- Email: [email protected]
Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone
Diagnostic Microbiology and Infectious Disease 75 (2013) 121–123
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Bacteriology
Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone☆ Padman A. Jayaratne a, b,⁎, Lori Monkman b, George Broukhanski c, d, Dillan R. Pillai c, d, Christine Lee a, b a
Department of Pathology and Molecular medicine, McMaster University, Hamilton, Ontario, Canada L8N 3Z5 Microbiology Section, Hamilton Regional laboratory Medicine Program, St. Joseph's Healthcare, Hamilton, Ontario, Canada L8N 4A6 Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Canada d Ontario Agency of Health Protection and Promotion, Ontario, Canada b c
a r t i c l e
i n f o
Article history: Received 14 May 2012 Received in revised form 21 September 2012 Accepted 1 October 2012 Available online 20 November 2012 Keywords: Toxigenic Clostridium difficile Real-time PCR Detection NAP1 Clone
a b s t r a c t This study describes the development of a cost-effective, multiplex real-time polymerase chain reaction (RTPCR) method for detection of toxigenic Clostridium difficile from stools and presumptive identification of the NAP-1 strain. The diagnostic value of the new method is for the detection of toxigenic C. difficile which has the following performance characteristics: 99.8% specificity, 95.1% sensitivity, 97.5% positive predictive value, and 99.5% negative predictive value. Examination of 24 specimens presumptively identified as NAP1 strain by RTPCR with Pulsed-field gel electrophoresis performed on C. difficile isolated from those specimens showed 100% agreement. This RTPCR showed equivalent test performance characteristics as the 2 commercially available assays which were evaluated. The estimated cost per test is CAD$9.50 and which is significantly less than the commercial assays. The average turnaround time from setup to detection is 3.5 h. The RTPCR method described here is a cost-effective and highly sensitive test which can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of C. difficile infection and indirectly determine the presence of the hypervirulent epidemic binary toxin (BI)/NAP 1 strain for prompt infection control interventions. Crown Copyright © 2013 Published by Elsevier Inc. All rights reserved.
1. Introduction Clostridium difficile infection (CDI) is a leading cause of nosocomial diarrhea in adults. Symptoms can range from mild, self-limiting diarrhea to pseudomembranous colitis, toxic megacolon, and death. During the past decade, there has been a significant increase in the number of cases and an escalating rate of severe disease with a 4-fold increase in mortality (Rupnik et al., 2009). The NAP-1 strain is now implicated in causing more severe, recurrent disease and may be responsible for healthcare facility outbreaks (Peterson and Rovicsek., 2009). Therefore, rapid and accurate laboratory testing of C. difficile is essential for improved clinical outcome and reduced transmissions. In addition, identification of the NAP1 strain that is responsible for most outbreaks in a timely manner will allow the infection control to act promptly to prevent further spread. Due to rapid turnaround time and ease of use, many clinical laboratories continue to employ enzyme immunoassay (EIA) for the detection of C. difficile toxins A and B (Sloan et al., 2008). The major limitation to the EIA's is the poor sensitivity, which ranges from 60% to 86% when compared to toxigenic culture (Eastwood et al., 2009). ☆ This work was supported by the Hamilton Regional Laboratory Medicine Program. ⁎ Corresponding author. Tel.: +1-905-522-1155x34047; fax: +1-905-521-6083. E-mail address: [email protected] (P.A. Jayaratne).
Several recent studies from Europe and the USA have shown that current laboratory testing based on EIA detection of C. difficile toxins may miss up to 50% of CDI cases (Ticehurst et al., 2006). Adapting to the rapid tests like real-time polymerase chain reaction (RTPCR) that approach the performance characteristics of toxigenic culture to establish the diagnosis of CDI will result in improved outcomes for both the individual and the institution (Kvach et al., 2010; Ticehurst et al., 2006). RTPCR methods that detect various targets in the toxin gene region (pathogenicity locus [PaLoc]) of the genome have been described (Belanger et al., 2003; Peterson et al., 2007; Sloan et al., 2008). Toxigenic strains of C. difficile produce 2 large protein toxins— toxin A and toxin B—that are responsible for the cellular damage associated with the disease. The genes tcdA and tcdB that encode toxin A and toxin B, respectively, are located in the PaLoc, along with the tcdD- and tcdC-positive and -negative regulator genes, respectively (Spigaglia and Mastrantonia., 2002). There are a number of commercially available PCR assays for CDI diagnosis (Babady et al., 2010; Kvach et al., 2010; Stamper et al., 2009). Unfortunately, these assays are cost-prohibitive and many clinical laboratories may not be able to implement PCR. The objective of the present study was to develop a rapid, costeffective RTPCR method with equivalent performance characteristics to the commercial assays for detection of toxigenic C. difficile from stools and to presumptively identify the NAP-1 strain.
