- Email: [email protected]
Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam
G Model VIRMET 12186 1–7
ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam
1
2
3 4 5 6 7 8 9
Q1
Z. Kis a,b , J. Jones a , A. Creanga a , K. Ferdinand a , K. Inui c , N. Gerloff a , C.T. Davis a , T. Nguyen d,e , R.O. Donis a,∗ a
Influenza Division, CDC, USA National Center for Epidemiology, Budapest, Hungary c Food and Agriculture Organization of Vietnam, Hanoi, Viet Nam d Hanoi University of Agriculture, Graduate School, Hanoi, Viet Nam e National Centre for Veterinary Diagnostics, Department of Animal Health, Hanoi, Viet Nam b
10
a b s t r a c t
11 12 13 14 15 16
Article history: Received 22 February 2013 Received in revised form 9 June 2013 Accepted 14 June 2013 Available online xxx
17 18 19 20 21 22 23
Keywords: Highly pathogenic avian influenza H5N1 Real-time RT-PCR Clade-differentiation Vietnam
Continued circulation and geographical expansion of highly pathogenic avian influenza H5N1 virus have led to the emergence of numerous clades in Vietnam. Although viral RNA sequencing and phylogenetic analysis are the gold standard for H5N1 HA clade designation, limited sequencing capacity in many laboratories precludes rapid H5N1 clade identification and detection of novel viruses. Therefore, a Taqman real-time RT-PCR assay for rapid differentiation of the four major H5N1 clades detected in Vietnam was developed. Using HA sequence alignments of clades 1.1, 2.3.2.1, 2.3.4, and 7 viruses, primers and FAMlabeled probes were designed to target conserved regions characteristic of each clade. The assay was optimized and evaluated using circulating clades of H5N1 collected in Vietnam from 2007 to 2012 and shown to be both sensitive and specific for the differentiation of the four H5N1 clades. The assay provides a useful tool for screening of large specimen collections for HA gene sequencing and phylogenetic analysis and for the rapid identification of molecular clade signatures to support outbreak investigations and surveillance activities. Finally, this assay may be useful to monitor for the emergence of novel or variant clades of H5N1 in Vietnam in the future or in other countries where these particular clades may circulate. © 2013 Elsevier B.V. All rights reserved.
24
25 26 27 28 29 30 31 32 33 34 35 36 37
1. Introduction The highly pathogenic avian influenza A H5N1 viruses have now appeared in over 60 countries on three continents and continue to infect humans and birds (Beato and Capua, 2011; FAO, 2011; Li et al., 2011). Through December 2012, at least 610 human infections and 360 deaths have occurred (WHO, 2012a,b). In addition, sporadic and sustained poultry outbreaks continue to occur across the Eastern Hemisphere resulting in severe losses to the poultry industry of the affected countries (Wan et al., 2011; Takakuwa et al., 2012; Wibawa et al., 2011). H5N1 is now considered to be enzootic in several countries despite efforts to eliminate the disease using various methods, such as stamping-out and vaccination. In addition, the virus continues to spread via migratory birds and poultry trade leading to detection of viruses outside regions of
∗ Corresponding author at: Influenza Division, NCIRD, Centers for Disease Control & Prevention, 1600 Clifton Road, NE, MS-G16, Atlanta, GA 30333, USA. Tel.: +1 404 639 4968; fax: +1 404 639 2350. E-mail addresses: [email protected], [email protected] (R.O. Donis).
endemicity (FAO, 2011; Sakoda et al., 2010; L‘Vov et al., 2008). As a consequence, viral evolution acting in concert with both local endemicity and regional spread has led to the emergence of distinct genetic groups (clades). In order to keep up with this divergence, the WHO/OIE/FAO H5N1 Evolution Working Group established a nomenclature system based on hemagglutinin (HA) sequences to identify clades of H5N1 (WHO/OIE/FAO, 2008, 2009, 2012). The molecular epidemiology of H5N1 in Vietnam has been unique in that multiple clades of the virus have been detected over the past decade (Buchy et al., 2009; Wan et al., 2008; Davis et al., 2010; Nguyen et al., 2008, 2012). Since 2001, at least fourteen different HA clades have been identified from birds in Vietnam. At least seven of these clades have been identified in consecutive years indicating consistent circulation. Although there remains some spatial association of clade distribution within Vietnam (e.g., clade 1.1 in the Mekong Delta), the continued introduction and re-introduction of viruses into the country has complicated the phylogeography of the virus (Nguyen et al., 2012). In order to provide a tool for the rapid prediction of HA clades prior to confirmatory sequencing a single-plex Taqman real-time RT-PCR assay to differentiate between the major clades of HPAI
0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.06.023
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
2
76
H5N1 in Vietnam was designed. Using HA sequence alignments of clades 1.1, 2.3.2.1, 2.3.4.1, 2.3.4.2, 2.3.4.3, 7.1 and 7.2 viruses collected in Vietnam and neighboring countries from 2007 to 2012, primers and FAM-labeled probes were designed to target conserved regions specific for each clade. The assay was optimized and evaluated using RNA extracted both from contemporary H5N1 virus isolates and from cloacal swabs from Vietnamese poultry, and was shown to be sensitive and specific for the detection and differentiation of H5N1 viruses belonging to clades 1.1, 2.3.2.1, 2.3.4.x and 7.x (7.1 or 7.2). Comparison to a universal influenza A matrix gene quantitative real-time RT-PCR assay demonstrated that each of the four clade-differentiation assays had a similar limit of detection of influenza A RNA. Thus, this assay may be useful as a screening tool to assess changes in the molecular epidemiology of H5N1 in Vietnam and potentially other countries with similar genetic groups in circulation. In addition, the assay may be a valuable tool in the early detection of novel or variant H5N1 virus strains in Vietnam and serve as a complement to existing H5N1 diagnostic platforms.
77
2. Material and methods
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
78 79
80 81 82 83 84 85
2.1. Primer/probe design for clade-specific real-time RT-PCR detection Highly pathogenic avian influenza (H5N1) virus hemagglutinin (HA) genes containing at least the full length HA1 region were downloaded from GenBank and aligned using MUSCLE (Edgar, 2004) together with HA sequences from recent H5N1 viruses collected in Vietnam (GISAID accession numbers EPI284431–EPI284593). The alignment was trimmed to include
only sequences collected from 2007 to 2012 in the Eastern Asian region and to include only viruses from clades 1.1, 2.3.2.1, 2.3.4.1, 2.3.4.2, 2.3.4.3, 7.1 and 7.2 as determined using the WHO/OIE/FAO H5N1 Evolution Working Group criteria (WHO/OIE/FAO, 2008, 2009, 2012). Initially, forward and reverse primers were designed based on nucleotide conservation within each clade of interest and RT-PCR reactions were performed, followed by gel electrophoresis, to demonstrate clade-specific amplification (approx. 150 nucleotide amplicons) of template RNA. After appropriate forward and reverse primers were selected (Table 1), probes were designed with a FAM labeled 5 end, an internally quenched modified “T” using BHQ1, and a modified 3 -end blocker (C6 spacer) to prevent probe extension by Taq polymerase (Table 1 and Fig. 1). 2.2. Virologic surveillance, real-time RT-PCR screening, and sequencing The Vietnamese Department of Animal Health (DAH) and the National Centre for Veterinary Diagnostics (NCVD, Hanoi, Vietnam) collected cloacal or oropharyngeal swabs from a variety of domestic poultry from 2007 to 2012. Collection sites included poultry farms, backyard flocks, and live bird markets in at least 39 provinces representing regions in Northern, Central, and Southern Vietnam. Swab specimens were placed in containers with 1.0 ml of virus transport medium and RNA extraction was performed either directly from 100 l of swab/transport medium supernatant or from egg allantoic fluid following a single passage in 10–11 day old embryonated chicken eggs using the Qiagen RNeasy Total Nucleic Acid Extraction Kit (Qiagen). Each specimen was first screened for influenza A matrix gene RNA by real-time RT-PCR (described below)
Table 1 Primers and probes designed for H5N1 clade-specific real-time RT-PCR. Clade specificity
Clade 1.1
Clade 2.3.2.1
Clade 2.3.4.x
Clade 7.x a b c
Primer/probe
Sequence (5 –3 )a , b , c
For 401 Rev 555 Probe 463 For 382 Rev 508 Probe 460 For 410 Rev 614 Probe 547 For 438 Rev 531 Probe 490
CCA AGA GTT CTT GGC CYA GT CTT GGT CGG TAT TAT TGT AAC TCC FAM – CAG GGA AAG TCC “T”CT TTT TTC MGA AAT GTG G GAG AAA ATA CRG ATC ATY CCC AAA GA GCY TTT CTT TAT TRT TGG GTA TGC ATY GTC FAM – CAG GGA AAT TCC “T”CM TTY TTC AGA AAT GTG GT CTT GGY CCG ATC ATG AAG CCT CAT CAG ATA GGT GGY TGG GTT TTG ATA GAG CT FAM – ACC ARC CAG GAA GA“T” CTK TTG ATA CTG TGG GGT GAG CGC AGC ATG TTC CTA TCT CTT CTT GRT TGG YAT TGG TGT AGT TCA CC FAM – GTA TGG CTT AYC AAA AAG AA“T” AAT ACA TAC CCA CC
FAM, 6-carboxyfluorescein. Indicates internally quenched at modified “T” using BHQ1. Modified 3 -end blocker (C6 spacer) to prevent probe extension by Taq polymerase.
