. The PCR protocol consisted of an initial denaturation at 100 °C for 150 s, followed by 10 cycles of 27 °C for 1.7 s, 60 °C for 15 s and 75 °C for 15 s, 100 °C for 17 s, and 17 cycles of 27 °C for 60 s followed by europium and terbium TRF measurement, 75 °C for 25 s, 100 °C for 17 s, 27 °C for 1.7 s, 60 °C for 15 s, 75 °C for 15 s and 100 °C for 17 s. The temperatures refer to the settings of the blocks and the time is the total incubation time of the reaction chip. Total PCR time was 90 min. The europium and terbium TRF measurements utilized excitation wavelength 340 nm, emission wavelength 545 and 615 nm for Tb and Eu, respectively, delay time was 400 μs and counting time was 500 μs. Terbium chelates elicit the main emission peak at 545 nm and small emission peaks at 489, 589 and 622 nm. Europium emission is measured at 615 nm and there is a small crosstalk from terbium that elevates the measured europium signal level in a duplex assay. Therefore, 11% of the terbium signal was subtracted from europium signals (Lehmusvuori et al., 2013). 2.6. Result interpretation PCR results are illustrated using europium and terbium signal-tobackground ratios. Background signal in each reaction was determined
67
as the average signal of the PCR cycles 10, 12, 14 and 16. The threshold cycles were determined as the PCR cycle where the signal-tobackground ratio reached the level of 3. The preliminary sensitivities of the dry-reagent assays were defined as the lowest bacteria number (cfu) or DNA template copy number (Pseudomonas spp. assay) per reaction that was detected as positive by all the parallel reactions using 10fold dilution series of the bacteria cells or extracted DNA template. 3. Results and discussion 3.1. Target sequences Alignment of 16S rRNA gene sequences of the 21 different sepsis causing bacteria showed high sequence similarity which allowed design of a single broad-range primer pair (amplicon 236 bp) for the detection of all the 21 target species. The 16S rRNA sequence contains also variable regions that can be used for the bacteria identification, for example, using sequence-specific hybridization probes (McCabe et al., 1999). However, the alignment indicated that the variable regions are spread widely to the sequence area. Thus, it is improbable to be able to specifically detect several different bacteria species using identification probes together with one PCR amplicon with the maximum length of approximately 300 bp that would be efficiently amplified by PCR. Therefore we used 16S rRNA gene for the broad-range bacteria and Pseudomonas spp. detection. S. aureus and E. coli assays were targeted to detect gyrB gene and lytA gene was used in S. pneumoniae PCR assay. 3.2. Specificity of the E. coli, S. aureus, S. pneumoniae and Pseudomonas spp. PCR assays, and sensitivity of the broad-range PCR assay Preliminary specificity of the PCR assays was tested using 21 bacteria species. S. aureus, S. pneumonia and Pseudomonas spp. PCR assays detected only the specific target bacterium species (10,000 DNA template copies per reaction) as designed at the threshold cycles of 29, 28 and 20, respectively and none of the non-target 20 bacteria were detected. The E. coli PCR assay threshold cycle with 10,000 E. coli genomic DNA copies was at cycle 27 and, in addition the NTC reactions and the reactions containing 20 non-target bacteria reached the threshold level at the cycles 35 to 36. The broad-range PCR assay detected all DNA samples from 21 different bacteria between the cycles 21 and 29 and the NTC reactions reached the threshold level at the cycle 31. 3.3. Performance of the dry-reagent PCR assays The dry-reagent PCR assays are easy to use requiring only addition of the bacteria into the PCR chip in a suitable solution. The S. aureus, S. pneumonia and Pseudomonas spp. dry-reagent assays showed good performance with sensitivity of 3 cfu, 2 cfu and 10 genomic DNA copies per PCR reaction, respectively, and high signal-to-background ratios (S/B) with a maximum of 240. The E. coli and broad-range bacteria assays were functional but the detection limits were limited because 20% of the E. coli assay NTC reactions (total n = 25) and all the broadrange assay NTC reactions (n = 24) gave signals over the threshold level after the PCR cycles 34 and 26, respectively. The broad-range PCR assay sensitivity of 4000 cfu and the E. coli assay sensitivity of 400 cfu were determined as the threshold cycles were detected more than three PCR cycles earlier than threshold cycles of the NTC reactions. All the NTC reactions gave positive IAC signals that verify functionality of the assays when no bacteria specific signal is observed. Performances of the assays are shown in Fig. 2. The real-time PCR assays were performed in 90 min and 4 dryreagent PCR chips were analyzed in one run. Real-time measurements were performed to monitor the amplification reactions with different target amounts and to be able to determine sensitivity of the E. coli and broad-range assays which NTC reactions fluorescence signal was elevated. For routine qualitative bacteria analysis the assay time can be
68
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
Fig. 2. Real-time PCR results of the dry-reagent (A) E. coli, (B) S. pneumoniae, (C) S. aureus, (D) Pseudomonas spp. and (E) broad-range bacteria assays. Performance of the assays was tested using intact bacteria except the Pseudomonas spp. assay that was tested with extracted P. aeruginosa genomic DNA. Bacteria specific Eu TRF and IAC specific Tb TRF signal-to-background ratios are shown.
diminished to less than 1 h by measuring the fluorescence only after the PCR cycling. For routine use the assays that might suffer from NTC reactions fluorescence signal elevation at the late PCR cycles should have limited PCR cycle numbers to avoid false positive results. Techniques for precise end-point measurement have been described, where both the specific and the background signals are measured post-PCR from the same exact closed-tube reaction to avoid real-time signal measurement (Lehmusvuori et al., 2010; Nurmi et al., 2008). Regardless of the measurement method (real-time or end-point), the low background fluorescence level of the switchable probe system should be ideal for setting a reliable threshold level clearly over the background signal. The E. coli and broad-range PCR assay NTC reactions gave positive results at late PCR cycles. The detection was based on switchable probe system where consecutive hybridization of two oligonucleotide probe sequences is required for fluorescent complex formation. Therefore the detection is highly specific and primer dimers or other unspecific amplification products should not increase the fluorescence signal level. In accordance with this, the sequencing results indicated that
signal of the NTC and non-target reactions was elevated by contaminating DNA. The results showed that E. coli DNA was the major contaminant, although the sequencing data was not unambiguous and most likely DNA from different bacteria species were also involved. The contamination of laboratory reagents and plastic-ware by bacterial DNA is well-known and problematic especially for broad-range bacteria detection assays (Gill et al., 2010; Grahn et al., 2003; Muhl et al., 2010). The DNA polymerase enzymes are mainly manufactured in E. coli as is also the polymerase that was used in this study. It has been presented that polymerase enzymes might contain traces of bacterial DNA (Niimi et al., 2011). Good laboratory practice was followed by using clean room, surface decontaminants and UV-irradiation of the working space and plastic-ware. In addition, several different PCR reagents were tested and DNA-free plastics were used but the contamination could not be totally eliminated. To avoid DNA polymeraseoriginated bacteria DNA contamination, the polymerase enzyme can be produced in eukaryotic cells, for example in Saccharomyces cerevisiae (Niimi et al., 2011).