0732-8893/$ – see front matter. Crown Copyright © 2013 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2012.10.002
122
P.A. Jayaratne et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 121–123
2. Materials and methods 2.1. Bacterial strains
Table 2 Number of toxigenic C. difficile–positive and –negative specimens and performance characteristics of the PCR-based assays (n = 470). Method
The Hamilton Health Sciences and St. Joseph's Healthcare Hamilton are tertiary-care hospitals with combined beds of over 1000. Four-hundred and seventy consecutive unformed stool specimens from adults with suspected CDI submitted to the microbiology laboratory at the Hamilton Health Sciences and St. Joseph's Healthcare, Hamilton, Ontario, Canada, were tested. Three previously characterized strains—NML4, positive for only toxin A and B; NML5, positive for both toxin A and B and binary toxin; and NML3, a nontoxigenic strain from the National Microbiology Laboratory, Winnipeg, Manitoba, Canada (NML)—were used as the controls. 2.2. Nucleic acid extraction and amplification For the in-house RTPCR method, 100 μL of the thawed stool samples was emulsified in 900 μL of S.T.A.R. (Stool Transport and Recovery) buffer (Roche Diagnostics, Laval, QC, Canada) and 140 μL of the supernatant was extracted using the easyMAG® (bioMerieux, Montreal, QC, Canada) automated nucleic acid extractor according to the manufacturer's instructions. Purified DNA was collected in 55 μL of elution buffer. The in-house multiplex RTPCR method amplified and detected a 226-bp fragment of the tcdC gene (surrogate marker for tcdA and/or tcdB toxin genes) flanking the known 18-bp deletion in some strains, a 139-bp cdtA (binary toxin gene), and a 94-bp eubacterial ribosomal gene target (rrnB), an internal extraction and amplification control (IC) gene. Genes were amplified using the QuantiTect™ Mutiplex PCR NoROX kit (Qiagen, Mississauga, ON, Canada) supplemented with respective primers and TaqMan® Probes (Integrated DNA Technologies [IDT], Coralville, IA, USA). A web-based multiple sequence alignment software program, ClustralW2 (EMBLEBI), and the IDT SciTool using GenBank sequences of the respective genes of C. difficile (toxin genes) and Escherichia coli (eubacterial ribosomal gene) were used to design primers and probes (Table 1). An internal ZEN™ quencher molecule (IDT) was incorporated into the 5′ FAM-labeled probe (tcdC probe—CDP) (Table 1). Five microliters of extracted DNA was used as the template for all PCR methods. Two commercial real-time PCR assays—Prodesse ProGastro Cd™ (GenProbe, San Diego, CA, USA) for the detection of toxin B gene, and Astra Clostridium difficile PCR Kit 1.0 (Astra Diagnostics, Hamburg, Germany) for the detection toxin A and/or B gene—were used for comparison. All commercial assays were performed according to the laboratory standard operating procedure and product insert procedure manuals. RTPCR amplifications and detections were conducted using a RotorGene 6500 real-time PCR machine (Qiagen, Mississauga, ON, Canada). Discordant results were tested by stool culture and presence of toxin. Prior to the culture of stools, all samples were alcohol shocked as described by Clabots et al. (1989), plated, and cultured on Cycloserine Cefoxitin Fructose Agar plates (Oxoid, Nepean, On., Canada) at 35 °C
Target
Primer/ probe
Sequence (5′–3′)
tcdC
CDF CDR CDP BTAF BTAR BTAP 16SRTF 16SRTR 16SRTP
ACCATCTTCAATAACTTGAATAACCT AGACGACGAAAAGAAAGCTATTGAA FAM-AGCTGAAGA/ZEN/AGCTAAAAAGGCTGAAGAACAA/3IBlk_FQ GGRAARCAYTATATTAAAGCAGA ACATCAGCAAGTTCATTAGGTG ROXN-AAGGGRGAYTCTTGGGGTAAAGCA/3IABlk_FQ CCATGAAGTCGGAATCGCTAG ACTCCCATGGTGTGACGG HEX-GCCTGAATACGTTCCCGGGCCTTGTAC/3IABlk_FQ
rrnB
ProGastro Cd
Astra
In-house
39 431
38 432
39 431
100 95.1 100 99.5
100 92.7 100 99.3
99.8 95.1 97.5 99.5
PPV = Positive predictive value; NPV = negative predictive value.