Fig. 1. Hemagglutinin (HA) gene diagram showing nucleotide positions of primers and probes used in this study.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
86 87 88 89 90 91 92 93 94 95 96 97 98
99 100
101 102 103 104 105 106 107 108 109 110 111 112 113
G Model VIRMET 12186 1–7
ARTICLE IN PRESS
154 155 156 157 158 159 160 161 162 163 164 165 166
170 171 172
Using prototype strains from each of the clades of interest, including viruses belonging to specific phylogenetic subgroups of clade 2.3.2.1 [designated in Table 2 as subgroups A
1.30E + 10 4.30E + 08 7.00E + 07 4.90E + 06 1.70E + 04 8.90E + 03 5.20E + 02 0 13 17 22 26 29 33 35 −
M HA
21 25 29 33 38 − − − 3.40E + 09 5.10E + 07 6.20E + 06 1.00E + 05 5.90E + 03 9.00E + 02 0 0 16 18 22 26 28 32 − − 17 20 24 27 31 34 − − 8.80E + 09 5.00E + 08 7.00E + 07 6.30E + 06 1.30E + 05 2.30E + 03 0 0 14 18 23 27 31 34 − − 17 20 24 29 33 35 − − 1.60E + 09 7.60E + 08 1.50E + 07 2.00E + 06 2.30E + 05 2.00E + 03 0 0 16 20 23 27 30 34 − − 16 20 24 27 31 34 − − 1.90E + 09 5.10E + 08 3.70E + 07 5.60E + 06 4.80E + 05 3.90E + 03 1.20E + 02 0 16 18 21 25 28 32 34 − 17 18 22 26 29 32 35 − 9.79E + 07 5.31E + 07 4.81E + 06 3.53E + 05 3.00E + 04 2.21E + 03 0 0 18 18 24 28 32 35 − − 18 19 23 27 31 35 − −
7.2
Copy # M HA
7.1
Copy # M HA
2.3.4.3
Copy # M HA
− Indicates no Ct detected. NTC; no template control. a Indicates a specific phylogenetic subgroup of the clade: A (A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group). b Indicates ct value using either the clade-specific HA gene assay or M gene assay. c Indicates viral RNA copy number determined using RT-qPCR M gene assay.
153
9.50E + 09 6.40E + 07 1.00E + 06 2.40E + 05 5.10E + 03 7.80E + 02 0 0
152
14 17 20 23 28 34 − −
151
14 17 20 23 27 33 − −
150
1.10E + 10 1.80E + 08 7.60E + 07 4.10E + 06 2.90E + 05 1.90E + 03 0 0
149
12 14 18 21 25 33 − −
148
14 17 20 24 26 35 − −
3.1. Evaluation of primers/probes and assay sensitivity
147
4.00E + 09 3.30E + 08 1.10E + 07 1.60E + 06 9.30E + 05 5.90E + 03 2.80E + 02 0
169
146
15 18 21 25 29 33 34 −
3. Results
145
16 18 22 25 29 33 35 −
168
144
Neat 1.00E−01 1.00E−02 1.00E−03 1.00E−04 1.00E−05 1.00E−06 NTC
167
Universal influenza A virus matrix (M) protein gene specific forward and reverse primers and probe were designed to detect all type A influenza viruses [M-For (5 -CATGGAATGGCTAAAGACAAGACC-3 )]; M-Rev (5 -AGGGCATTTTGGACAAAGCGTCTA3 ); M-Probe (FAM-ACGCTCACCGTGCCCAGT-BHQ1). M gene DNA from a highly pathogenic avian influenza A(H5N1) virus (A/Thailand/16/04) was previously cloned into the pAMP1 vector and amplified by PCR with a M gene forward primer [M-For (5 -GATCGCTCTTCAGGGAGCAAAAGCAGGTAG-3 )] and the M-Rev primer with a T7 promoter added to the 5 end [T7/M-Rev (5 TGTAATACGACTCACTATAGGGCATTT TGGACAAAGCGTC-3 )]. The resulting PCR product was then used for in vitro transcription of M gene RNA using the Riboprobe in vitro Transcription Systems according to the manufacturer (Promega). Following DNase treatment and RNA extraction, the concentration of RNA was measured by spectrophotometry and converted to copy number/l. Dilutions of 1010 copies/l of standard M gene RNA were prepared and stored at −80 ◦ C until further use. 5 l of RNA was used for RT-qPCR in a single-step reaction using the QuantiTech Probe RT-PCR Kit (QIAGEN). Each reaction was run in parallel with standard concentrations of M gene RNA (1010 –102 copies/l) to produce a standard curve used for interpolation of sample viral RNA copy number (Fig. 2). RT-qPCR was performed according to the manufacturer’s protocol with 40 cycles using the Mx3005P QPCR system (Stratagene) or ABI 7500 (Life Technologies).
143
2.3.4.2
140
Copy #
139
M
138
HA
137
2.3.4.1
136
Copy #
135
M
134
HA
2.4. Quantitative real-time RT-PCR (RT-qPCR)
133
Copy #
142
132
M
141
The QuantiTech Probe RT-PCR Kit (Qiagen) and SuperScript III Platinum One-Step Quantitative RT-PCR kit (Invitrogen) were both tested with 12.5 l of Master Mix, 0.25 l reverse transcriptase, 1 l of forward and reverse primers (12 M), 1 l of probe (4 M) and 5.0 l RNA template in a 25 l total reaction volume. Using either the Mx3005 (Stratagene) or ABI 7500 (Life Technologies) real-time thermocyclers, reverse transcription was carried out for 30 min at 50 ◦ C followed by polymerase activation for 2 min at 95 ◦ C. Denaturation for 15 s at 95 ◦ C and annealing-extension for 30 s at 60 ◦ C were performed for 40 cycles to evaluate cycle threshold (Ct) values.
131
HA
128
Copy #
127
M
126
HA
125
Copy
124
2.3.2.1 Ca
123
2.3.2.1 Ba
122
2.3.2.1 Aa
121
#c
120
Mb
119
HAb
118
1.1
117
Clade
2.3. Clade-specific real-time RT-PCR reaction conditions
116
RNA dilution
130
115
Table 2 Clade-specific HA assay limit of detection compared to universal influenza A matrix gene quantitative real-time RT-PCR.
129
and positive samples were subjected to real-time RT-PCR using the clade-specific primer/probe combinations as described above. Approximately 200 samples were characterized for this study and the results from a subset of these (n = 65) are presented in Table 3. Results from the 65 samples were chosen because they represent the full range of Ct values detected by each of the clade-specific realtime RT-PCR assays. Following clade-specific real-time RT-PCR, the full length HA gene was sequenced using the Access Quick one-step RT-PCR kit (Promega) to amplify the gene as overlapping fragments. To confirm clade designations, the amplicons were sequenced on an automated Applied Biosystems 3730 system using cycle sequencing dye terminator chemistry and contigs of the full length HA open reading frame were generated (Sequencher 4.8, Gene Codes). Phylogenetic trees were constructed using MEGA5 (Tamura et al., 2011) and analyzed using the WHO/OIE/FAO H5N1 Evolution Working Group nomenclature (WHO/OIE/FAO, 2012; WHO, 2012a,b).
114
3
Copy #
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
4 Table 3 Clade-specific detection by real-time RT-PCR. Clade
1.1
2.3.2.1
2.3.4.1
2.3.4.2
2.3.4.3
Strain name
A/duck/Vietnam/NCVD-001/2008 A/chicken/Vietnam/NCVD-370/2009 A/duck/Vietnam/NCVD-360/2009 A/chicken/Vietnam/NCVD-380/2009 A/duck/Vietnam/NCVD-361/2009 A/chicken/Vietnam/NCVD-424/2009 A/chicken/Vietnam/NCVD-425/2009 A/muscovy duck/Vietnam/NCVD-426/2009 A/chicken/Vietnam/NCVD-427/2010 A/chicken/Vietnam/NCVD-428/2010 A/chicken/Vietnam/NCVD-429/2010 A/duck/Vietnam/NCVD-430/2010 A/chicken/Vietnam/NCVD-775/2011 A/chicken/Vietnam/NCVD-879/2011 A/chicken/Vietnam/NCVD-779/2011 A/chicken/Vietnam/NCVD-878/2011 A/duck/Vietnam/NCVD-1276/2012 A/chicken/Vietnam/NCVD-1189/2012 A/chicken/Vietnam/NCVD-389/2009 A/chicken/Vietnam/NCVD-390/2009 A/chicken/Vietnam/NCVD-398/2010 A/chicken/Vietnam/NCVD-399/2010 A/chicken/Vietnam/NCVD-421/2010 A/duck/Vietnam/NCVD-423/2010 A/duck/Vietnam/NCVD-431/2010 A/duck/Vietnam/NCVD-432/2010 A/duck/Vietnam/NCVD-456/2010 A/duck/Vietnam/NCVD-457/2010 A/duck/Vietnam/NCVD-458/2010 A/chicken/Vietnam/NCVD-459/2010 A/duck/Vietnam/NCVD-460/2010 A/duck/Vietnam/NCVD-461/2010 A/duck/Vietnam/NCVD-815/2010 A/chicken/Vietnam/NCVD-709/2011 A/duck/Vietnam/NCVD-712/2011 A/chicken/Vietnam/NCVD-715/2011 A/duck/Vietnam/NCVD-760/2011 A/duck/Vietnam/NCVD-806/2011 A/duck/Vietnam/NCVD-825/2011 A/dover/Vietnam/NCVD-1178/2012 A/duck/Vietnam/NCVD-1306/2012 A/duck/Vietnam/NCVD-885/2010 A/duck/Vietnam/NCVD129-7/2011 A/duck/Vietnam/NCVD-1162/2011 A/chicken/Vietnam/NCVD-1254/2012 A/chicken/Vietnam/NCVD-1437/2012 A/duck/Vietnam/NCVD-1940/2012 A/duck/Vietnam/NCVD-1584/2012 A/duck/Vietnam/NCVD-1607/2012 A/duck/Vietnam/NCVD-1544/2012 A/duck/Vietnam/NCVD-1878/2012 A/duck/Vietnam/NCVD-1884/2012 A/duck/Vietnam/NCVD-1931/2012 A/duck/Vietnam/NCVD-343/2009 A/chicken/Vietnam/NCVD-342/2009 A/duck/Vietnam/NCVD-375/2009 A/duck/Vietnam/NCVD-293/2009 A/chicken/Vietnam/NCVD-404/2010 A/chicken/Vietnam/NCVD-406/2010 A/duck/Vietnam/NCVD-422/2010 A/duck/Vietnam/NCVD-462/2010 A/duck/Vietnam/NCVD-471/2010 A/chicken/Vietnam/NCVD-383/2009 A/chicken/Vietnam/NCVD-396/2010 A/chicken/Vietnam/NCVD-397/2010 A/chicken/Vietnam/NCVD-384/2010 A/chicken/Vietnam/NCVD-394/2010 A/Muscovy duck/Vietnam/NCVD-403/2010 A/chicken/Vietnam/NCVD-381/2009 A/duck/Vietnam/NCVD-472/2010 A/duck/Vietnam/NCVD-142/2008 A/duck/Vietnam/NCVD-145/2008 A/duck/Vietnam/NCVD-146/2008 A/chicken/Vietnam/NCVD-086/2008
RRT-PCR Ct values M
1.1
2.3.2.1
2.3.4.x
7.x
12.1 13.9 13.4 12.8 17.3 13.9 12.4 17.2 24.9 21.2 17.1 16.2 27.5 17.3 18.5 18.3 18.2 21.9 14.7 13.4 20.5 22.9 13.2 13.1 17.3 14.5 15.9 11.6 16.2 17.3 16.7 15.7 18 19.4 22.9 27 26.3 20.8 19.7 15.3 22.7 16.2 17.6 23 20.4 24.8 18.8 18.7 18.2 23.3 20.1 19.2 16.4 15.8 23.1 15.6 11.5 13.2 18.7 14.3 18.4 15.4 24.4 22.2 18.6 21.7 17.5 19.4 16.2 12.3 14.8 15.7 15.2 18.5
14.1 12.6 14.2 13.8 17.6 12.2 10.8 14.6 17.9 26.5 15.4 13.9 33.1 19.2 18.8 19.6 16.1 20.9 − − − − − − − − − − − − − 37.9 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
− − − − − − − − − − − − − − − − − − 15.1 14.9 20.1 23.8 13.4 12.9 34.4 35.0 33.6 10.9 14.9 16 15.5 14.8 22 16.3 21.1 24.7 24.4 18.6 18.1 15.4 21.8 15.1 19.7 25 24 25.2 22 18.8 20.4 19.5 17.9 18.9 20.6 − − − − − − − 37.4 − − − − − 38.7 − − − − − − −
− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 16.3 23.6 15.7 11.3 13.8 20.5 15.5 21 16.9 26.6 22.6 19.5 22.3 18.5 20.2 17.1 15.1 14.5 16.9 15.7 25.2
− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 37.7 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
5
Table 3 (Continued ) Clade
Strain name
RRT-PCR Ct values
A/chicken/Vietnam/NCVD-138/2008 A/chicken/Vietnam/NCVD-03/2008 A/chicken/Vietnam/NCVD-04/2008 A/chicken/Vietnam/NCVD-05/2008 A/chicken/Vietnam/NCVD-093/2008 A/chicken/Vietnam/NCVD-swab17/2008 A/turkey/Saudi Arabia/6732-6/2007 A/Pakistan/0540-NAMRU3/2007 A/Egypt/N02127/2010 A/Egypt/N02554/2010 A/Egypt/N03071/2010 A/Egypt/N03072/2010 A/duck/Hunan/795/2002 A/Indonesia/5/2005 A/goose/Guiyang/337/2006 A/goose/Guangdong/1/1996 No Ct
16 15.8 19.1 12.7 12.6 19.3 26.6 16.5 11.3 22.6 19.5 22.3 18.5 20.2 13.8 20.5 −
M
7.1 7.2 2.2 2.2 2.2.1 2.2.1 2.2.1 2.2.1 2.1 2.1.3 4 0 No template control