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
4. Conclusions Ready to use dry-reagent PCR assays based on switchable lanthanide probes were demonstrated. The S. aureus, S. pneumonia and Pseudomonas PCR assays showed high sensitivity. The sensitivity of broad-range and E. coli assays was restricted by contaminating DNA that was at least partially originated from the DNA polymerase enzyme. The assays require only sample addition into the dry-reagent PCR chips and samples containing intact cells can be analyzed without DNA extraction. The dry-reagent PCR assays are ideal for rapid and simple qualitative bacteria detection, for example, for routine diagnosis of clinical samples by using a suitable sample preparation method or for rapid confirmation of bacteria culture results. In fact, the chip-based PCR format used in the current study has proven well adaptable with various clinical sample types (Hirvonen and Kaukoranta, 2015; Hirvonen et al., 2012a; Hirvonen et al., 2012b, Lehmusvuori et al., 2010). In combination with the novel label technology of switchable probes, new possibilities for future studies and improvements are opened. For example, design of highly multiplexed target DNA detection in closed-tube PCR assays by immobilizing one of the probes on the solid surface in the PCR reaction chamber as described recently (Lahdenpera et al., 2015). Acknowledgement The research leading to these results has received funding from the European Union Seventh Framework Programme (FP7/2007–2013) under grant agreement no. 259848. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mimet.2015.08.022. References FilmArray BioThrest Panel, BioFire Defence, USA, Information Sheet, Cat. No. FLM1-ASY0108, Accessed Aug 26 2015. http://biofiredefense.com/media/FilmArray-BioThreatPanel-Information-Sheet.pdf Xpert® MTB/RIF datasheet, Cat. No. GXMTB/RIF-US-10, Cepheid, USA, Accessed Aug 26 2015. http://tbevidence.org/documents/rescentre/sop/XpertMTB_Broch_R9_EU.pdf Bravo, D., Clari, M.A., Costa, E., Munoz-Cobo, B., Solano, C., Jose Remigia, M., Navarro, D., 2011. Comparative evaluation of three automated systems for DNA extraction in conjunction with three commercially available real-time PCR assays for quantitation of plasma Cytomegalovirus DNAemia in allogeneic stem cell transplant recipients. J. Clin. Microbiol. 49, 2899–2904. Clarridge III, J.E., 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 17, 840–862. Collin, F., Karkare, S., Maxwell, A., 2011. Exploiting bacterial DNA gyrase as a drug target: current state and perspectives. Appl. Microbiol. Biotechnol. 92, 479–497. Deshpande, A., White, P.S., 2012. Multiplexed nucleic acid-based assays for molecular diagnostics of human disease. Expert. Rev. Mol. Diagn. 12, 645–659. Gill, P., Rowlands, D., Tully, G., Bastisch, I., Staples, T., Scott, P., 2010. Manufacturer contamination of disposable plastic-ware and other reagents—an agreed position statement by ENFSI, SWGDAM and BSAG. Forensic science international. Genetics 4, 269–270. Grahn, N., Olofsson, M., Ellnebo-Svedlund, K., Monstein, H.J., Jonasson, J., 2003. Identification of mixed bacterial DNA contamination in broad-range PCR amplification of 16S rDNA V1 and V3 variable regions by pyrosequencing of cloned amplicons. FEMS Microbiol. Lett. 219, 87–91. Greve, T., Moller, J.K., 2012. Accuracy of using the lytA gene to distinguish Streptococcus pneumoniae from related species. J. Med. Microbiol. 61, 478–482. Hagren, V., von Lode, P., Syrjala, A., Soukka, T., Lovgren, T., Kojola, H., Nurmi, J., 2008. An automated PCR platform with homogeneous time-resolved fluorescence detection and dry chemistry assay kits. Anal. Biochem. 374, 411–416. Hirvonen, J.J., Kaukoranta, S.S., 2015. Comparison of BD Max Cdiff and GenomEra C. difficile molecular assays for detection of toxigenic Clostridium difficile from stools in conventional sample containers and in FecalSwabs. Eur. J. Clin. Microbiol. Infect. Dis. 34, 1005–1009. Hirvonen, J.J., Nevalainen, M., Tissari, P., Salmenlinna, S., Rantakokko-Jalava, K., Kaukoranta, S.S., 2012a. Rapid confirmation of suspected methicillin-resistant Staphylococcus
69
aureus colonies on chromogenic agars by a new commercial PCR assay, the GenomEra MRSA/SA Diagnose. Eur. J. Clin. Microbiol. Infect. Dis. 31, 1961–1968. Hirvonen, J.J., von Lode, P., Nevalainen, M., Rantakokko-Jalava, K., Kaukoranta, S.S., 2012b. One-step sample preparation of positive blood cultures for the direct detection of methicillin-sensitive and -resistant Staphylococcus aureus and methicillin-resistant coagulase-negative Staphylococci within one hour using the automated GenomEra CDX PCR system. Eur. J. Clin. Microbiol. Infect. Dis. 31, 2835–2842. Karhunen, U., Jaakkola, L., Wang, Q., Lamminmaki, U., Soukka, T., 2010. Luminescence switching by hybridization-directed mixed lanthanide complex formation. Anal. Chem. 82, 751–754. Kim, W., Park, H.K., Hwang, W.J., Shin, H.S., 2013. Simultaneous detection of Streptococcus pneumoniae, S. mitis, and S. oralis by a novel multiplex PCR assay targeting the gyrB gene. J. Clin. Microbiol. 51, 835–840. Korpimäki, T., Lövgren, T., Nurmi, J., 2004. Method for stabilizing assay reagents, reagent container with stabilized assay reagents and use thereof, Patent, WO2005118849. Kubista, M., 2012. I see the light! And I see it again and again! Clin. Chem. 58, 1505–1506. Lahdenpera, S., Spangar, A., Lempainen, A.M., Joki, L., Soukka, T., 2015. An integrated closed-tube 2-plex PCR amplification and hybridization assay with switchable lanthanide luminescence based spatial detection. Analyst 140, 3960–3968. Lehmusvuori, A., Juntunen, E., Tapio, A.H., Rantakokko-Jalava, K., Soukka, T., Lovgren, T., 2010. Rapid homogeneous PCR assay for the detection of Chlamydia trachomatis in urine samples. J. Microbiol. Methods 83, 302–306. Lehmusvuori, A., Karhunen, U., Tapio, A.H., Lamminmaki, U., Soukka, T., 2012. Highperformance closed-tube PCR based on switchable luminescence probes. Anal. Chim. Acta 731, 88–92. Lehmusvuori, A., Tapio, A.H., Maki-Teeri, P., Rantakokko-Jalava, K., Wang, Q., Takalo, H., Soukka, T., 2013. Homogeneous duplex polymerase chain reaction assay using switchable lanthanide fluorescence probes. Anal. Biochem. 