for 18 to 48 h under anaerobic conditions. The organisms were identified based on the typical “horse barn” odor, gram stain, and gas liquid chromatography patterns. The extracted DNA from culture isolates was tested using an in-house PCR for the detection of toxin B gene. For this study, gold standard was defined as follows: 100% concordance between tests, and for discrepant results, positive by toxigenic culture. PCR-amplified products from samples positive for both tcdC and cdtA in the in-house method were examined by agarose gel electrophoresis and visualized on 1.5% gels to detect the 18-bp tcdC deletion. The expected amplicon sizes on the agarose gels for the PCRamplified tcdC, cdtA, and the rrnB (IC) targets were 226, 139, and 94 bp, respectively. The presumptive NAP1 strains that carried the 18-bp deletion in the tcdC gene showed a 208-bp band instead of the 226-bp band present in the wild-type strain. Both tcdC- and cdtA-positive strains were isolated by culture from their respective stool specimens and subtyped using pulsed-field gel electrophoresis (PFGE) by the method of Klaassen et al. (2002) to obtain SmaI RFLP patterns. 3. Results Forty-one of 470 specimens were identified to have toxigenic C. difficile using the expanded gold standard. Four of 41 toxigenic specimens showed discrepant results by at least 1 genotypic method. The test performance characteristics showed that the in-house RTPCR method was comparable to all commercial assays tested (Table 2). Twenty-four (58%) of 41 specimens detected as toxigenic isolates were positive for both tcdC gene and cdtA gene by the in-house method and were identified as presumptive NAP1 strains. Seventeen (42%) of 41 specimens positive for the tcdC gene were negative for cdtA gene and were identified as non-NAP1 (Fig. 1). Agarose gel electrophoresis of amplified DNA of all tcdC- and cdtA-positive strains showed a 18-bp deletion of the tcdC gene as determined by the amplicon size (Fig. 1B). PFGE patterns of all strains positive for both tcdC and cdtA genes were identified as indistinguishable from the NAP1 strain pattern (results not shown). Two specimens showed the deletion in the tcdC gene but did not show the presence of the cdtA gene and were identified as nonNAP1 strains by PFGE (results not shown). 4. Discussion
Table 1 Primers and probes.
cdtA
Test results Positives Negatives Test performance (%) Specificity Sensitivity PPV NPV
ZEN = internal quencher molecule.
The average turnaround time for the in-house RTPCR method is 3.5 h from the time of specimen reception. The estimated total cost per test for the in-house method is CAD$9.50 (nucleic acid extraction, CAD$7.00; PCR amplification and detection, CAD$2.50), which is approximately 25% to 30% of the costs of commercially available RTPCR tests. The labor costs and hands-on time associated with the inhouse method and those of commercial RTPCR assays were similar. The diagnostic value of the new in-house method primarily lies in the detection of toxigenic C. difficile. In addition, the new method also presumptively identifies the NAP1 strain in real time. Examination of all presumptive NAP1 strains (n = 24) identified in the present study
P.A. Jayaratne et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 121–123
123
by PFGE showed 100% accuracy. The presumptively identified NAP1 strain can be confirmed by agarose gel electrophoresis to confirm the 18-bp deletion in the tcdC gene amplicon. Incorporation of the internal ZEN quencher enables to reduce the background and to increase the signal (IDT). In addition, use of this double-quenched probe to detect the tcdC gene target also allowed to experience increased sensitivity, efficiency, and precision in the PCR method as compared to conventional single-quenched probe. A threshold cycle (CT) of 38 was set as the cut-off limit for signal detection of the inhouse method. CT values ≥38 were considered to be indeterminant, and the test was repeated starting with a new extraction from the specimen. If the CT value remains ≥38 upon repeat testing, the result was considered to be negative. The lower limit of detection of the method was determined by using a 10-fold serial dilution of known concentration of C. difficile NML4 genomic DNA and was calculated based on the number of genomic copies present in the amplification reaction considering the size of the C. difficile genome. The lower limit of detection was estimated to be 130 genome equivalents in a PCR reaction, giving a sensitivity of detection of 1.0 × 10 5 CFU per milliliter of stools. The in-house PCR method described here is a cost-effective and highly sensitive test that can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of CDI and confirming the presence of the hypervirulent epidemic NAP 1 strain responsible for current outbreaks in institutions. Since validation, the in-house method has been introduced into the Hamilton Regional Laboratory Medicine Program for routine C. difficile testing. References
Fig. 1. Detection of toxigenic C. difficile by real-time multiplex PCR amplification and of tcdC and cdtA genes. (A) Fluorescence detection curves: I, tcdC (green channel); II, cdtA (orange channel); and III, internal control (IC; yellow channel) genes during amplification. Specimen legend: (———— ————), non-NAP1 toxigenic strains; (——— ———), NAP1 toxigenic strains; ( ), nontoxigenic strain. (B) Agarose gel electrophoresis of the respective amplification products. Lanes: 1, nontoxigenic strain; 2–4, 6–8, nonNAP1 toxigenic strains; 5 and 9, NAP1 toxigenic strains; M, 100-bp molecular size marker (Bio-Rad Laboratories, Mississauga, ON., Canada).