173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195
(A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group)] (WHO, 2012a,b), this study examined the assay sensitivity by comparing serial dilutions of viral RNA to a universal influenza A matrix gene quantitative real-time RT-PCR assay. All clade-specific primers/probes were able to detect RNA from the homologous H5N1 clade using a range of RNA concentrations (Table 2). 10-fold serially diluted RNA samples were detectable at a limit of detection (LOD) between 120 and 2300 copies for each of the assays, demonstrating comparable limits of detection to the M gene assay. Across the range of RNA concentrations, the Ct values of prototype viruses using clade 1.1, 2.3.2.1, 2.3.4.x and 7.x primers/probes were only slightly higher and occasionally lower than the universal influenza A matrix gene real-time RT-PCR assay indicating comparable sensitivity. One exception was the clade 7 assay relative to a clade 7.2 prototype virus, which had an LOD of 17,000 copies of RNA while the M gene assay had an LOD of 100 copies for these viruses. The Ct values using clade 7 primers/probes against clade 7.2 strains were also 1.5 times higher on average than the universal influenza A matrix gene real-time RT-PCR assay indicating that higher concentrations of clade 7.2 RNA may be necessary to detect these viruses.
1.1 − − − − − − − − − − − − − − − − −
2.3.2.1 − − − − − − − − − − − − − − − − −
2.3.4.x
7.x
28.5 − − − − − − − − − − − − − − − −
− 16.9 21.8 14.3 20.7 22.2 − − − − − − − − − −
3.2. Assessment of assay specificity using field isolates from Vietnam Following optimization steps to assess assay sensitivity, a Ct value cutoff of 35 was established to determine the specificity of each of the clade-specific real-time RT-PCR assays. Due to the identification of false positive results in 7 of 200 samples tested when amplification was carried out for more than 35 cycles (i.e., nonclade specific fluorescence of amplification product at Cts higher than 35), a Ct value of 35 was set as the cutoff. Using this cutoff, all clade-specific primer/probe combinations were found to be 100% specific to viruses within the homologous clade and did not produce false positive results when tested against heterologous viruses (Table 3). No false positive or false negative results were identified when a Ct value cutoff of 35 was set as the final cycle. However, there were several examples of viruses tested whereby heterologous strains did show detectable Ct values higher than 35 indicating the importance of conforming to the established cutoff when interpreting the results. Both the sensitivity and specificity of the assay were additionally tested against viruses from clade 1.1, 2.3.2.1, and 2.3.4.x from countries other than Vietnam, when available, and the assay was found to differentiate between these virus clades as well (data not shown). In addition to the four H5N1 clades analyzed, the assay was tested against a panel of different H5N1 virus clades and determined to be equally specific showing no cross-clade reactivity (Table 3).
196 197
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220
36
4. Discussion
34
221
32 30 28 26
Ct
24 22 20 18 16 14 12 10 1.0E+02
1.0E+03
1.0E+04
1.0E+05
1.0E+06
1.0E+07
1.0E+08
1.0E+09
1.0E+10
Copy number
Fig. 2. Standard curve of control RNA () vs. RNA extracted from unknown isolates () generated by RT-qPCR. Y = −3.385x + 47.10, R2 = 0.997.
This study describes a Taqman real-time RT-PCR assay that can be used, together with a variety of RNA extraction protocols for swab material or virus isolates, to differentiate between each of the four H5N1 clades known to be present in Vietnam. The assay has been validated against sequence-confirmed clade designations following the WHO criteria, using numerous viruses from all seven clades of H5N1 recently found in Vietnam, and has been shown to be both sensitive and specific for the differentiation of H5N1 clades 1.1, 2.3.2.1, 2.3.4.x and 7.x. In addition, the assay was demonstrated to detect recently described subgroups of clade 2.3.2.1 referred to in this study as subgroups A (A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group) (20). All clade-specific primers/probes were able to detect RNA from the appropriate H5N1 clade using a range of reaction conditions, RNA concentrations, and two different commercially available realtime RT-PCR kits without producing false positive/negative results
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238
G Model VIRMET 12186 1–7 6
239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304
ARTICLE IN PRESS Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
when a Ct value cutoff of 35 was set as the final cycle. The Ct values using clade specific primers/probes were comparable to a universal influenza A matrix gene real-time RT-PCR assay with the exception of clade 7 primers/probes tested against clade 7.2 strains from Vietnam, which had on average 1.5 times higher Ct values. Decreased sensitivity to clade 7.2 viruses was likely the result of mismatches in primer and probe regions due to the high genetic diversity described in this clade (WHO/OIE/FAO, 2012). Overall, the LOD of each of the primer/probe combinations was similar to that of the universal M gene (ranging from 102 to 103 viral RNA copies) demonstrating that the assay could be used to test RNA extracted from both high (i.e., egg passaged isolates) and low (i.e., environmental swabs) copy number samples. Previous reports describing the evolution of H5N1 viruses in Vietnam indicate that a high diversity of HA clades have circulated in the country (Buchy et al., 2009; Wan et al., 2008; Davis et al., 2010; Nguyen et al., 2008, 2012). In addition to the more recent introduction and proliferation of clade 2.3.2.1 viruses, the clade 1.1 viruses detected primarily in the Mekong Delta regions of Vietnam and Cambodia continue to circulate and diversify. While clade 2.3.4 viruses were detected less frequently in Vietnam during 2011, this clade remains a potential threat as evidenced from its recent detection in Bangladesh and continued circulation elsewhere (WHO, 2012a,b; Islam et al., 2011). Clades 7.1 and 7.2 H5N1 viruses have also not been detected recently in Vietnam (Nguyen et al., 2012). However, sporadic detection of these clades in neighboring China in recent years indicates the possibility of re-introduction into Vietnam in the future (Li et al., 2010). While many real-time RT-PCR assays have been developed to universally detect the numerous clades and subgroups of H5N1 viruses, few have been designed to target specific clades for the sake of differentiation (Tsukamoto et al., 2012; Gao et al., 2011; Tan et al., 2010; Moore et al., 2010). Thus, utilization of a clade-specific assay may offer a fast and reliable method to not only screen field samples for the various clades known to circulate currently in Vietnam but also a way to monitor for the emergence or re-emergence of H5N1 viruses having distinct HA clades. A similar real-time RT-PCR assay design has been used in Egypt to detect and differentiate between divergent subgroups of clade 2.2.1 circulating in poultry (Abdelwhab et al., 2010a, 2010b). Like the clade-specific assay described herein, the ability to rapidly detect and differentiate between viruses with divergent HA genes, especially those that may be antigenic variants, could prove useful. As veterinary health agencies look to poultry vaccination as a means of controlling disease, early detection and differentiation between the numerous H5N1 clades may prove critical to better match vaccine and circulating field strains. Based on the results of the sensitivity and specificity of the realtime assay, it is recommended that this methodology be used after confirmation of a positive H5N1 sample using currently validated H5N1 diagnostic primers and probes (universal influenza A matrix gene and H5 HA gene real-time RT-PCR). In addition, this assay was developed for research purposes and was not intended as an alternative to standard diagnostic procedures currently used for the detection of highly pathogenic avian influenza A(H5N1) especially those licensed by regulatory authorities for the detection of H5N1 virus in human samples. Performing the clade-specific assay following a primary, positive diagnostic test will allow the results to be fully interpreted together with current diagnostic procedures. This clade-specific assay will allow the user to identify the H5N1 clade of the virus in question prior to confirmatory HA gene sequencing and may provide a useful tool for selecting viruses for HA gene sequencing and further phylogenetic analysis. In addition, the results may allow researchers to obtain preliminary molecular epidemiological results pertaining to specific outbreak investigations and/or other surveillance activities. Finally, the results from this assay may be helpful to determine if a novel clade (or subclade) of H5N1 has been
detected in Vietnam or possibly in other countries where these clades are known to circulate. For example, a positive H5 HA realtime assay with subsequent negative results using each of the four clade-specific primers/probes might indicate either emergence of a novel clade or significant genetic drift of currently circulating viruses. While testing of viruses from outside of Vietnam will be needed to validate the assay further, preliminary data of viruses isolated from other Asian countries indicate that each of the four assays remain stable despite some genetic diversity within the HA gene. Nonetheless, future updates to primers and probes may be necessary as mutations accumulate within assay-specific regions of the HA. Based on these findings, this clade-specific real-time RTPCR test will benefit those laboratories that require rapid H5N1 clade differentiation, have limited sequencing capacity, and/or that may wish to screen H5N1 positive samples for variant or novel strains.