436, 16–21. Maurin, M., 2012. Real-time PCR as a diagnostic tool for bacterial diseases. Expert. Rev. Mol. Diagn. 12, 731–754. McAvin, J.C., Reilly, P.A., Roudabush, R.M., Barnes, W.J., Salmen, A., Jackson, G.W., Beninga, K.K., Astorga, A., McCleskey, F.K., Huff, W.B., Niemeyer, D., Lohman, K.L., 2001. Sensitive and specific method for rapid identification of Streptococcus pneumoniae using real-time fluorescence PCR. J. Clin. Microbiol. 39, 3446–3451. McCabe, K.M., Zhang, Y.H., Huang, B.L., Wagar, E.A., McCabe, E.R., 1999. Bacterial species identification after DNA amplification with a universal primer pair. Mol. Genet. Metab. 66, 205–211. Mothershed, E.A., Whitney, A.M., 2006. Nucleic acid-based methods for the detection of bacterial pathogens: present and future considerations for the clinical laboratory. Clin. Chim. Acta 363, 206–220. Muhl, H., Kochem, A.J., Disque, C., Sakka, S.G., 2010. Activity and DNA contamination of commercial polymerase chain reaction reagents for the universal 16S rDNA realtime polymerase chain reaction detection of bacterial pathogens in blood. Diagn. Microbiol. Infect. Dis. 66, 41–49. Naughton, C., Avlonitis, N., Corless, S., Prendergast, J.G., Mati, I.K., Eijk, P.P., Cockroft, S.L., Bradley, M., Ylstra, B., Gilbert, N., 2013. Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures. Nat. Struct. Mol. Biol. 20, 387–395. Niimi, H., Mori, M., Tabata, H., Minami, H., Ueno, T., Hayashi, S., Kitajima, I., 2011. A novel eukaryote-made thermostable DNA polymerase which is free from bacterial DNA contamination. J. Clin. Microbiol. 49, 3316–3320. Nurmi, J., Korpimäki, T., Lövgren, T., Kojola, H., Iitiä, A., 2004. Temperature control of reaction vessel, system with reaction vessel, software product for system and use of system. Vol. EP20050746850. Nurmi, J., Syrjala, A., von Lode, P., Hagren, V., 2008. Method for detection of presence of target polynucleotide in samples. Patent, PCT/FI2008/050038. Persson, S., Al-Shuweli, S., Yapici, S., Jensen, J.N., Olsen, K.E., 2015. Identification of clinical Aeromonas species by rpoB and gyrB sequencing and development of a multiplex PCR method for detection of Aeromonas hydrophila, A. caviae, A. veronii, and A. media. J. Clin. Microbiol. 53, 653–656. Poritz, M.A., Blaschke, A.J., Byington, C.L., Meyers, L., Nilsson, K., Jones, D.E., Thatcher, S.A., Robbins, T., Lingenfelter, B., Amiott, E., Herbener, A., Daly, J., Dobrowolski, S.F., Teng, D.H., Ririe, K.M., 2011. FilmArray, an automated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection. PLoS ONE 6, e26047. Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, M., Lofstrom, C., 2004. Pre-PCR processing: strategies to generate PCR-compatible samples. Mol. Biotechnol. 26, 133–146. Raja, S., Ching, J., Xi, L., Hughes, S.J., Chang, R., Wong, W., McMillan, W., Gooding, W.E., McCarty Jr., K.S., Chestney, M., Luketich, J.D., Godfrey, T.E., 2005. Technology for automated, rapid, and quantitative PCR or reverse transcription-PCR clinical testing. Clin. Chem. 51, 882–890. Rampini, S.K., Bloemberg, G.V., Keller, P.M., Buchler, A.C., Dollenmaier, G., Speck, R.F., Bottger, E.C., 2011. Broad-range 16S rRNA gene polymerase chain reaction for diagnosis of culture-negative bacterial infections. Clin. Infect. Dis. 53, 1245–1251. Tanriverdi, S., Chen, L., Chen, S., 2010. A rapid and automated sample-to-result HIV load test for near-patient application. J. Infect. Dis. 201 (Suppl 1), S52–S58. Whatmore, A.M., Dowson, C.G., 1999. The autolysin-encoding gene (lytA) of Streptococcus pneumoniae displays restricted allelic variation despite localized recombination events with genes of pneumococcal bacteriophage encoding cell wall lytic enzymes. Infect. Immun. 67, 4551–4556. Woese, C.R., 1987. Bacterial evolution. Microbiol. Rev. 51, 221–271.
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Ready to use dry-reagent PCR assays for the four common bacterial pathogens using switchable lanthanide luminescence probe system A. Lehmusvuori a,⁎, M. Soikkeli a, E. Tuunainen a, T. Seppä a, A. Spangar a, K. Rantakokko-Jalava b, P. von Lode c, U. Karhunen a, T. Soukka a, S. Wittfooth a a b c
Department of Biochemistry/Biotechnology, University of Turku, 20520 Turku, Finland Clinical Microbiology Laboratory, Turku University Hospital, 20521 Turku, Finland Abacus Diagnostica Oy, 20520 Turku, Finland
a r t i c l e
i n f o
Article history: Received 27 October 2014 Received in revised form 27 August 2015 Accepted 27 August 2015 Available online 3 September 2015 Keywords: Dry-reagent PCR Switchable lanthanide luminescence Bacteria detection
a b s t r a c t Ready to use dry-reagent PCR assays for Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas spp. and for broad-range bacteria detection were developed. The assays were based on novel switchable lanthanide probes that provide sensitive target DNA detection with exceptionally high signal-to-background ratio, thus enabling clear discrimination between positive and negative results. For example, sensitivity of three S. aureus and two S. pneumonia bacteria (colony forming units) per PCR assay was measured with fluorescence signal more than 30 times over the background signal level. The rapid and easy-to-use assays are suitable for routine clinical diagnostics without molecular biology expertise and facilities. © 2015 Elsevier B.V. All rights reserved.