Babady NE, Stiles J, Ruggiero P, Khosa P, Huang D, Shuptar S, et al. Evaluation of the Cepheid Xpert Clostridium difficile Epi assay for diagnosis of Clostridium difficile infection and typing of the NAP1 strain at a cancer hospital. J Clin Microbiol 2010;48:4519–24. Belanger SD, Boissinot M, Clairoux N, Picard FJ, Bergeron MG. Rapid detection of Clostridium difficile in feces by real-time PCR. J Clin Microbiol 2003;41:730–4. Clabots CR, Gerding SJ, Olson MM, Peterson LR, Gerding DN. Detection of asymptomatic Clostridium difficile carriage by an alcohol shock procedure. J Clin Microbiol 1989;27:2386–7. Eastwood K, Else P, Charlett A, Wilcox M. Comparison of nine commercially available Clostridium difficile toxin detection assays, a real-time PCR assay for C. difficile tcdB, and a glutamate dehydrogenase detection assay to cytotoxin testing and cytotoxigenic culture methods. J Clin Microbiol 2009;47:3211–7. Klaassen CH, van Haren HA, Horrevorts AM. Molecular fingerprinting of Clostridium difficile isolates: pulsed-field gel electrophoresis versus amplified fragment length polymorphism. J Clin Microbiol 2002;40:101–4. Kvach EJ, Ferguson D, Riska PF, Landry ML. Comparison of BD GeneOhm Cdiff real-time PCR assay with a two-step algorithm and a toxin A/B enzyme-linked immunosorbent assay for diagnosis of toxigenic Clostridium difficile infection. J Clin Microbiol 2010;48:109–14. Peterson LR, Manson RU, Paule SM, Hacek DM, Robicsek A, Thomsom RB, et al. Detection of toxigenic Clostridium difficile in stool samples by real-time polymerase chain reaction for the diagnosis of C. difficile-associated diarrhea. Clin Infect Dis 2007;45: 1152–60. Peterson LR, Rovicsek A. Does my patient have Clostridium difficile infection? Ann Intern Med 2009;151:176–9. Rupnik M, Wilcox MH, Gerding DN. Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat Rev Microbiol 2009;7:526–36. Sloan LM, Duresko BJ, Gustafson DR, Rosenblatt JE. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis in Clostridium difficile infection. J Clin Microbiol 2008;46:1996–2001. Spigaglia P, Mastrantonia P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 2002;40:3470–5. Stamper PD, Alcabasa R, Arid D, Babiker W, Wehrlin J, Ikpeama I, et al. Comparison of a commercial real-time PCR assay for tcdB detection to a cell culture cytotoxicity assay and toxigenic culture for direct detection of toxin-producing Clostridium difficile in clinical samples. J Clin Microbiol 2009;47:373–8. Ticehurst JR, Aird DZ, Dam LM, Borek AP, Hargrove JT, Carroll KC. Effective detection of toxigenic Clostridium difficile by a two-step algorithm tests for antigen and cytotoxin. J Clin Microbiol 2006;44:1145–9.