Acknowledgments We thank the Vietnamese Ministry of Agriculture and Rural Development for viruses used in this research. In addition, we thank Ian York and Pierre Rivailler for thoughtful suggestions for this manuscript. The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.
References Abdelwhab, El-S.M., Arafa, A.S., Erfan, A.M., Aly, M.M., Hafez, H.M., 2010a. Modified H5 real-time reverse transcriptase-PCR oligonucleotides for detection of divergent avian influenza H5N1 viruses in Egypt. Avian Dis. 54, 1301–1305. Abdelwhab, El-S.M., Erfan, A.M., Grund, C., Ziller, M., Arafa, A.S., Beer, M., Aly, M.M., Hafez, H.M., Harder, T.C., 2010b. Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper) and escape mutant (clade 2.2.1 variant) lineages in Egypt. Virol. J. 7, 260–267. Beato, M.S., Capua, I., 2011. Transboundary spread of highly pathogenic avian influenza through poultry commodities and wild birds: a review. Rev. Sci. Technol. 1, 51–61. Buchy, P., Fourment, M., Mardy, S., Sorn, S., Holl, D., Ly, S., Vong, S., Enouf, V., Peiris, J.S.M., Van Der Werf, S., 2009. Molecular epidemiology of clade 1 influenza A viruses (H5N1), Southern Indochina Peninsula, 2004–2007. Emerg. Infect. Dis. 15, 1641–1644. Davis, C.T., Balish, A.L., O‘Neill, E., Nguyen, C.V., Cox, N.J., Xiyan, X., Klimov, A., Nguyen, T., Donis, R.O., 2010. Detection and characterization of clade 7 high pathogenicity avian influenza H5N1 viruses in chickens seized at ports of entry and live poultry markets in Vietnam. Avian Dis. 54 (1 Suppl.), 307–312. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Food and Agriculture Organization, 2011. Approaches to controlling, preventing and eliminating H5N1 Highly Pathogenic Avian Influenza in endemic countries. In: Animal Production and Health Paper. No. 171. Rome. http://www.fao.org/docrep/014/i2150e/i2150e.pdf (accessed 20.02.13). Gao, R., Gao, Y., Wen, L., Shao, M., Zou, S., Li, C., Yang, L., Li, X., Wang, W., Shu, Y., 2011. Development and implementation of the quality control panel of RT-PCR and real time RT-PCR for avian influenza A (H5N1) surveillance network in mainland China. BMC Infect. Dis. 11, 67–75. Islam, M.R., Haque, M.E., Giasuddin, M., Chowdhury, E.H., Samad, M.A., Parvin, R., Nooruzzaman, M., Rahman, M.M., Monoura, P., 2011. New introduction of clade 2.3.2.1 avian influenza virus (H5N1) into Bangladesh. Transbound Emerg. Dis. 59, 460–463. Li, X.H., Tian, H.D., Heiner, M., Li, D.M., 2011. Global occurrence and spread of highly pathogenic avian influenza virus of the subtype H5N1. Avian Dis. 55, 21–28. Li, Y., Shi, J., Zhong, G., Deng, G., Tian, G., Ge, J., Zeng, X., Song, J., Zhao, D., Liu, L., Jiang, Y., Guan, Y., Bu, Z., Chen, H., 2010. Continued evolution of H5N1 influenza viruses in wild birds, domestic poultry, and humans in China from 2004 to 2009. J. Virol. 84, 8389–8397. L‘Vov, D.K., Zhchelkanov, M., Vlasov, N.A., Prilipov, A.G., Deriabin, P.G., Fediakina, I.T., Galkina, I.V., Zaberezhnyi, A.D., 2008. The first break-through of the genotype 2.3.2 of high-virulence influenza A virus A/H5N1, which is new for Russia, in the Far East. Vopr. Virusol. 53, 4–8. Moore, C., Telles, J.N., Corden, S., Gao, R.B., Vernet, G., Van Aarle, P., Shu, Y.L., 2010. Development and validation of a commercial real-time NASBA assay for the rapid confirmation of influenza A H5N1 virus in clinical samples. J. Virol. Methods 170, 173–176.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320
321
322 323 324 325 326 327
328
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375
G Model VIRMET 12186 1–7
ARTICLE IN PRESS Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404
Nguyen, T.D., Nguyen, T.V., Vijaykrishna, D., Webster, R.G., Guan, Y., Peiris, M.J.S., Smith, G.J., 2008. Multiple sublineages of influenza A virus (H5N1), Vietnam, 2005–2007. Emerg. Infect. Dis. 14, 632–636. Nguyen, T., Rivailler, P., Davis, C.T., Hoa, D.T., Balish, A., Dang, N.H., Jones, J., Vui, D.T., Simpson, N., Huong, N.T., Shu, B., Loughlin, R., Ferdinand, K., Lindstrom, S.E., York, I.A., Klimov, A.I., Donis, R.O., 2012. Evolution of highly pathogenic avian influenza (H5N1) virus populations in Vietnam between 2007 and 2010. Virology 432, 405–416. Sakoda, Y., Sugar, S., Batchluun, D., Erdene-Ochir, T., Okamatsu, M., 2010. Characterization of H5N1 highly pathogenic avian influenza virus strains isolated from migratory waterfowl in Mongolia on the way back from the southern Asia to their northern territory. Virology 406, 88–94. Takakuwa, H., Yamashiro, T., Le, M.Q., Phuong, L.S., Ozaki, H., Tsunekuni, R., Usui, T., Ito, H., Morimatsu, M., Tomioka, Y., Yamaguchi, T., Ito, T., Murase, T., Ono, E., Otsuki, K., 2012. Molecular epidemiology of avian influenza viruses circulating among healthy poultry flocks in farms in northern Vietnam. Prev. Vet. Med. 103, 192–200. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tan, T., Pawestri, H.P., My, N.N., Minh, H.M., Syahrial, H., Vu, T.N., van Doorn, H.R., Wertheim, H.F., Van Vinh, C.N., Quang, H.D., Farrar, J.J., Tinh, H.T., Sedyaningsih, E.R., de Jong, M.D., 2010. A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes. Virol. J. 7, 46–51. Tsukamoto, K., Javier, P.C., Shishido, M., Noguchi, D., Pearce, J., Kang, H.M., Jeong, O.M., Lee, Y.J., Nakanishi, K., Ashizawa, T., 2012. SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests. J. Clin. Microbiol. 50, 37–45.
7
Wan, X.F., Dong, L., Lan, Y., Long, L.P., Xu, C., Zou, S., Li, Z., Wen, L., Cai, Z., Wang, W., Li, X., Yuan, F., Sui, H., Zhang, Y., Dong, J., Sun, S., Gao, Y., Wang, M., Bai, T., Yang, L., Li, D., Yang, W., Yu, H., Wang, S., Feng, Z., Wang, Y., Guo, Y., Webby, R.J., Shu, Y., 2011. Indications that live poultry markets are a major source of human H5N1 influenza virus infection in China. J. Virol. 85, 13432–13438. Wan, X.F., Nguyen, T., Davis, C.T., Smith, C.B., Zhao, Z.M., Carrel, M., Inui, K., Do, H.T., Mai, D.T., Jadhao, S., Balish, A., Shu, B., Luo, F., Emch, M., Matsuoka, Y., Lindstrom, S.E., Cox, N.J., Nguyen, C.V., Klimov, A., Donis, R.O., 2008. Evolution of highly pathogenic H5N1 avian influenza viruses in Vietnam between 2001 and 2007. PLoS ONE 3, e3462. Wibawa, H., Henning, J., Wong, F., Selleck, P., Junaidi, A., Bingham, J., Daniels, P., Meers, J., 2011. A molecular and antigenic survey of H5N1 highly pathogenic avian influenzavirus isolates from small holder duck farms in Central Java, Indonesia during 2007–2008. Virol. J. 8, 425–429. World Health Organization, 2012. Cumulative number of confirmed human cases of avian influenza A(H5N1) reported to WHO. http://www.who.int/influenza/ human animal interface/en/ (accessed 31.12.12). World Health Organization, 2012. Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses pandemic preparedness. www.who.int/influenza/vaccines/virus/ for 201209 h5h7h9 vaccinevirusupdate.pdf (accessed 20.02.12). WHO/OIE/FAO H5N1 Evolution Working Group, 2008. Toward a unified nomenclature system for highly pathogenic avian influenza virus (H5N1). Emerg. Infect. Dis. 14 (7), e1, http://dx.doi.org/10.3201/eid1407.071681. WHO/OIE/FAO H5N1 Evolution Working Group, 2009. Continuing progress towards a unified nomenclature for the highly pathogenic H5N1 avian influenza viruses: divergence of clade 2.2 viruses. Influenza Other Respir. Viruses 3, 59–62. WHO/OIE/FAO H5N1 Evolution Working Group, 2012. Continued evolution of highly pathogenic avian influenza A(H5N1): updated nomenclature. Influenza Other Respir. Viruses 6, 1–5.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434
ARTICLE IN PRESS Journal of Virological Methods xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam
1
2
3 4 5 6 7 8 9
Q1
Z. Kis a,b , J. Jones a , A. Creanga a , K. Ferdinand a , K. Inui c , N. Gerloff a , C.T. Davis a , T. Nguyen d,e , R.O. Donis a,∗ a
Influenza Division, CDC, USA National Center for Epidemiology, Budapest, Hungary c Food and Agriculture Organization of Vietnam, Hanoi, Viet Nam d Hanoi University of Agriculture, Graduate School, Hanoi, Viet Nam e National Centre for Veterinary Diagnostics, Department of Animal Health, Hanoi, Viet Nam b
10
a b s t r a c t
11 12 13 14 15 16
Article history: Received 22 February 2013 Received in revised form 9 June 2013 Accepted 14 June 2013 Available online xxx
17 18 19 20 21 22 23
Keywords: Highly pathogenic avian influenza H5N1 Real-time RT-PCR Clade-differentiation Vietnam
Continued circulation and geographical expansion of highly pathogenic avian influenza H5N1 virus have led to the emergence of numerous clades in Vietnam. Although viral RNA sequencing and phylogenetic analysis are the gold standard for H5N1 HA clade designation, limited sequencing capacity in many laboratories precludes rapid H5N1 clade identification and detection of novel viruses. Therefore, a Taqman real-time RT-PCR assay for rapid differentiation of the four major H5N1 clades detected in Vietnam was developed. Using HA sequence alignments of clades 1.1, 2.3.2.1, 2.3.4, and 7 viruses, primers and FAMlabeled probes were designed to target conserved regions characteristic of each clade. The assay was optimized and evaluated using circulating clades of H5N1 collected in Vietnam from 2007 to 2012 and shown to be both sensitive and specific for the differentiation of the four H5N1 clades. The assay provides a useful tool for screening of large specimen collections for HA gene sequencing and phylogenetic analysis and for the rapid identification of molecular clade signatures to support outbreak investigations and surveillance activities. Finally, this assay may be useful to monitor for the emergence of novel or variant clades of H5N1 in Vietnam in the future or in other countries where these particular clades may circulate. © 2013 Elsevier B.V. All rights reserved.