1. Introduction The number of polymerase chain reaction (PCR) assays for the detection of human pathogens and drug resistance causing genes has increased significantly in recent years. PCR assays allow specific and sensitive detection of the target microbe by combining the precise DNA sequence-based detection to the powerful target nucleic acid amplification. Furthermore, real-time and other homogenous PCR assays provide a relatively rapid (less than 1 h) detection of infectious agents in clinical sample and can detect fastidious and uncultivable microbes. In clinical settings rapid and reliable pathogen detection enables fast initiation of the optimal treatment of infectious diseases and, therefore, can improve patient recovery and healthcare outcome (Deshpande and White, 2012; Maurin, 2012). Real-time PCR assays utilize fluorescence reporter technologies that are used for monitoring the amplified target DNA during the amplification reaction. Simultaneous DNA amplification and detection enable rapid and simple-to-use diagnosis that is performed in closed-tube without time-consuming post-PCR processing that requires separate facilities and hands-on laboratory expertise. Furthermore, homogenous closed-tube assays are preferred because of the extremely low risk of contamination of the facilities and thus, the following reactions by the amplified nucleic acids (Kubista, 2012). PCR assays have traditionally been relatively laborious and timeconsuming to perform because the reaction mixture has been ⁎ Corresponding author. E-mail address: artule@utu.fi (A. Lehmusvuori).
http://dx.doi.org/10.1016/j.mimet.2015.08.022 0167-7012/© 2015 Elsevier B.V. All rights reserved.
formulated by combining several reagents prior to testing. This has been found to be challenging in routine clinical diagnostics where easy-to-use and rapid assays are needed for cost-effective daily testing (Bravo et al., 2011; Mothershed and Whitney, 2006; Radstrom et al., 2004). To simplify nucleic acid amplification test procedure, dried PCR reagents have been used in different applications (Hirvonen et al., 2012a; Hirvonen et al., 2012b, Poritz et al., 2011; Raja et al., 2005; Tanriverdi et al., 2010). Dry-reagent closed-tube PCR assays are easy to use by adding the sample in an assay compatible solution making nucleic acid amplification testing possible in the clinics lacking molecular biology laboratory facilities and expertise. Many current dried reagents do not require cold storage and therefore facilitate delivery, storage and use of the assays also outside clinics and in resource poor settings (BioFire Defence, Cepheid). However, with clinical samples, such as urine, blood or sputum, DNA extraction is commonly used to remove PCR inhibitors and release DNA from the microbes. Here we describe for the first time closed-tube PCR assays based on dried switchable lanthanide luminescence probes for the detection of Escherichia coli, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas spp. and also a broad-range bacteria detection assay. The switchable probe system involves two non-luminescent oligonucleotide probes, one carrying a lanthanide chelate and the other an organic antenna chromophore. Hybridization of the probes consecutively onto amplified target DNA leads to formation of a luminescent lanthanide chelate complex by self-assembly of the two reporter molecules. The long-lifetime luminescence of the lanthanide chelate complex is measured using time-resolved fluorescence (TRF) measurement mode that collects the signal after the short-lifetime fluorescence has decayed
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
and thus, decreases the background signal level (Karhunen et al., 2010; Lehmusvuori et al., 2012). All the assays also contained an internal amplification control (IAC) that was co-amplified and used to verify negative results. The assay principle is illustrated in Fig. 1. 2. Materials and methods 2.1. PCR target sequences The 16S ribosomal RNA plays essential role in translation of mRNA to protein. The 16S rRNA gene is universal in bacteria and it contains highly conservative sequence regions (Clarridge, 2004; Woese, 1987). Several broad-range PCR assays for pathogenic bacteria based on the 16S rRNA gene have been published (Rampini et al., 2011). Our broad-range bacteria PCR assay primers and probes were targeted to the conservative 16S rRNA gene region. Certain sites in the 16S rRNA show also variation between different bacteria and our amplicon contained also a mutated site which was utilized in the design of Pseudomonas genus bacteria specific probes. Therefore, the broad-range and Pseudomonas spp. PCR assays utilized same primer sequences and different probe sequences with an amplicon length of 236 nucleotides. Although the 16S rRNA gene contain variations, the E. coli, S. aureus and S. pneumoniae PCR assays were targeted to recognize different genes to ensure specificity. The DNA gyrase enzyme is found in bacteria and it has a critical role in DNA replication and gene expression as the enzyme is involved in the DNA supercoiling (Collin et al., 2011; Naughton et al., 2013). The DNA gyrase is made up of two A and two B subunits coded by the gyrA and gyrB genes. Due to relatively high genetic variation between different bacterial species the gyrB has been used previously in PCR assays for identification of pathogenic bacteria (Kim et al., 2013; Persson et al., 2015). We used gyrB gene for the detection of S. aureus and E. coli with PCR amplicon size of 139 and 137 nucleotides, respectively. N-acetylmuramoyl-L-alanine amidase is an autolysin enzyme that degrades peptidoglycan and is associated to the microorganism's cell wall synthesis (Whatmore and Dowson, 1999). The lytA gene of the S. pneumonia codes the autolysin enzyme and has been used as a PCR target gene. It has been shown that lytA targeted PCR is sensitive and specific and also able to distinguish S. pneumoniae from its close relative Streptococcus mitis (Greve and Moller, 2012). Our S. pneumoniae PCR assay was based on lytA gene and the primers amplified a 114 base pair amplicons.
65
2.2. Oligonucleotide primers and probes Oligonucleotide primer and probe sequences (Table 1) for E. coli, S. aureus, S. pneumoniae, Pseudomonas spp. and broad-range bacteria PCR assays were designed using sequence information from the GenBank of the National Center for Biotechnology Information (NCBI) (U.S. National Library of Medicine, MD, USA). The assays were designed to recognize the selected target gene variant (mentioned in Chapter 2.1) specific to the target bacteria species. Several variants of 16S rRNA (n = 119), gyrB (n = 157) and lytA (n = 34) genes from 22 sepsis causing bacteria were aligned (listed in Supplementary material) using Vector NTI software (Thermo). Oligonucleotide primer and probe sequences were manually designed using OligoAnalyzer 3.1 from the Integrated DNA Technologies (IA, USA) to identify the melting temperatures and secondary structures. Oligonucleotide sequence dimers were identified using Oligo Analyzer (Kuulasmaa, T., University of Kuopio, Finland). Furthermore, artificial internal amplification control primer, probe and target sequences were designed. Primer and probe specificities to the target microbes were revised by an in silico specificity screen using the Basic Local Alignment Search Tool (BLAST) at the NCBI website. The bacteria specific probes and IAC probes were labeled with switchable europium and terbium labels (Lehmusvuori et al., 2013), respectively, as described previously (Karhunen et al., 2010). Oligonucleotide probes and primers were purchased from the biomers.net (Germany) and Thermo Fisher Scientific (MA, USA), respectively, except the E. coli specific primers that were purchased from the Exiqon (Denmark). The synthetic ssDNA IAC PCR template was purchased from TAQ Copenhagen (Denmark). 2.3. Ready to use dry-reagent PCR assay chips Closed-tube duplex dry-reagent PCR assays for the detection of target bacteria (or broad-range bacteria) and IAC were prepared in the plastic GenomEra reaction chips (Nurmi et al., 2004) (Abacus Diagnostica Oy, Finland). The reagents were dispensed into the reaction chamber in three separated drops and dried as described previously (Korpimäki et al., 2004). The base reagents calculated for a 35 μL PCR reaction included Tris–HCl 10 mM (pH 8.3), Trehalose 25 g/L, NaN3 0.005%, BSA 1 g/L (Gemini, CA, USA) and dNTPs 400 μM (Larova, Germany). These reagents were divided into two aliquots. The following reagents were included into one portion: MgCl2 1.5 mM, IAC forward and reverse primers 250 nM, IAC Tb chelate probe 50 nM, broad-range
Fig. 1. Illustration of (A) the duplex PCR assay principle based on the switchable probes. The non-luminescent probes form a luminescent lanthanide chelate complex when hybridized to the amplified target DNA at the measurement temperature of 30 °C. Internal amplification control (IAC) is used to verify PCR functionality when no bacteria is observed. (B) The dry-reagent PCR chips (n = 4) are placed into the holder that is compatible with the GenomEra PCR thermocycler containing time-resolved fluorescence measurement unit.