Contents lists available at SciVerse ScienceDirect
Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio
Bacteriology
Real-time polymerase chain reaction method for detection of toxigenic Clostridium difficile from stools and presumptive identification of NAP1 clone☆ Padman A. Jayaratne a, b,⁎, Lori Monkman b, George Broukhanski c, d, Dillan R. Pillai c, d, Christine Lee a, b a
Department of Pathology and Molecular medicine, McMaster University, Hamilton, Ontario, Canada L8N 3Z5 Microbiology Section, Hamilton Regional laboratory Medicine Program, St. Joseph's Healthcare, Hamilton, Ontario, Canada L8N 4A6 Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Canada d Ontario Agency of Health Protection and Promotion, Ontario, Canada b c
a r t i c l e
i n f o
Article history: Received 14 May 2012 Received in revised form 21 September 2012 Accepted 1 October 2012 Available online 20 November 2012 Keywords: Toxigenic Clostridium difficile Real-time PCR Detection NAP1 Clone
a b s t r a c t This study describes the development of a cost-effective, multiplex real-time polymerase chain reaction (RTPCR) method for detection of toxigenic Clostridium difficile from stools and presumptive identification of the NAP-1 strain. The diagnostic value of the new method is for the detection of toxigenic C. difficile which has the following performance characteristics: 99.8% specificity, 95.1% sensitivity, 97.5% positive predictive value, and 99.5% negative predictive value. Examination of 24 specimens presumptively identified as NAP1 strain by RTPCR with Pulsed-field gel electrophoresis performed on C. difficile isolated from those specimens showed 100% agreement. This RTPCR showed equivalent test performance characteristics as the 2 commercially available assays which were evaluated. The estimated cost per test is CAD$9.50 and which is significantly less than the commercial assays. The average turnaround time from setup to detection is 3.5 h. The RTPCR method described here is a cost-effective and highly sensitive test which can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of C. difficile infection and indirectly determine the presence of the hypervirulent epidemic binary toxin (BI)/NAP 1 strain for prompt infection control interventions. Crown Copyright © 2013 Published by Elsevier Inc. All rights reserved.
1. Introduction Clostridium difficile infection (CDI) is a leading cause of nosocomial diarrhea in adults. Symptoms can range from mild, self-limiting diarrhea to pseudomembranous colitis, toxic megacolon, and death. During the past decade, there has been a significant increase in the number of cases and an escalating rate of severe disease with a 4-fold increase in mortality (Rupnik et al., 2009). The NAP-1 strain is now implicated in causing more severe, recurrent disease and may be responsible for healthcare facility outbreaks (Peterson and Rovicsek., 2009). Therefore, rapid and accurate laboratory testing of C. difficile is essential for improved clinical outcome and reduced transmissions. In addition, identification of the NAP1 strain that is responsible for most outbreaks in a timely manner will allow the infection control to act promptly to prevent further spread. Due to rapid turnaround time and ease of use, many clinical laboratories continue to employ enzyme immunoassay (EIA) for the detection of C. difficile toxins A and B (Sloan et al., 2008). The major limitation to the EIA's is the poor sensitivity, which ranges from 60% to 86% when compared to toxigenic culture (Eastwood et al., 2009). ☆ This work was supported by the Hamilton Regional Laboratory Medicine Program. ⁎ Corresponding author. Tel.: +1-905-522-1155x34047; fax: +1-905-521-6083. E-mail address: [email protected] (P.A. Jayaratne).
Several recent studies from Europe and the USA have shown that current laboratory testing based on EIA detection of C. difficile toxins may miss up to 50% of CDI cases (Ticehurst et al., 2006). Adapting to the rapid tests like real-time polymerase chain reaction (RTPCR) that approach the performance characteristics of toxigenic culture to establish the diagnosis of CDI will result in improved outcomes for both the individual and the institution (Kvach et al., 2010; Ticehurst et al., 2006). RTPCR methods that detect various targets in the toxin gene region (pathogenicity locus [PaLoc]) of the genome have been described (Belanger et al., 2003; Peterson et al., 2007; Sloan et al., 2008). Toxigenic strains of C. difficile produce 2 large protein toxins— toxin A and toxin B—that are responsible for the cellular damage associated with the disease. The genes tcdA and tcdB that encode toxin A and toxin B, respectively, are located in the PaLoc, along with the tcdD- and tcdC-positive and -negative regulator genes, respectively (Spigaglia and Mastrantonia., 2002). There are a number of commercially available PCR assays for CDI diagnosis (Babady et al., 2010; Kvach et al., 2010; Stamper et al., 2009). Unfortunately, these assays are cost-prohibitive and many clinical laboratories may not be able to implement PCR. The objective of the present study was to develop a rapid, costeffective RTPCR method with equivalent performance characteristics to the commercial assays for detection of toxigenic C. difficile from stools and to presumptively identify the NAP-1 strain.