24
25 26 27 28 29 30 31 32 33 34 35 36 37
1. Introduction The highly pathogenic avian influenza A H5N1 viruses have now appeared in over 60 countries on three continents and continue to infect humans and birds (Beato and Capua, 2011; FAO, 2011; Li et al., 2011). Through December 2012, at least 610 human infections and 360 deaths have occurred (WHO, 2012a,b). In addition, sporadic and sustained poultry outbreaks continue to occur across the Eastern Hemisphere resulting in severe losses to the poultry industry of the affected countries (Wan et al., 2011; Takakuwa et al., 2012; Wibawa et al., 2011). H5N1 is now considered to be enzootic in several countries despite efforts to eliminate the disease using various methods, such as stamping-out and vaccination. In addition, the virus continues to spread via migratory birds and poultry trade leading to detection of viruses outside regions of
∗ Corresponding author at: Influenza Division, NCIRD, Centers for Disease Control & Prevention, 1600 Clifton Road, NE, MS-G16, Atlanta, GA 30333, USA. Tel.: +1 404 639 4968; fax: +1 404 639 2350. E-mail addresses: [email protected], [email protected] (R.O. Donis).
endemicity (FAO, 2011; Sakoda et al., 2010; L‘Vov et al., 2008). As a consequence, viral evolution acting in concert with both local endemicity and regional spread has led to the emergence of distinct genetic groups (clades). In order to keep up with this divergence, the WHO/OIE/FAO H5N1 Evolution Working Group established a nomenclature system based on hemagglutinin (HA) sequences to identify clades of H5N1 (WHO/OIE/FAO, 2008, 2009, 2012). The molecular epidemiology of H5N1 in Vietnam has been unique in that multiple clades of the virus have been detected over the past decade (Buchy et al., 2009; Wan et al., 2008; Davis et al., 2010; Nguyen et al., 2008, 2012). Since 2001, at least fourteen different HA clades have been identified from birds in Vietnam. At least seven of these clades have been identified in consecutive years indicating consistent circulation. Although there remains some spatial association of clade distribution within Vietnam (e.g., clade 1.1 in the Mekong Delta), the continued introduction and re-introduction of viruses into the country has complicated the phylogeography of the virus (Nguyen et al., 2012). In order to provide a tool for the rapid prediction of HA clades prior to confirmatory sequencing a single-plex Taqman real-time RT-PCR assay to differentiate between the major clades of HPAI
0166-0934/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2013.06.023
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
2
76
H5N1 in Vietnam was designed. Using HA sequence alignments of clades 1.1, 2.3.2.1, 2.3.4.1, 2.3.4.2, 2.3.4.3, 7.1 and 7.2 viruses collected in Vietnam and neighboring countries from 2007 to 2012, primers and FAM-labeled probes were designed to target conserved regions specific for each clade. The assay was optimized and evaluated using RNA extracted both from contemporary H5N1 virus isolates and from cloacal swabs from Vietnamese poultry, and was shown to be sensitive and specific for the detection and differentiation of H5N1 viruses belonging to clades 1.1, 2.3.2.1, 2.3.4.x and 7.x (7.1 or 7.2). Comparison to a universal influenza A matrix gene quantitative real-time RT-PCR assay demonstrated that each of the four clade-differentiation assays had a similar limit of detection of influenza A RNA. Thus, this assay may be useful as a screening tool to assess changes in the molecular epidemiology of H5N1 in Vietnam and potentially other countries with similar genetic groups in circulation. In addition, the assay may be a valuable tool in the early detection of novel or variant H5N1 virus strains in Vietnam and serve as a complement to existing H5N1 diagnostic platforms.
77
2. Material and methods
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
78 79
80 81 82 83 84 85
2.1. Primer/probe design for clade-specific real-time RT-PCR detection Highly pathogenic avian influenza (H5N1) virus hemagglutinin (HA) genes containing at least the full length HA1 region were downloaded from GenBank and aligned using MUSCLE (Edgar, 2004) together with HA sequences from recent H5N1 viruses collected in Vietnam (GISAID accession numbers EPI284431–EPI284593). The alignment was trimmed to include
only sequences collected from 2007 to 2012 in the Eastern Asian region and to include only viruses from clades 1.1, 2.3.2.1, 2.3.4.1, 2.3.4.2, 2.3.4.3, 7.1 and 7.2 as determined using the WHO/OIE/FAO H5N1 Evolution Working Group criteria (WHO/OIE/FAO, 2008, 2009, 2012). Initially, forward and reverse primers were designed based on nucleotide conservation within each clade of interest and RT-PCR reactions were performed, followed by gel electrophoresis, to demonstrate clade-specific amplification (approx. 150 nucleotide amplicons) of template RNA. After appropriate forward and reverse primers were selected (Table 1), probes were designed with a FAM labeled 5 end, an internally quenched modified “T” using BHQ1, and a modified 3 -end blocker (C6 spacer) to prevent probe extension by Taq polymerase (Table 1 and Fig. 1). 2.2. Virologic surveillance, real-time RT-PCR screening, and sequencing The Vietnamese Department of Animal Health (DAH) and the National Centre for Veterinary Diagnostics (NCVD, Hanoi, Vietnam) collected cloacal or oropharyngeal swabs from a variety of domestic poultry from 2007 to 2012. Collection sites included poultry farms, backyard flocks, and live bird markets in at least 39 provinces representing regions in Northern, Central, and Southern Vietnam. Swab specimens were placed in containers with 1.0 ml of virus transport medium and RNA extraction was performed either directly from 100 l of swab/transport medium supernatant or from egg allantoic fluid following a single passage in 10–11 day old embryonated chicken eggs using the Qiagen RNeasy Total Nucleic Acid Extraction Kit (Qiagen). Each specimen was first screened for influenza A matrix gene RNA by real-time RT-PCR (described below)
Table 1 Primers and probes designed for H5N1 clade-specific real-time RT-PCR. Clade specificity
Clade 1.1
Clade 2.3.2.1
Clade 2.3.4.x
Clade 7.x a b c
Primer/probe
Sequence (5 –3 )a , b , c
For 401 Rev 555 Probe 463 For 382 Rev 508 Probe 460 For 410 Rev 614 Probe 547 For 438 Rev 531 Probe 490
CCA AGA GTT CTT GGC CYA GT CTT GGT CGG TAT TAT TGT AAC TCC FAM – CAG GGA AAG TCC “T”CT TTT TTC MGA AAT GTG G GAG AAA ATA CRG ATC ATY CCC AAA GA GCY TTT CTT TAT TRT TGG GTA TGC ATY GTC FAM – CAG GGA AAT TCC “T”CM TTY TTC AGA AAT GTG GT CTT GGY CCG ATC ATG AAG CCT CAT CAG ATA GGT GGY TGG GTT TTG ATA GAG CT FAM – ACC ARC CAG GAA GA“T” CTK TTG ATA CTG TGG GGT GAG CGC AGC ATG TTC CTA TCT CTT CTT GRT TGG YAT TGG TGT AGT TCA CC FAM – GTA TGG CTT AYC AAA AAG AA“T” AAT ACA TAC CCA CC
FAM, 6-carboxyfluorescein. Indicates internally quenched at modified “T” using BHQ1. Modified 3 -end blocker (C6 spacer) to prevent probe extension by Taq polymerase.
Fig. 1. Hemagglutinin (HA) gene diagram showing nucleotide positions of primers and probes used in this study.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
86 87 88 89 90 91 92 93 94 95 96 97 98
99 100
101 102 103 104 105 106 107 108 109 110 111 112 113
G Model VIRMET 12186 1–7
ARTICLE IN PRESS
154 155 156 157 158 159 160 161 162 163 164 165 166
170 171 172
Using prototype strains from each of the clades of interest, including viruses belonging to specific phylogenetic subgroups of clade 2.3.2.1 [designated in Table 2 as subgroups A
1.30E + 10 4.30E + 08 7.00E + 07 4.90E + 06 1.70E + 04 8.90E + 03 5.20E + 02 0 13 17 22 26 29 33 35 −
M HA
21 25 29 33 38 − − − 3.40E + 09 5.10E + 07 6.20E + 06 1.00E + 05 5.90E + 03 9.00E + 02 0 0 16 18 22 26 28 32 − − 17 20 24 27 31 34 − − 8.80E + 09 5.00E + 08 7.00E + 07 6.30E + 06 1.30E + 05 2.30E + 03 0 0 14 18 23 27 31 34 − − 17 20 24 29 33 35 − − 1.60E + 09 7.60E + 08 1.50E + 07 2.00E + 06 2.30E + 05 2.00E + 03 0 0 16 20 23 27 30 34 − − 16 20 24 27 31 34 − − 1.90E + 09 5.10E + 08 3.70E + 07 5.60E + 06 4.80E + 05 3.90E + 03 1.20E + 02 0 16 18 21 25 28 32 34 − 17 18 22 26 29 32 35 − 9.79E + 07 5.31E + 07 4.81E + 06 3.53E + 05 3.00E + 04 2.21E + 03 0 0 18 18 24 28 32 35 − − 18 19 23 27 31 35 − −
7.2
Copy # M HA
7.1
Copy # M HA
2.3.4.3
Copy # M HA
− Indicates no Ct detected. NTC; no template control. a Indicates a specific phylogenetic subgroup of the clade: A (A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group). b Indicates ct value using either the clade-specific HA gene assay or M gene assay. c Indicates viral RNA copy number determined using RT-qPCR M gene assay.