66
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
Table 1 Oligonucleotide primer and probe sequences, and internal amplification control artificial single-stranded DNA template sequence. Oligonucleotide
Sequence 5′ to 3′
Gene
Broad-range primer 1a Broad-range primer 2a S. aureus primer 1 S. aureus primer 2 E. coli primer 1 E. coli primer 2 S. pneumoniae primer 1 S. pneumoniae primer 2 IAC primer 1 IAC primer 2 Broad-range EuIII probe mix
TCCTACGGGAGGCAGC CTTTACGCCCARTAAWTCCG GGTTCATCAGTTGTAAACGCAT TACCTGTCTTATCAGTTGTGCC GGTGTTTCGGTAGTAAACGCC CCGGTTTTTTCAGTCTCGCC ACGCAATCTAGCAGATGAAGCb TGGTCTGAGTGGTTGTTTGG CGACTTCAGGACCAACATCAGAC GTGTGCGCCGACGTCC CGGCTAACTCCGTGC CGGCTAACTTCGTGC CGGCTAACTACGTGC CGGCTAACTCTGTGC CCGCTAACTAAGTGC CAGCCGCGGTAATAC GAAGGGCAGTAAGTTAAT CCTTGCTGTTTTGACG CACAAGACTTAGAAGTATATG CACAGAAATGAGACTATATATC GGTAAAATTCACCGTCA CGAACACGGTGTACC GCTTGATACAGGGAGTT GGAATTAAAACGCACGAGTA GGTTCTAGTACGACAT CAGAGACATTCTTTAGA CCGACTTCAGGACCAACATCAGAC CCTCTTGCTAAGTTCTAAAGAATGT CTCTGTATGTCGTACTAGAACCTGC GGTGGATGGACGTCGGCGCACAC AGATT
16S rRNA 16S rRNA gyrB gyrB gyrB gyrB lytA lytA Artificial Artificial 16S rRNA
Broad-range antenna probe Pseudomonas spp. EuIII probe Pseudomonas spp. antenna probe S. aureus EuIII probe S. aureus antenna probe E. coli EuIII probe E. coli antenna probe S. pneumoniae EuIII probe S. pneumoniae antenna probe IAC TbIII probe IAC antenna probe IAC PCR template
16S rRNA 16S rRNA 16S rRNA gyrB gyrB gyrB gyrB lytA lytA Artificial Artificial Artificial
GenBank accession number and position AB269763 AB269763 AB084059 AB084059 AB083953 AB083953 AM113494 AM113494 – – AB269763 AF094719 AM980864 Z93435 AF076036 AB269763 AF094719 AF094719 AB084059 AB084059 AB083953 AB083953 AM113494 AM113494 – – –
332–347 548–567 41–62 158–179 41–61 158–177 478–498 572–591 – – 496–510 473–487 485–499 482–496 511–525 514–528 419–436 438–453 66–86 89–110 98–114 121–135 514–530 536–555 – – –
The lanthanide chelates (EuIII and TbIII) and antenna chromophores were attached to the oligonucleotide probes by the six-carbon amino modified linker located at the 3′-end of the EuIII and TbIII probes and 5′-end of the antenna probes. The antenna probes contained a 3′-terminal phosphate. a The broad-range primers were used in the broad-range bacteria and Pseudomonas spp. assays. b The S. pneumonia primer 1 sequence is identical to the sequence introduced by McAvin et al., 2001.
bacteria or one of the bacteria specific forward and reverse primers 500 nM and either 250 nM of broad-range bacteria EuIII probe mix (50 nM each of the five different probe sequences) or 150 nM of one of the target bacteria specific EuIII probe. In addition to the base reagents, the other aliquot also contained DTPA 30 μM, IAC antenna probe 50 nM, 5000 copies of IAC single stranded oligonucleotide target and 150 nM of broad-range antenna probe or one of the bacteria specific antenna probe, except 200 nM of E. coli antenna probe was used. Both reagent mixtures were dispensed and dried as separate drops into reaction chamber. A stabilized DNA polymerase containing 1 μL of Phire Hot Start II DNA polymerase (Thermo Fisher Scientific) was dried as a third drop into the reaction chamber. KCl (100 mM) was added with the sample when starting the reaction. 2.4. Specificity testing of the PCR assays Preliminary specificity of the E. coli, S. aureus, S. pneumonia and Pseudomonas spp. PCR assays, and sensitivity of the broad-range PCR assay were tested in 96-well PCR plate format without drying the reagents. Reactions contained same reagent compositions as the dry-reagent assays except the IAC reagents were not used and Phire Hot Start II DNA polymerase 0.8 μL/reaction was used. Similarly to the dry-reagent assays, 100 mM KCl was used in every reaction. DNA was extracted from 21 different sepsis causing bacteria (Table 2) by picking 3–5 colonies from plate cultures and using NucleoSpin Tissue Kit and extraction protocol from Macherey-Nagel (Germany). The concentration of the extracted DNA samples was determined by the Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher Scientific). The PCR reactions contained 0 or 10,000 copies of the extracted genomic DNA and testing was performed using two parallel reactions. The thermal cycling was
performed with Bio-Rad C1000 touch thermal cycler (CA, USA) and it consisted of 150 s initial denaturation at 98 °C followed first by 10 cycles of 98 °C for 10 s, 62 °C for 15 s and 72 °C for 10 s and then 34 cycles of 98 °C for 10 s, 62 °C for 15 s or 25 °C for 35 s in every second cycle and 72 °C for 10 s. The europium fluorescence signal was measured using timeresolved mode (excitation 340 nm, emission 615 nm, delay 400 μs and counting time 400 μs) after 30 s incubation at the 25 °C with PerkinElmer Wallac Victor X4 multilabel plate reader (Finland). No template control (NTC) reactions of broad-range PCR assay were sequenced. The amplified DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Nerherlands). The sequencing was performed using the broad-range assay primers and ABI PRISM BigDye Terminator v3.1 Ready Reaction Cycle Sequencing Kit (Thermo Fisher Scientific, MA, USA) with Applied Biosystems 3130xl Genetic Analyzer (Thermo Fisher Scientific) at the Finnish Microarray and Sequencing Centre (Finland).