0732-8893/$ – see front matter. Crown Copyright © 2013 Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.diagmicrobio.2012.10.002
122
P.A. Jayaratne et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 121–123
2. Materials and methods 2.1. Bacterial strains
Table 2 Number of toxigenic C. difficile–positive and –negative specimens and performance characteristics of the PCR-based assays (n = 470). Method
The Hamilton Health Sciences and St. Joseph's Healthcare Hamilton are tertiary-care hospitals with combined beds of over 1000. Four-hundred and seventy consecutive unformed stool specimens from adults with suspected CDI submitted to the microbiology laboratory at the Hamilton Health Sciences and St. Joseph's Healthcare, Hamilton, Ontario, Canada, were tested. Three previously characterized strains—NML4, positive for only toxin A and B; NML5, positive for both toxin A and B and binary toxin; and NML3, a nontoxigenic strain from the National Microbiology Laboratory, Winnipeg, Manitoba, Canada (NML)—were used as the controls. 2.2. Nucleic acid extraction and amplification For the in-house RTPCR method, 100 μL of the thawed stool samples was emulsified in 900 μL of S.T.A.R. (Stool Transport and Recovery) buffer (Roche Diagnostics, Laval, QC, Canada) and 140 μL of the supernatant was extracted using the easyMAG® (bioMerieux, Montreal, QC, Canada) automated nucleic acid extractor according to the manufacturer's instructions. Purified DNA was collected in 55 μL of elution buffer. The in-house multiplex RTPCR method amplified and detected a 226-bp fragment of the tcdC gene (surrogate marker for tcdA and/or tcdB toxin genes) flanking the known 18-bp deletion in some strains, a 139-bp cdtA (binary toxin gene), and a 94-bp eubacterial ribosomal gene target (rrnB), an internal extraction and amplification control (IC) gene. Genes were amplified using the QuantiTect™ Mutiplex PCR NoROX kit (Qiagen, Mississauga, ON, Canada) supplemented with respective primers and TaqMan® Probes (Integrated DNA Technologies [IDT], Coralville, IA, USA). A web-based multiple sequence alignment software program, ClustralW2 (EMBLEBI), and the IDT SciTool using GenBank sequences of the respective genes of C. difficile (toxin genes) and Escherichia coli (eubacterial ribosomal gene) were used to design primers and probes (Table 1). An internal ZEN™ quencher molecule (IDT) was incorporated into the 5′ FAM-labeled probe (tcdC probe—CDP) (Table 1). Five microliters of extracted DNA was used as the template for all PCR methods. Two commercial real-time PCR assays—Prodesse ProGastro Cd™ (GenProbe, San Diego, CA, USA) for the detection of toxin B gene, and Astra Clostridium difficile PCR Kit 1.0 (Astra Diagnostics, Hamburg, Germany) for the detection toxin A and/or B gene—were used for comparison. All commercial assays were performed according to the laboratory standard operating procedure and product insert procedure manuals. RTPCR amplifications and detections were conducted using a RotorGene 6500 real-time PCR machine (Qiagen, Mississauga, ON, Canada). Discordant results were tested by stool culture and presence of toxin. Prior to the culture of stools, all samples were alcohol shocked as described by Clabots et al. (1989), plated, and cultured on Cycloserine Cefoxitin Fructose Agar plates (Oxoid, Nepean, On., Canada) at 35 °C
Target
Primer/ probe
Sequence (5′–3′)
tcdC
CDF CDR CDP BTAF BTAR BTAP 16SRTF 16SRTR 16SRTP
ACCATCTTCAATAACTTGAATAACCT AGACGACGAAAAGAAAGCTATTGAA FAM-AGCTGAAGA/ZEN/AGCTAAAAAGGCTGAAGAACAA/3IBlk_FQ GGRAARCAYTATATTAAAGCAGA ACATCAGCAAGTTCATTAGGTG ROXN-AAGGGRGAYTCTTGGGGTAAAGCA/3IABlk_FQ CCATGAAGTCGGAATCGCTAG ACTCCCATGGTGTGACGG HEX-GCCTGAATACGTTCCCGGGCCTTGTAC/3IABlk_FQ
rrnB
ProGastro Cd
Astra
In-house
39 431
38 432
39 431
100 95.1 100 99.5
100 92.7 100 99.3
99.8 95.1 97.5 99.5
PPV = Positive predictive value; NPV = negative predictive value.