153
9.50E + 09 6.40E + 07 1.00E + 06 2.40E + 05 5.10E + 03 7.80E + 02 0 0
152
14 17 20 23 28 34 − −
151
14 17 20 23 27 33 − −
150
1.10E + 10 1.80E + 08 7.60E + 07 4.10E + 06 2.90E + 05 1.90E + 03 0 0
149
12 14 18 21 25 33 − −
148
14 17 20 24 26 35 − −
3.1. Evaluation of primers/probes and assay sensitivity
147
4.00E + 09 3.30E + 08 1.10E + 07 1.60E + 06 9.30E + 05 5.90E + 03 2.80E + 02 0
169
146
15 18 21 25 29 33 34 −
3. Results
145
16 18 22 25 29 33 35 −
168
144
Neat 1.00E−01 1.00E−02 1.00E−03 1.00E−04 1.00E−05 1.00E−06 NTC
167
Universal influenza A virus matrix (M) protein gene specific forward and reverse primers and probe were designed to detect all type A influenza viruses [M-For (5 -CATGGAATGGCTAAAGACAAGACC-3 )]; M-Rev (5 -AGGGCATTTTGGACAAAGCGTCTA3 ); M-Probe (FAM-ACGCTCACCGTGCCCAGT-BHQ1). M gene DNA from a highly pathogenic avian influenza A(H5N1) virus (A/Thailand/16/04) was previously cloned into the pAMP1 vector and amplified by PCR with a M gene forward primer [M-For (5 -GATCGCTCTTCAGGGAGCAAAAGCAGGTAG-3 )] and the M-Rev primer with a T7 promoter added to the 5 end [T7/M-Rev (5 TGTAATACGACTCACTATAGGGCATTT TGGACAAAGCGTC-3 )]. The resulting PCR product was then used for in vitro transcription of M gene RNA using the Riboprobe in vitro Transcription Systems according to the manufacturer (Promega). Following DNase treatment and RNA extraction, the concentration of RNA was measured by spectrophotometry and converted to copy number/l. Dilutions of 1010 copies/l of standard M gene RNA were prepared and stored at −80 ◦ C until further use. 5 l of RNA was used for RT-qPCR in a single-step reaction using the QuantiTech Probe RT-PCR Kit (QIAGEN). Each reaction was run in parallel with standard concentrations of M gene RNA (1010 –102 copies/l) to produce a standard curve used for interpolation of sample viral RNA copy number (Fig. 2). RT-qPCR was performed according to the manufacturer’s protocol with 40 cycles using the Mx3005P QPCR system (Stratagene) or ABI 7500 (Life Technologies).
143
2.3.4.2
140
Copy #
139
M
138
HA
137
2.3.4.1
136
Copy #
135
M
134
HA
2.4. Quantitative real-time RT-PCR (RT-qPCR)
133
Copy #
142
132
M
141
The QuantiTech Probe RT-PCR Kit (Qiagen) and SuperScript III Platinum One-Step Quantitative RT-PCR kit (Invitrogen) were both tested with 12.5 l of Master Mix, 0.25 l reverse transcriptase, 1 l of forward and reverse primers (12 M), 1 l of probe (4 M) and 5.0 l RNA template in a 25 l total reaction volume. Using either the Mx3005 (Stratagene) or ABI 7500 (Life Technologies) real-time thermocyclers, reverse transcription was carried out for 30 min at 50 ◦ C followed by polymerase activation for 2 min at 95 ◦ C. Denaturation for 15 s at 95 ◦ C and annealing-extension for 30 s at 60 ◦ C were performed for 40 cycles to evaluate cycle threshold (Ct) values.
131
HA
128
Copy #
127
M
126
HA
125
Copy
124
2.3.2.1 Ca
123
2.3.2.1 Ba
122
2.3.2.1 Aa
121
#c
120
Mb
119
HAb
118
1.1
117
Clade
2.3. Clade-specific real-time RT-PCR reaction conditions
116
RNA dilution
130
115
Table 2 Clade-specific HA assay limit of detection compared to universal influenza A matrix gene quantitative real-time RT-PCR.
129
and positive samples were subjected to real-time RT-PCR using the clade-specific primer/probe combinations as described above. Approximately 200 samples were characterized for this study and the results from a subset of these (n = 65) are presented in Table 3. Results from the 65 samples were chosen because they represent the full range of Ct values detected by each of the clade-specific realtime RT-PCR assays. Following clade-specific real-time RT-PCR, the full length HA gene was sequenced using the Access Quick one-step RT-PCR kit (Promega) to amplify the gene as overlapping fragments. To confirm clade designations, the amplicons were sequenced on an automated Applied Biosystems 3730 system using cycle sequencing dye terminator chemistry and contigs of the full length HA open reading frame were generated (Sequencher 4.8, Gene Codes). Phylogenetic trees were constructed using MEGA5 (Tamura et al., 2011) and analyzed using the WHO/OIE/FAO H5N1 Evolution Working Group nomenclature (WHO/OIE/FAO, 2012; WHO, 2012a,b).
114
3
Copy #
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
4 Table 3 Clade-specific detection by real-time RT-PCR. Clade
1.1
2.3.2.1
2.3.4.1
2.3.4.2
2.3.4.3
Strain name
A/duck/Vietnam/NCVD-001/2008 A/chicken/Vietnam/NCVD-370/2009 A/duck/Vietnam/NCVD-360/2009 A/chicken/Vietnam/NCVD-380/2009 A/duck/Vietnam/NCVD-361/2009 A/chicken/Vietnam/NCVD-424/2009 A/chicken/Vietnam/NCVD-425/2009 A/muscovy duck/Vietnam/NCVD-426/2009 A/chicken/Vietnam/NCVD-427/2010 A/chicken/Vietnam/NCVD-428/2010 A/chicken/Vietnam/NCVD-429/2010 A/duck/Vietnam/NCVD-430/2010 A/chicken/Vietnam/NCVD-775/2011 A/chicken/Vietnam/NCVD-879/2011 A/chicken/Vietnam/NCVD-779/2011 A/chicken/Vietnam/NCVD-878/2011 A/duck/Vietnam/NCVD-1276/2012 A/chicken/Vietnam/NCVD-1189/2012 A/chicken/Vietnam/NCVD-389/2009 A/chicken/Vietnam/NCVD-390/2009 A/chicken/Vietnam/NCVD-398/2010 A/chicken/Vietnam/NCVD-399/2010 A/chicken/Vietnam/NCVD-421/2010 A/duck/Vietnam/NCVD-423/2010 A/duck/Vietnam/NCVD-431/2010 A/duck/Vietnam/NCVD-432/2010 A/duck/Vietnam/NCVD-456/2010 A/duck/Vietnam/NCVD-457/2010 A/duck/Vietnam/NCVD-458/2010 A/chicken/Vietnam/NCVD-459/2010 A/duck/Vietnam/NCVD-460/2010 A/duck/Vietnam/NCVD-461/2010 A/duck/Vietnam/NCVD-815/2010 A/chicken/Vietnam/NCVD-709/2011 A/duck/Vietnam/NCVD-712/2011 A/chicken/Vietnam/NCVD-715/2011 A/duck/Vietnam/NCVD-760/2011 A/duck/Vietnam/NCVD-806/2011 A/duck/Vietnam/NCVD-825/2011 A/dover/Vietnam/NCVD-1178/2012 A/duck/Vietnam/NCVD-1306/2012 A/duck/Vietnam/NCVD-885/2010 A/duck/Vietnam/NCVD129-7/2011 A/duck/Vietnam/NCVD-1162/2011 A/chicken/Vietnam/NCVD-1254/2012 A/chicken/Vietnam/NCVD-1437/2012 A/duck/Vietnam/NCVD-1940/2012 A/duck/Vietnam/NCVD-1584/2012 A/duck/Vietnam/NCVD-1607/2012 A/duck/Vietnam/NCVD-1544/2012 A/duck/Vietnam/NCVD-1878/2012 A/duck/Vietnam/NCVD-1884/2012 A/duck/Vietnam/NCVD-1931/2012 A/duck/Vietnam/NCVD-343/2009 A/chicken/Vietnam/NCVD-342/2009 A/duck/Vietnam/NCVD-375/2009 A/duck/Vietnam/NCVD-293/2009 A/chicken/Vietnam/NCVD-404/2010 A/chicken/Vietnam/NCVD-406/2010 A/duck/Vietnam/NCVD-422/2010 A/duck/Vietnam/NCVD-462/2010 A/duck/Vietnam/NCVD-471/2010 A/chicken/Vietnam/NCVD-383/2009 A/chicken/Vietnam/NCVD-396/2010 A/chicken/Vietnam/NCVD-397/2010 A/chicken/Vietnam/NCVD-384/2010 A/chicken/Vietnam/NCVD-394/2010 A/Muscovy duck/Vietnam/NCVD-403/2010 A/chicken/Vietnam/NCVD-381/2009 A/duck/Vietnam/NCVD-472/2010 A/duck/Vietnam/NCVD-142/2008 A/duck/Vietnam/NCVD-145/2008 A/duck/Vietnam/NCVD-146/2008 A/chicken/Vietnam/NCVD-086/2008
RRT-PCR Ct values M
1.1
2.3.2.1
2.3.4.x
7.x
12.1 13.9 13.4 12.8 17.3 13.9 12.4 17.2 24.9 21.2 17.1 16.2 27.5 17.3 18.5 18.3 18.2 21.9 14.7 13.4 20.5 22.9 13.2 13.1 17.3 14.5 15.9 11.6 16.2 17.3 16.7 15.7 18 19.4 22.9 27 26.3 20.8 19.7 15.3 22.7 16.2 17.6 23 20.4 24.8 18.8 18.7 18.2 23.3 20.1 19.2 16.4 15.8 23.1 15.6 11.5 13.2 18.7 14.3 18.4 15.4 24.4 22.2 18.6 21.7 17.5 19.4 16.2 12.3 14.8 15.7 15.2 18.5
14.1 12.6 14.2 13.8 17.6 12.2 10.8 14.6 17.9 26.5 15.4 13.9 33.1 19.2 18.8 19.6 16.1 20.9 − − − − − − − − − − − − − 37.9 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
− − − − − − − − − − − − − − − − − − 15.1 14.9 20.1 23.8 13.4 12.9 34.4 35.0 33.6 10.9 14.9 16 15.5 14.8 22 16.3 21.1 24.7 24.4 18.6 18.1 15.4 21.8 15.1 19.7 25 24 25.2 22 18.8 20.4 19.5 17.9 18.9 20.6 − − − − − − − 37.4 − − − − − 38.7 − − − − − − −
− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 16.3 23.6 15.7 11.3 13.8 20.5 15.5 21 16.9 26.6 22.6 19.5 22.3 18.5 20.2 17.1 15.1 14.5 16.9 15.7 25.2
− − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − 37.7 − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − −
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
ARTICLE IN PRESS
G Model VIRMET 12186 1–7
Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
5
Table 3 (Continued ) Clade
Strain name
RRT-PCR Ct values
A/chicken/Vietnam/NCVD-138/2008 A/chicken/Vietnam/NCVD-03/2008 A/chicken/Vietnam/NCVD-04/2008 A/chicken/Vietnam/NCVD-05/2008 A/chicken/Vietnam/NCVD-093/2008 A/chicken/Vietnam/NCVD-swab17/2008 A/turkey/Saudi Arabia/6732-6/2007 A/Pakistan/0540-NAMRU3/2007 A/Egypt/N02127/2010 A/Egypt/N02554/2010 A/Egypt/N03071/2010 A/Egypt/N03072/2010 A/duck/Hunan/795/2002 A/Indonesia/5/2005 A/goose/Guiyang/337/2006 A/goose/Guangdong/1/1996 No Ct
16 15.8 19.1 12.7 12.6 19.3 26.6 16.5 11.3 22.6 19.5 22.3 18.5 20.2 13.8 20.5 −
M
7.1 7.2 2.2 2.2 2.2.1 2.2.1 2.2.1 2.2.1 2.1 2.1.3 4 0 No template control
173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195
(A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group)] (WHO, 2012a,b), this study examined the assay sensitivity by comparing serial dilutions of viral RNA to a universal influenza A matrix gene quantitative real-time RT-PCR assay. All clade-specific primers/probes were able to detect RNA from the homologous H5N1 clade using a range of RNA concentrations (Table 2). 10-fold serially diluted RNA samples were detectable at a limit of detection (LOD) between 120 and 2300 copies for each of the assays, demonstrating comparable limits of detection to the M gene assay. Across the range of RNA concentrations, the Ct values of prototype viruses using clade 1.1, 2.3.2.1, 2.3.4.x and 7.x primers/probes were only slightly higher and occasionally lower than the universal influenza A matrix gene real-time RT-PCR assay indicating comparable sensitivity. One exception was the clade 7 assay relative to a clade 7.2 prototype virus, which had an LOD of 17,000 copies of RNA while the M gene assay had an LOD of 100 copies for these viruses. The Ct values using clade 7 primers/probes against clade 7.2 strains were also 1.5 times higher on average than the universal influenza A matrix gene real-time RT-PCR assay indicating that higher concentrations of clade 7.2 RNA may be necessary to detect these viruses.