2.5. Evaluation of the dry-reagent PCR assays Liquid E. coli (ATCC 25922) and S. aureus (ATCC 29213) Brain Heart Infusion Broth cultures were incubated at +37 °C in 500 rpm shaking until the optical density at 600 nm (OD600 nm) reached the value of 0.5. The S. pneumoniae (ATCC 49619) was cultured in Brain Heart Infusion Broth in anaerobic conditions until OD600 nm value was 0.4. The cultures were centrifuged (2000 g, 2 min), supernatants were discarded and the bacteria pellets were suspended to phosphate buffered saline (PBS). Bacteria concentrations were determined by cultivating the bacteria solution in the Luria Agar (LA) plates except the S. pneumoniae that was cultivated in the Blood Agar plates in anaerobic conditions. Aliquots of the bacteria in PBS solution were complemented with 0.05% NaN3 to
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69 Table 2 Bacteria strains used for PCR assay testing. Bacteria strains originated from the American Type Culture Collection (ATCC) or Culture Collection University of Göteborg (CCUG). Bacteria
ATCC
Escherichia coli Streptococcus pneumoniae Staphylococcus aureus Pseudomonas aeruginosa Klebsiella pneumoniae Staphylococcus epidermidis Enterobacter cloacae Morganella morganii Proteus mirabilis Acinetobacter baumannii Streptococcus mitis Streptococcus mutans Streptococcus pyogenes Enterococcus faecalis Enterococcus faecium Clostridium perfringens Klebsiella oxytoca Bacteroides fragilis Fusobacterium nucleatum Citrobacter freundii Salmonella enteriditis
25922 49619 25923 27853 13883 14990 700323 25829 43071 BAA-747 6249 25175 19615 29212 35667 13124 700324 25285 25586 8090 13076 CCUG
Streptococcus pseudopneumoniae
49455 62647 63747 63793 34062
inhibit the bacteria growth and dilution series of these bacteria solutions were used for PCR testing. Performance of the dry-reagent assays was tested in real-time PCR measurements using a prototype GenomEra PCR device (Abacus Diagnostica) (Hagren et al., 2008). E. coli, S. aureus or S. pneumoniae intact bacteria of 0–400,000 colony forming units (cfu) per PCR reaction in 100 mM KCl were used (35 μL reaction volume). Pseudomonas spp. assay was tested using genomic DNA extracted from Pseudomonas aeruginosa (ATCC 27853) 0–1000 copies per PCR reaction in KCl 100 mM. The GenomEra PCR device consists of four thermal blocks, which are set to different constant temperatures, and a time-resolved fluorescence measurement unit. The PCR amplification is performed by transferring the reaction chips between the thermal blocks by a conveyor. A total of 44 PCR amplification cycles were performed while europium and terbium TRF were measured every second cycle after the cycle 10. The PCR protocol consisted of an initial denaturation at 100 °C for 150 s, followed by 10 cycles of 27 °C for 1.7 s, 60 °C for 15 s and 75 °C for 15 s, 100 °C for 17 s, and 17 cycles of 27 °C for 60 s followed by europium and terbium TRF measurement, 75 °C for 25 s, 100 °C for 17 s, 27 °C for 1.7 s, 60 °C for 15 s, 75 °C for 15 s and 100 °C for 17 s. The temperatures refer to the settings of the blocks and the time is the total incubation time of the reaction chip. Total PCR time was 90 min. The europium and terbium TRF measurements utilized excitation wavelength 340 nm, emission wavelength 545 and 615 nm for Tb and Eu, respectively, delay time was 400 μs and counting time was 500 μs. Terbium chelates elicit the main emission peak at 545 nm and small emission peaks at 489, 589 and 622 nm. Europium emission is measured at 615 nm and there is a small crosstalk from terbium that elevates the measured europium signal level in a duplex assay. Therefore, 11% of the terbium signal was subtracted from europium signals (Lehmusvuori et al., 2013). 2.6. Result interpretation PCR results are illustrated using europium and terbium signal-tobackground ratios. Background signal in each reaction was determined
67
as the average signal of the PCR cycles 10, 12, 14 and 16. The threshold cycles were determined as the PCR cycle where the signal-tobackground ratio reached the level of 3. The preliminary sensitivities of the dry-reagent assays were defined as the lowest bacteria number (cfu) or DNA template copy number (Pseudomonas spp. assay) per reaction that was detected as positive by all the parallel reactions using 10fold dilution series of the bacteria cells or extracted DNA template. 3. Results and discussion 3.1. Target sequences Alignment of 16S rRNA gene sequences of the 21 different sepsis causing bacteria showed high sequence similarity which allowed design of a single broad-range primer pair (amplicon 236 bp) for the detection of all the 21 target species. The 16S rRNA sequence contains also variable regions that can be used for the bacteria identification, for example, using sequence-specific hybridization probes (McCabe et al., 1999). However, the alignment indicated that the variable regions are spread widely to the sequence area. Thus, it is improbable to be able to specifically detect several different bacteria species using identification probes together with one PCR amplicon with the maximum length of approximately 300 bp that would be efficiently amplified by PCR. Therefore we used 16S rRNA gene for the broad-range bacteria and Pseudomonas spp. detection. S. aureus and E. coli assays were targeted to detect gyrB gene and lytA gene was used in S. pneumoniae PCR assay. 3.2. Specificity of the E. coli, S. aureus, S. pneumoniae and Pseudomonas spp. PCR assays, and sensitivity of the broad-range PCR assay Preliminary specificity of the PCR assays was tested using 21 bacteria species. S. aureus, S. pneumonia and Pseudomonas spp. PCR assays detected only the specific target bacterium species (10,000 DNA template copies per reaction) as designed at the threshold cycles of 29, 28 and 20, respectively and none of the non-target 20 bacteria were detected. The E. coli PCR assay threshold cycle with 10,000 E. coli genomic DNA copies was at cycle 27 and, in addition the NTC reactions and the reactions containing 20 non-target bacteria reached the threshold level at the cycles 35 to 36. The broad-range PCR assay detected all DNA samples from 21 different bacteria between the cycles 21 and 29 and the NTC reactions reached the threshold level at the cycle 31. 3.3. Performance of the dry-reagent PCR assays The dry-reagent PCR assays are easy to use requiring only addition of the bacteria into the PCR chip in a suitable solution. The S. aureus, S. pneumonia and Pseudomonas spp. dry-reagent assays showed good performance with sensitivity of 3 cfu, 2 cfu and 10 genomic DNA copies per PCR reaction, respectively, and high signal-to-background ratios (S/B) with a maximum of 240. The E. coli and broad-range bacteria assays were functional but the detection limits were limited because 20% of the E. coli assay NTC reactions (total n = 25) and all the broadrange assay NTC reactions (n = 24) gave signals over the threshold level after the PCR cycles 34 and 26, respectively. The broad-range PCR assay sensitivity of 4000 cfu and the E. coli assay sensitivity of 400 cfu were determined as the threshold cycles were detected more than three PCR cycles earlier than threshold cycles of the NTC reactions. All the NTC reactions gave positive IAC signals that verify functionality of the assays when no bacteria specific signal is observed. Performances of the assays are shown in Fig. 2. The real-time PCR assays were performed in 90 min and 4 dryreagent PCR chips were analyzed in one run. Real-time measurements were performed to monitor the amplification reactions with different target amounts and to be able to determine sensitivity of the E. coli and broad-range assays which NTC reactions fluorescence signal was elevated. For routine qualitative bacteria analysis the assay time can be
68
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
Fig. 2. Real-time PCR results of the dry-reagent (A) E. coli, (B) S. pneumoniae, (C) S. aureus, (D) Pseudomonas spp. and (E) broad-range bacteria assays. Performance of the assays was tested using intact bacteria except the Pseudomonas spp. assay that was tested with extracted P. aeruginosa genomic DNA. Bacteria specific Eu TRF and IAC specific Tb TRF signal-to-background ratios are shown.