for 18 to 48 h under anaerobic conditions. The organisms were identified based on the typical “horse barn” odor, gram stain, and gas liquid chromatography patterns. The extracted DNA from culture isolates was tested using an in-house PCR for the detection of toxin B gene. For this study, gold standard was defined as follows: 100% concordance between tests, and for discrepant results, positive by toxigenic culture. PCR-amplified products from samples positive for both tcdC and cdtA in the in-house method were examined by agarose gel electrophoresis and visualized on 1.5% gels to detect the 18-bp tcdC deletion. The expected amplicon sizes on the agarose gels for the PCRamplified tcdC, cdtA, and the rrnB (IC) targets were 226, 139, and 94 bp, respectively. The presumptive NAP1 strains that carried the 18-bp deletion in the tcdC gene showed a 208-bp band instead of the 226-bp band present in the wild-type strain. Both tcdC- and cdtA-positive strains were isolated by culture from their respective stool specimens and subtyped using pulsed-field gel electrophoresis (PFGE) by the method of Klaassen et al. (2002) to obtain SmaI RFLP patterns. 3. Results Forty-one of 470 specimens were identified to have toxigenic C. difficile using the expanded gold standard. Four of 41 toxigenic specimens showed discrepant results by at least 1 genotypic method. The test performance characteristics showed that the in-house RTPCR method was comparable to all commercial assays tested (Table 2). Twenty-four (58%) of 41 specimens detected as toxigenic isolates were positive for both tcdC gene and cdtA gene by the in-house method and were identified as presumptive NAP1 strains. Seventeen (42%) of 41 specimens positive for the tcdC gene were negative for cdtA gene and were identified as non-NAP1 (Fig. 1). Agarose gel electrophoresis of amplified DNA of all tcdC- and cdtA-positive strains showed a 18-bp deletion of the tcdC gene as determined by the amplicon size (Fig. 1B). PFGE patterns of all strains positive for both tcdC and cdtA genes were identified as indistinguishable from the NAP1 strain pattern (results not shown). Two specimens showed the deletion in the tcdC gene but did not show the presence of the cdtA gene and were identified as nonNAP1 strains by PFGE (results not shown). 4. Discussion
Table 1 Primers and probes.
cdtA
Test results Positives Negatives Test performance (%) Specificity Sensitivity PPV NPV
ZEN = internal quencher molecule.
The average turnaround time for the in-house RTPCR method is 3.5 h from the time of specimen reception. The estimated total cost per test for the in-house method is CAD$9.50 (nucleic acid extraction, CAD$7.00; PCR amplification and detection, CAD$2.50), which is approximately 25% to 30% of the costs of commercially available RTPCR tests. The labor costs and hands-on time associated with the inhouse method and those of commercial RTPCR assays were similar. The diagnostic value of the new in-house method primarily lies in the detection of toxigenic C. difficile. In addition, the new method also presumptively identifies the NAP1 strain in real time. Examination of all presumptive NAP1 strains (n = 24) identified in the present study
P.A. Jayaratne et al. / Diagnostic Microbiology and Infectious Disease 75 (2013) 121–123
123
by PFGE showed 100% accuracy. The presumptively identified NAP1 strain can be confirmed by agarose gel electrophoresis to confirm the 18-bp deletion in the tcdC gene amplicon. Incorporation of the internal ZEN quencher enables to reduce the background and to increase the signal (IDT). In addition, use of this double-quenched probe to detect the tcdC gene target also allowed to experience increased sensitivity, efficiency, and precision in the PCR method as compared to conventional single-quenched probe. A threshold cycle (CT) of 38 was set as the cut-off limit for signal detection of the inhouse method. CT values ≥38 were considered to be indeterminant, and the test was repeated starting with a new extraction from the specimen. If the CT value remains ≥38 upon repeat testing, the result was considered to be negative. The lower limit of detection of the method was determined by using a 