1.1 − − − − − − − − − − − − − − − − −
2.3.2.1 − − − − − − − − − − − − − − − − −
2.3.4.x
7.x
28.5 − − − − − − − − − − − − − − − −
− 16.9 21.8 14.3 20.7 22.2 − − − − − − − − − −
3.2. Assessment of assay specificity using field isolates from Vietnam Following optimization steps to assess assay sensitivity, a Ct value cutoff of 35 was established to determine the specificity of each of the clade-specific real-time RT-PCR assays. Due to the identification of false positive results in 7 of 200 samples tested when amplification was carried out for more than 35 cycles (i.e., nonclade specific fluorescence of amplification product at Cts higher than 35), a Ct value of 35 was set as the cutoff. Using this cutoff, all clade-specific primer/probe combinations were found to be 100% specific to viruses within the homologous clade and did not produce false positive results when tested against heterologous viruses (Table 3). No false positive or false negative results were identified when a Ct value cutoff of 35 was set as the final cycle. However, there were several examples of viruses tested whereby heterologous strains did show detectable Ct values higher than 35 indicating the importance of conforming to the established cutoff when interpreting the results. Both the sensitivity and specificity of the assay were additionally tested against viruses from clade 1.1, 2.3.2.1, and 2.3.4.x from countries other than Vietnam, when available, and the assay was found to differentiate between these virus clades as well (data not shown). In addition to the four H5N1 clades analyzed, the assay was tested against a panel of different H5N1 virus clades and determined to be equally specific showing no cross-clade reactivity (Table 3).
196 197
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220
36
4. Discussion
34
221
32 30 28 26
Ct
24 22 20 18 16 14 12 10 1.0E+02
1.0E+03
1.0E+04
1.0E+05
1.0E+06
1.0E+07
1.0E+08
1.0E+09
1.0E+10
Copy number
Fig. 2. Standard curve of control RNA () vs. RNA extracted from unknown isolates () generated by RT-qPCR. Y = −3.385x + 47.10, R2 = 0.997.
This study describes a Taqman real-time RT-PCR assay that can be used, together with a variety of RNA extraction protocols for swab material or virus isolates, to differentiate between each of the four H5N1 clades known to be present in Vietnam. The assay has been validated against sequence-confirmed clade designations following the WHO criteria, using numerous viruses from all seven clades of H5N1 recently found in Vietnam, and has been shown to be both sensitive and specific for the differentiation of H5N1 clades 1.1, 2.3.2.1, 2.3.4.x and 7.x. In addition, the assay was demonstrated to detect recently described subgroups of clade 2.3.2.1 referred to in this study as subgroups A (A/Hubei/1/2010-like genetic group), B (A/barn swallow/Hong Kong/D10-1161/2010-like genetic group) and C (A/Hong Kong/6841/2010-like genetic group) (20). All clade-specific primers/probes were able to detect RNA from the appropriate H5N1 clade using a range of reaction conditions, RNA concentrations, and two different commercially available realtime RT-PCR kits without producing false positive/negative results
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238
G Model VIRMET 12186 1–7 6
239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304
ARTICLE IN PRESS Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
when a Ct value cutoff of 35 was set as the final cycle. The Ct values using clade specific primers/probes were comparable to a universal influenza A matrix gene real-time RT-PCR assay with the exception of clade 7 primers/probes tested against clade 7.2 strains from Vietnam, which had on average 1.5 times higher Ct values. Decreased sensitivity to clade 7.2 viruses was likely the result of mismatches in primer and probe regions due to the high genetic diversity described in this clade (WHO/OIE/FAO, 2012). Overall, the LOD of each of the primer/probe combinations was similar to that of the universal M gene (ranging from 102 to 103 viral RNA copies) demonstrating that the assay could be used to test RNA extracted from both high (i.e., egg passaged isolates) and low (i.e., environmental swabs) copy number samples. Previous reports describing the evolution of H5N1 viruses in Vietnam indicate that a high diversity of HA clades have circulated in the country (Buchy et al., 2009; Wan et al., 2008; Davis et al., 2010; Nguyen et al., 2008, 2012). In addition to the more recent introduction and proliferation of clade 2.3.2.1 viruses, the clade 1.1 viruses detected primarily in the Mekong Delta regions of Vietnam and Cambodia continue to circulate and diversify. While clade 2.3.4 viruses were detected less frequently in Vietnam during 2011, this clade remains a potential threat as evidenced from its recent detection in Bangladesh and continued circulation elsewhere (WHO, 2012a,b; Islam et al., 2011). Clades 7.1 and 7.2 H5N1 viruses have also not been detected recently in Vietnam (Nguyen et al., 2012). However, sporadic detection of these clades in neighboring China in recent years indicates the possibility of re-introduction into Vietnam in the future (Li et al., 2010). While many real-time RT-PCR assays have been developed to universally detect the numerous clades and subgroups of H5N1 viruses, few have been designed to target specific clades for the sake of differentiation (Tsukamoto et al., 2012; Gao et al., 2011; Tan et al., 2010; Moore et al., 2010). Thus, utilization of a clade-specific assay may offer a fast and reliable method to not only screen field samples for the various clades known to circulate currently in Vietnam but also a way to monitor for the emergence or re-emergence of H5N1 viruses having distinct HA clades. A similar real-time RT-PCR assay design has been used in Egypt to detect and differentiate between divergent subgroups of clade 2.2.1 circulating in poultry (Abdelwhab et al., 2010a, 2010b). Like the clade-specific assay described herein, the ability to rapidly detect and differentiate between viruses with divergent HA genes, especially those that may be antigenic variants, could prove useful. As veterinary health agencies look to poultry vaccination as a means of controlling disease, early detection and differentiation between the numerous H5N1 clades may prove critical to better match vaccine and circulating field strains. Based on the results of the sensitivity and specificity of the realtime assay, it is recommended that this methodology be used after confirmation of a positive H5N1 sample using currently validated H5N1 diagnostic primers and probes (universal influenza A matrix gene and H5 HA gene real-time RT-PCR). In addition, this assay was developed for research purposes and was not intended as an alternative to standard diagnostic procedures currently used for the detection of highly pathogenic avian influenza A(H5N1) especially those licensed by regulatory authorities for the detection of H5N1 virus in human samples. Performing the clade-specific assay following a primary, positive diagnostic test will allow the results to be fully interpreted together with current diagnostic procedures. This clade-specific assay will allow the user to identify the H5N1 clade of the virus in question prior to confirmatory HA gene sequencing and may provide a useful tool for selecting viruses for HA gene sequencing and further phylogenetic analysis. In addition, the results may allow researchers to obtain preliminary molecular epidemiological results pertaining to specific outbreak investigations and/or other surveillance activities. Finally, the results from this assay may be helpful to determine if a novel clade (or subclade) of H5N1 has been
detected in Vietnam or possibly in other countries where these clades are known to circulate. For example, a positive H5 HA realtime assay with subsequent negative results using each of the four clade-specific primers/probes might indicate either emergence of a novel clade or significant genetic drift of currently circulating viruses. While testing of viruses from outside of Vietnam will be needed to validate the assay further, preliminary data of viruses isolated from other Asian countries indicate that each of the four assays remain stable despite some genetic diversity within the HA gene. Nonetheless, future updates to primers and probes may be necessary as mutations accumulate within assay-specific regions of the HA. Based on these findings, this clade-specific real-time RTPCR test will benefit those laboratories that require rapid H5N1 clade differentiation, have limited sequencing capacity, and/or that may wish to screen H5N1 positive samples for variant or novel strains.