diminished to less than 1 h by measuring the fluorescence only after the PCR cycling. For routine use the assays that might suffer from NTC reactions fluorescence signal elevation at the late PCR cycles should have limited PCR cycle numbers to avoid false positive results. Techniques for precise end-point measurement have been described, where both the specific and the background signals are measured post-PCR from the same exact closed-tube reaction to avoid real-time signal measurement (Lehmusvuori et al., 2010; Nurmi et al., 2008). Regardless of the measurement method (real-time or end-point), the low background fluorescence level of the switchable probe system should be ideal for setting a reliable threshold level clearly over the background signal. The E. coli and broad-range PCR assay NTC reactions gave positive results at late PCR cycles. The detection was based on switchable probe system where consecutive hybridization of two oligonucleotide probe sequences is required for fluorescent complex formation. Therefore the detection is highly specific and primer dimers or other unspecific amplification products should not increase the fluorescence signal level. In accordance with this, the sequencing results indicated that
signal of the NTC and non-target reactions was elevated by contaminating DNA. The results showed that E. coli DNA was the major contaminant, although the sequencing data was not unambiguous and most likely DNA from different bacteria species were also involved. The contamination of laboratory reagents and plastic-ware by bacterial DNA is well-known and problematic especially for broad-range bacteria detection assays (Gill et al., 2010; Grahn et al., 2003; Muhl et al., 2010). The DNA polymerase enzymes are mainly manufactured in E. coli as is also the polymerase that was used in this study. It has been presented that polymerase enzymes might contain traces of bacterial DNA (Niimi et al., 2011). Good laboratory practice was followed by using clean room, surface decontaminants and UV-irradiation of the working space and plastic-ware. In addition, several different PCR reagents were tested and DNA-free plastics were used but the contamination could not be totally eliminated. To avoid DNA polymeraseoriginated bacteria DNA contamination, the polymerase enzyme can be produced in eukaryotic cells, for example in Saccharomyces cerevisiae (Niimi et al., 2011).
A. Lehmusvuori et al. / Journal of Microbiological Methods 118 (2015) 64–69
4. Conclusions Ready to use dry-reagent PCR assays based on switchable lanthanide probes were demonstrated. The S. aureus, S. pneumonia and Pseudomonas PCR assays showed high sensitivity. The sensitivity of broad-range and E. coli assays was restricted by contaminating DNA that was at least partially originated from the DNA polymerase enzyme. The assays require only sample addition into the dry-reagent PCR chips and samples containing intact cells can be analyzed without DNA extraction. The dry-reagent PCR assays are ideal for rapid and simple qualitative bacteria detection, for example, for routine diagnosis of clinical samples by using a suitable sample preparation method or for rapid confirmation of bacteria culture results. In fact, the chip-based PCR format used in the current study has proven well adaptable with various clinical sample types (Hirvonen and Kaukoranta, 2015; Hirvonen et al., 2012a; Hirvonen et al., 2012b, Lehmusvuori et al., 2010). In combination with the novel label technology of switchable probes, new possibilities for future studies and improvements are opened. For example, design of highly multiplexed target DNA detection in closed-tube PCR assays by immobilizing one of the probes on the solid surface in the PCR reaction chamber as described recently (Lahdenpera et al., 2015). Acknowledgement The research leading to these results has received funding from the European Union Seventh Framework Programme (FP7/2007–2013) under grant agreement no. 259848. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mimet.2015.08.022. References FilmArray BioThrest Panel, BioFire Defence, USA, Information Sheet, Cat. No. FLM1-ASY0108, Accessed Aug 26 2015. http://biofiredefense.com/media/FilmArray-BioThreatPanel-Information-Sheet.pdf Xpert® MTB/RIF datasheet, Cat. No. GXMTB/RIF-US-10, Cepheid, USA, Accessed Aug 26 2015. http://tbevidence.org/documents/rescentre/sop/XpertMTB_Broch_R9_EU.pdf Bravo, D., Clari, M.A., Costa, E., Munoz-Cobo, B., Solano, C., Jose Remigia, M., Navarro, D., 2011. Comparative evaluation of three automated systems for DNA extraction in conjunction with three commercially available real-time PCR assays for quantitation of plasma Cytomegalovirus DNAemia in allogeneic stem cell transplant recipients. J. Clin. Microbiol. 49, 2899–2904. Clarridge III, J.E., 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 17, 840–862. Collin, F., Karkare, S., Maxwell, A., 2011. Exploiting bacterial DNA gyrase as a drug target: current state and perspectives. Appl. Microbiol. Biotechnol. 92, 479–497. Deshpande, A., White, P.S., 2012. Multiplexed nucleic acid-based assays for molecular diagnostics of human disease. Expert. Rev. Mol. Diagn. 12, 645–659. Gill, P., Rowlands, D., Tully, G., Bastisch, I., Staples, T., Scott, P., 2010. Manufacturer contamination of disposable plastic-ware and other reagents—an agreed position statement by ENFSI, SWGDAM and BSAG. Forensic science international. Genetics 4, 269–270. Grahn, N., Olofsson, M., Ellnebo-Svedlund, K., Monstein, H.J., Jonasson, J., 2003. Identification of mixed bacterial DNA contamination in broad-range PCR amplification of 16S rDNA V1 and V3 variable regions by pyrosequencing of cloned amplicons. FEMS Microbiol. Lett. 219, 87–91. Greve, T., Moller, J.K., 2012. Accuracy of using the lytA gene to distinguish Streptococcus pneumoniae from related species. J. Med. Microbiol. 61, 478–482. Hagren, V., von Lode, P., Syrjala, A., Soukka, T., Lovgren, T., Kojola, H., Nurmi, J., 2008. An automated PCR platform with homogeneous time-resolved fluorescence detection and dry chemistry assay kits. Anal. Biochem. 374, 411–416. Hirvonen, J.J., Kaukoranta, S.S., 2015. Comparison of BD Max Cdiff and GenomEra C. difficile molecular assays for detection of toxigenic Clostridium difficile from stools in conventional sample containers and in FecalSwabs. Eur. J. Clin. Microbiol. Infect. Dis. 34, 1005–1009. Hirvonen, J.J., Nevalainen, M., Tissari, P., Salmenlinna, S., Rantakokko-Jalava, K., Kaukoranta, S.S., 2012a. Rapid confirmation of suspected methicillin-resistant Staphylococcus