10-fold serial dilution of known concentration of C. difficile NML4 genomic DNA and was calculated based on the number of genomic copies present in the amplification reaction considering the size of the C. difficile genome. The lower limit of detection was estimated to be 130 genome equivalents in a PCR reaction, giving a sensitivity of detection of 1.0 × 10 5 CFU per milliliter of stools. The in-house PCR method described here is a cost-effective and highly sensitive test that can be implemented in a clinical laboratory to assist clinicians in establishing the diagnosis of CDI and confirming the presence of the hypervirulent epidemic NAP 1 strain responsible for current outbreaks in institutions. Since validation, the in-house method has been introduced into the Hamilton Regional Laboratory Medicine Program for routine C. difficile testing. References
Fig. 1. Detection of toxigenic C. difficile by real-time multiplex PCR amplification and of tcdC and cdtA genes. (A) Fluorescence detection curves: I, tcdC (green channel); II, cdtA (orange channel); and III, internal control (IC; yellow channel) genes during amplification. Specimen legend: (———— ————), non-NAP1 toxigenic strains; (——— ———), NAP1 toxigenic strains; ( ), nontoxigenic strain. (B) Agarose gel electrophoresis of the respective amplification products. Lanes: 1, nontoxigenic strain; 2–4, 6–8, nonNAP1 toxigenic strains; 5 and 9, NAP1 toxigenic strains; M, 100-bp molecular size marker (Bio-Rad Laboratories, Mississauga, ON., Canada).
Babady NE, Stiles J, Ruggiero P, Khosa P, Huang D, Shuptar S, et al. Evaluation of the Cepheid Xpert Clostridium difficile Epi assay for diagnosis of Clostridium difficile infection and typing of the NAP1 strain at a cancer hospital. J Clin Microbiol 2010;48:4519–24. Belanger SD, Boissinot M, Clairoux N, Picard FJ, Bergeron MG. Rapid detection of Clostridium difficile in feces by real-time PCR. J Clin Microbiol 2003;41:730–4. Clabots CR, Gerding SJ, Olson MM, Peterson LR, Gerding DN. Detection of asymptomatic Clostridium difficile carriage by an alcohol shock procedure. J Clin Microbiol 1989;27:2386–7. Eastwood K, Else P, Charlett A, Wilcox M. Comparison of nine commercially available Clostridium difficile toxin detection assays, a real-time PCR assay for C. difficile tcdB, and a glutamate dehydrogenase detection assay to cytotoxin testing and cytotoxigenic culture methods. J Clin Microbiol 2009;47:3211–7. Klaassen CH, van Haren HA, Horrevorts AM. Molecular fingerprinting of Clostridium difficile isolates: pulsed-field gel electrophoresis versus amplified fragment length polymorphism. J Clin Microbiol 2002;40:101–4. Kvach EJ, Ferguson D, Riska PF, Landry ML. Comparison of BD GeneOhm Cdiff real-time PCR assay with a two-step algorithm and a toxin A/B enzyme-linked immunosorbent assay for diagnosis of toxigenic Clostridium difficile infection. J Clin Microbiol 2010;48:109–14. Peterson LR, Manson RU, Paule SM, Hacek DM, Robicsek A, Thomsom RB, et al. Detection of toxigenic Clostridium difficile in stool samples by real-time polymerase chain reaction for the diagnosis of C. difficile-associated diarrhea. Clin Infect Dis 2007;45: 1152–60. Peterson LR, Rovicsek A. Does my patient have Clostridium difficile infection? Ann Intern Med 2009;151:176–9. Rupnik M, Wilcox MH, Gerding DN. Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat Rev Microbiol 2009;7:526–36. Sloan LM, Duresko BJ, Gustafson DR, Rosenblatt JE. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis in Clostridium difficile infection. J Clin Microbiol 2008;46:1996–2001. Spigaglia P, Mastrantonia P. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 2002;40:3470–5. Stamper PD, Alcabasa R, Arid D, Babiker W, Wehrlin J, Ikpeama I, et al. Comparison of a commercial real-time PCR assay for tcdB detection to a cell culture cytotoxicity assay and toxigenic culture for direct detection of toxin-producing Clostridium difficile in clinical samples. J Clin Microbiol 2009;47:373–8. Ticehurst JR, Aird DZ, Dam LM, Borek AP, Hargrove JT, Carroll KC. Effective detection of toxigenic Clostridium difficile by a two-step algorithm tests for antigen and cytotoxin. J Clin Microbiol 2006;44:1145–9.