Acknowledgments We thank the Vietnamese Ministry of Agriculture and Rural Development for viruses used in this research. In addition, we thank Ian York and Pierre Rivailler for thoughtful suggestions for this manuscript. The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.
References Abdelwhab, El-S.M., Arafa, A.S., Erfan, A.M., Aly, M.M., Hafez, H.M., 2010a. Modified H5 real-time reverse transcriptase-PCR oligonucleotides for detection of divergent avian influenza H5N1 viruses in Egypt. Avian Dis. 54, 1301–1305. Abdelwhab, El-S.M., Erfan, A.M., Grund, C., Ziller, M., Arafa, A.S., Beer, M., Aly, M.M., Hafez, H.M., Harder, T.C., 2010b. Simultaneous detection and differentiation by multiplex real time RT-PCR of highly pathogenic avian influenza subtype H5N1 classic (clade 2.2.1 proper) and escape mutant (clade 2.2.1 variant) lineages in Egypt. Virol. J. 7, 260–267. Beato, M.S., Capua, I., 2011. Transboundary spread of highly pathogenic avian influenza through poultry commodities and wild birds: a review. Rev. Sci. Technol. 1, 51–61. Buchy, P., Fourment, M., Mardy, S., Sorn, S., Holl, D., Ly, S., Vong, S., Enouf, V., Peiris, J.S.M., Van Der Werf, S., 2009. Molecular epidemiology of clade 1 influenza A viruses (H5N1), Southern Indochina Peninsula, 2004–2007. Emerg. Infect. Dis. 15, 1641–1644. Davis, C.T., Balish, A.L., O‘Neill, E., Nguyen, C.V., Cox, N.J., Xiyan, X., Klimov, A., Nguyen, T., Donis, R.O., 2010. Detection and characterization of clade 7 high pathogenicity avian influenza H5N1 viruses in chickens seized at ports of entry and live poultry markets in Vietnam. Avian Dis. 54 (1 Suppl.), 307–312. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Food and Agriculture Organization, 2011. Approaches to controlling, preventing and eliminating H5N1 Highly Pathogenic Avian Influenza in endemic countries. In: Animal Production and Health Paper. No. 171. Rome. http://www.fao.org/docrep/014/i2150e/i2150e.pdf (accessed 20.02.13). Gao, R., Gao, Y., Wen, L., Shao, M., Zou, S., Li, C., Yang, L., Li, X., Wang, W., Shu, Y., 2011. Development and implementation of the quality control panel of RT-PCR and real time RT-PCR for avian influenza A (H5N1) surveillance network in mainland China. BMC Infect. Dis. 11, 67–75. Islam, M.R., Haque, M.E., Giasuddin, M., Chowdhury, E.H., Samad, M.A., Parvin, R., Nooruzzaman, M., Rahman, M.M., Monoura, P., 2011. New introduction of clade 2.3.2.1 avian influenza virus (H5N1) into Bangladesh. Transbound Emerg. Dis. 59, 460–463. Li, X.H., Tian, H.D., Heiner, M., Li, D.M., 2011. Global occurrence and spread of highly pathogenic avian influenza virus of the subtype H5N1. Avian Dis. 55, 21–28. Li, Y., Shi, J., Zhong, G., Deng, G., Tian, G., Ge, J., Zeng, X., Song, J., Zhao, D., Liu, L., Jiang, Y., Guan, Y., Bu, Z., Chen, H., 2010. Continued evolution of H5N1 influenza viruses in wild birds, domestic poultry, and humans in China from 2004 to 2009. J. Virol. 84, 8389–8397. L‘Vov, D.K., Zhchelkanov, M., Vlasov, N.A., Prilipov, A.G., Deriabin, P.G., Fediakina, I.T., Galkina, I.V., Zaberezhnyi, A.D., 2008. The first break-through of the genotype 2.3.2 of high-virulence influenza A virus A/H5N1, which is new for Russia, in the Far East. Vopr. Virusol. 53, 4–8. Moore, C., Telles, J.N., Corden, S., Gao, R.B., Vernet, G., Van Aarle, P., Shu, Y.L., 2010. Development and validation of a commercial real-time NASBA assay for the rapid confirmation of influenza A H5N1 virus in clinical samples. J. Virol. Methods 170, 173–176.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320
321
322 323 324 325 326 327
328
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375
G Model VIRMET 12186 1–7
ARTICLE IN PRESS Z. Kis et al. / Journal of Virological Methods xxx (2013) xxx–xxx
376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404
Nguyen, T.D., Nguyen, T.V., Vijaykrishna, D., Webster, R.G., Guan, Y., Peiris, M.J.S., Smith, G.J., 2008. Multiple sublineages of influenza A virus (H5N1), Vietnam, 2005–2007. Emerg. Infect. Dis. 14, 632–636. Nguyen, T., Rivailler, P., Davis, C.T., Hoa, D.T., Balish, A., Dang, N.H., Jones, J., Vui, D.T., Simpson, N., Huong, N.T., Shu, B., Loughlin, R., Ferdinand, K., Lindstrom, S.E., York, I.A., Klimov, A.I., Donis, R.O., 2012. Evolution of highly pathogenic avian influenza (H5N1) virus populations in Vietnam between 2007 and 2010. Virology 432, 405–416. Sakoda, Y., Sugar, S., Batchluun, D., Erdene-Ochir, T., Okamatsu, M., 2010. Characterization of H5N1 highly pathogenic avian influenza virus strains isolated from migratory waterfowl in Mongolia on the way back from the southern Asia to their northern territory. Virology 406, 88–94. Takakuwa, H., Yamashiro, T., Le, M.Q., Phuong, L.S., Ozaki, H., Tsunekuni, R., Usui, T., Ito, H., Morimatsu, M., Tomioka, Y., Yamaguchi, T., Ito, T., Murase, T., Ono, E., Otsuki, K., 2012. Molecular epidemiology of avian influenza viruses circulating among healthy poultry flocks in farms in northern Vietnam. Prev. Vet. Med. 103, 192–200. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tan, T., Pawestri, H.P., My, N.N., Minh, H.M., Syahrial, H., Vu, T.N., van Doorn, H.R., Wertheim, H.F., Van Vinh, C.N., Quang, H.D., Farrar, J.J., Tinh, H.T., Sedyaningsih, E.R., de Jong, M.D., 2010. A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes. Virol. J. 7, 46–51. Tsukamoto, K., Javier, P.C., Shishido, M., Noguchi, D., Pearce, J., Kang, H.M., Jeong, O.M., Lee, Y.J., Nakanishi, K., Ashizawa, T., 2012. SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests. J. Clin. Microbiol. 50, 37–45.
7
Wan, X.F., Dong, L., Lan, Y., Long, L.P., Xu, C., Zou, S., Li, Z., Wen, L., Cai, Z., Wang, W., Li, X., Yuan, F., Sui, H., Zhang, Y., Dong, J., Sun, S., Gao, Y., Wang, M., Bai, T., Yang, L., Li, D., Yang, W., Yu, H., Wang, S., Feng, Z., Wang, Y., Guo, Y., Webby, R.J., Shu, Y., 2011. Indications that live poultry markets are a major source of human H5N1 influenza virus infection in China. J. Virol. 85, 13432–13438. Wan, X.F., Nguyen, T., Davis, C.T., Smith, C.B., Zhao, Z.M., Carrel, M., Inui, K., Do, H.T., Mai, D.T., Jadhao, S., Balish, A., Shu, B., Luo, F., Emch, M., Matsuoka, Y., Lindstrom, S.E., Cox, N.J., Nguyen, C.V., Klimov, A., Donis, R.O., 2008. Evolution of highly pathogenic H5N1 avian influenza viruses in Vietnam between 2001 and 2007. PLoS ONE 3, e3462. Wibawa, H., Henning, J., Wong, F., Selleck, P., Junaidi, A., Bingham, J., Daniels, P., Meers, J., 2011. A molecular and antigenic survey of H5N1 highly pathogenic avian influenzavirus isolates from small holder duck farms in Central Java, Indonesia during 2007–2008. Virol. J. 8, 425–429. World Health Organization, 2012. Cumulative number of confirmed human cases of avian influenza A(H5N1) reported to WHO. http://www.who.int/influenza/ human animal interface/en/ (accessed 31.12.12). World Health Organization, 2012. Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses pandemic preparedness. www.who.int/influenza/vaccines/virus/ for 201209 h5h7h9 vaccinevirusupdate.pdf (accessed 20.02.12). WHO/OIE/FAO H5N1 Evolution Working Group, 2008. Toward a unified nomenclature system for highly pathogenic avian influenza virus (H5N1). Emerg. Infect. Dis. 14 (7), e1, http://dx.doi.org/10.3201/eid1407.071681. WHO/OIE/FAO H5N1 Evolution Working Group, 2009. Continuing progress towards a unified nomenclature for the highly pathogenic H5N1 avian influenza viruses: divergence of clade 2.2 viruses. Influenza Other Respir. Viruses 3, 59–62. WHO/OIE/FAO H5N1 Evolution Working Group, 2012. Continued evolution of highly pathogenic avian influenza A(H5N1): updated nomenclature. Influenza Other Respir. Viruses 6, 1–5.
Please cite this article in press as: Kis, Z., et al., Real-time RT-PCR assay to differentiate clades of H5N1 avian influenza viruses circulating in Vietnam. J. Virol. Methods (2013), http://dx.doi.org/10.1016/j.jviromet.2013.06.023
405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434