69
aureus colonies on chromogenic agars by a new commercial PCR assay, the GenomEra MRSA/SA Diagnose. Eur. J. Clin. Microbiol. Infect. Dis. 31, 1961–1968. Hirvonen, J.J., von Lode, P., Nevalainen, M., Rantakokko-Jalava, K., Kaukoranta, S.S., 2012b. One-step sample preparation of positive blood cultures for the direct detection of methicillin-sensitive and -resistant Staphylococcus aureus and methicillin-resistant coagulase-negative Staphylococci within one hour using the automated GenomEra CDX PCR system. Eur. J. Clin. Microbiol. Infect. Dis. 31, 2835–2842. Karhunen, U., Jaakkola, L., Wang, Q., Lamminmaki, U., Soukka, T., 2010. Luminescence switching by hybridization-directed mixed lanthanide complex formation. Anal. Chem. 82, 751–754. Kim, W., Park, H.K., Hwang, W.J., Shin, H.S., 2013. Simultaneous detection of Streptococcus pneumoniae, S. mitis, and S. oralis by a novel multiplex PCR assay targeting the gyrB gene. J. Clin. Microbiol. 51, 835–840. Korpimäki, T., Lövgren, T., Nurmi, J., 2004. Method for stabilizing assay reagents, reagent container with stabilized assay reagents and use thereof, Patent, WO2005118849. Kubista, M., 2012. I see the light! And I see it again and again! Clin. Chem. 58, 1505–1506. Lahdenpera, S., Spangar, A., Lempainen, A.M., Joki, L., Soukka, T., 2015. An integrated closed-tube 2-plex PCR amplification and hybridization assay with switchable lanthanide luminescence based spatial detection. Analyst 140, 3960–3968. Lehmusvuori, A., Juntunen, E., Tapio, A.H., Rantakokko-Jalava, K., Soukka, T., Lovgren, T., 2010. Rapid homogeneous PCR assay for the detection of Chlamydia trachomatis in urine samples. J. Microbiol. Methods 83, 302–306. Lehmusvuori, A., Karhunen, U., Tapio, A.H., Lamminmaki, U., Soukka, T., 2012. Highperformance closed-tube PCR based on switchable luminescence probes. Anal. Chim. Acta 731, 88–92. Lehmusvuori, A., Tapio, A.H., Maki-Teeri, P., Rantakokko-Jalava, K., Wang, Q., Takalo, H., Soukka, T., 2013. Homogeneous duplex polymerase chain reaction assay using switchable lanthanide fluorescence probes. Anal. Biochem. 436, 16–21. Maurin, M., 2012. Real-time PCR as a diagnostic tool for bacterial diseases. Expert. Rev. Mol. Diagn. 12, 731–754. McAvin, J.C., Reilly, P.A., Roudabush, R.M., Barnes, W.J., Salmen, A., Jackson, G.W., Beninga, K.K., Astorga, A., McCleskey, F.K., Huff, W.B., Niemeyer, D., Lohman, K.L., 2001. Sensitive and specific method for rapid identification of Streptococcus pneumoniae using real-time fluorescence PCR. J. Clin. Microbiol. 39, 3446–3451. McCabe, K.M., Zhang, Y.H., Huang, B.L., Wagar, E.A., McCabe, E.R., 1999. Bacterial species identification after DNA amplification with a universal primer pair. Mol. Genet. Metab. 66, 205–211. Mothershed, E.A., Whitney, A.M., 2006. Nucleic acid-based methods for the detection of bacterial pathogens: present and future considerations for the clinical laboratory. Clin. Chim. Acta 363, 206–220. Muhl, H., Kochem, A.J., Disque, C., Sakka, S.G., 2010. Activity and DNA contamination of commercial polymerase chain reaction reagents for the universal 16S rDNA realtime polymerase chain reaction detection of bacterial pathogens in blood. Diagn. Microbiol. Infect. Dis. 66, 41–49. Naughton, C., Avlonitis, N., Corless, S., Prendergast, J.G., Mati, I.K., Eijk, P.P., Cockroft, S.L., Bradley, M., Ylstra, B., Gilbert, N., 2013. Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures. Nat. Struct. Mol. Biol. 20, 387–395. Niimi, H., Mori, M., Tabata, H., Minami, H., Ueno, T., Hayashi, S., Kitajima, I., 2011. A novel eukaryote-made thermostable DNA polymerase which is free from bacterial DNA contamination. J. Clin. Microbiol. 49, 3316–3320. Nurmi, J., Korpimäki, T., Lövgren, T., Kojola, H., Iitiä, A., 2004. Temperature control of reaction vessel, system with reaction vessel, software product for system and use of system. Vol. EP20050746850. Nurmi, J., Syrjala, A., von Lode, P., Hagren, V., 2008. Method for detection of presence of target polynucleotide in samples. Patent, PCT/FI2008/050038. Persson, S., Al-Shuweli, S., Yapici, S., Jensen, J.N., Olsen, K.E., 2015. Identification of clinical Aeromonas species by rpoB and gyrB sequencing and development of a multiplex PCR method for detection of Aeromonas hydrophila, A. caviae, A. veronii, and A. media. J. Clin. Microbiol. 53, 653–656. Poritz, M.A., Blaschke, A.J., Byington, C.L., Meyers, L., Nilsson, K., Jones, D.E., Thatcher, S.A., Robbins, T., Lingenfelter, B., Amiott, E., Herbener, A., Daly, J., Dobrowolski, S.F., Teng, D.H., Ririe, K.M., 2011. FilmArray, an automated nested multiplex PCR system for multi-pathogen detection: development and application to respiratory tract infection. PLoS ONE 6, e26047. Radstrom, P., Knutsson, R., Wolffs, P., Lovenklev, M., Lofstrom, C., 2004. Pre-PCR processing: strategies to generate PCR-compatible samples. Mol. Biotechnol. 26, 133–146. Raja, S., Ching, J., Xi, L., Hughes, S.J., Chang, R., Wong, W., McMillan, W., Gooding, W.E., McCarty Jr., K.S., Chestney, M., Luketich, J.D., Godfrey, T.E., 2005. Technology for automated, rapid, and quantitative PCR or reverse transcription-PCR clinical testing. Clin. Chem. 51, 882–890. Rampini, S.K., Bloemberg, G.V., Keller, P.M., Buchler, A.C., Dollenmaier, G., Speck, R.F., Bottger, E.C., 2011. Broad-range 16S rRNA gene polymerase chain reaction for diagnosis of culture-negative bacterial infections. Clin. Infect. Dis. 53, 1245–1251. Tanriverdi, S., Chen, L., Chen, S., 2010. A rapid and automated sample-to-result HIV load test for near-patient application. J. Infect. Dis. 201 (Suppl 1), S52–S58. Whatmore, A.M., Dowson, C.G., 1999. The autolysin-encoding gene (lytA) of Streptococcus pneumoniae displays restricted allelic variation despite localized recombination events with genes of pneumococcal bacteriophage encoding cell wall lytic enzymes. Infect. Immun. 67, 4551–4556. Woese, C.R., 1987. Bacterial evolution. Microbiol. Rev. 51, 221–271.