- Email: [email protected]
Real-time TaqMan polymerase chain reaction assays for quantitative detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum
Diagnostic Microbiology and Infectious Disease 57 (2007) 373 – 378 www.elsevier.com/locate/diagmicrobio
Real-time TaqMan polymerase chain reaction assays for quantitative detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum Xuan Caoa, Yefu Wanga,4, Xingwen Hub, Hong Qingc, Hanhua Wangc a
The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China b Department of Clinical Laboratory, Hubei Maternal and Child Health Hospital, Wuhan 430070, China c Hubei Entry-Exit Inspection and Quarantine Bureau, Wuhan 430022, China Received 16 June 2006; accepted 19 September 2006
Abstract Evidence has been presented that the species currently known as Ureaplasma urealyticum should be separated into 2 species— Ureaplasma parvum (previously, U. urealyticum biovar 1) and U. urealyticum (previously, U. urealyticum biovar 2). Differentiation and quantification of U. parvum and U. urealyticum can provide important information of the epidemiology of Ureaplasma infections. We developed 2 real-time TaqMan polymerase chain reaction (PCR) assays that would allow rapid, specific, sensitive, quantitative detection and convenient differentiation of U. parvum and U. urealyticum. One hundred twenty-eight clinical specimens were studied and compared with results obtained by culture methods and conventional PCR. The positive rate of real-time TaqMan PCR (59.4%, 76 of 128) was higher than that of culture methods (42.2%, 54 of 128) and conventional PCR (50%, 64 of 128). Of 76 positive specimens, 86.8% (66) contained U. parvum only, 10.5% (8) contained U. urealyticum only, and 2.6% (2) contained both. The copy numbers of 11 positive specimens were in the range of 101 to 103 copies per reaction mixture, 18 in the range of 103 to 105, and 47 in the range of 105 to 108. In the future, quantitative detection and convenient differentiation of real-time TaqMan PCR assays will assist in the study of the pathogenesis and epidemiology of Ureaplasma infections. D 2007 Elsevier Inc. All rights reserved. Keywords: Ureaplasma urealyticum; Ureaplasma parvum; Real-time TaqMan PCR; TaqMan probe; Standard curve
1. Introduction Ureaplasma urealyticum is a common human pathogen that has been implicated in nongonococcal urethritis and intrauterine infections in association with adverse pregnancy outcomes such as preterm delivery or stillbirth (Gerber et al., 2003; Goldenberg and Thompson, 2003; Horner et al., 2001; Yoon et al., 2003). However, it is commonly found in healthy people, and its pathogenic role is difficult to prove in a small proportion of individuals (Ollikainen et al., 1998; Tully, 1993). Studies of epidemiology and pathogenesis of infections with Ureaplasma have received much attention in recent years. U. urealyticum consists of 14 serovars that can be divided into 2 biovars, biovars 1 and biovars 2, on the basis
4 Corresponding author. Tel.: +86-27-6875-4627. E-mail address: [email protected] (Y. Wang). 0732-8893/$ – see front matter D 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2006.09.006
of phenotypic and genotypic characteristics. Biovar 1 includes 4 serovars (serovars 1, 3, 6, 14), whereas biovar 2 comprises 10 serovars (serovars 2, 4, 5, and 7–13). Evidence has been presented that the species currently known as U. urealyticum should be separated into 2 species, namely, Ureaplasma parvum (previously, U. urealyticum biovar 1) and U. urealyticum (previously, U. urealyticum biovar 2). The majority of human Ureaplasma isolates belong to the new species U. parvum. U. urealyticum (biovar 2) is isolated less often but is not uncommon (Kong et al., 1999). Some Ureaplasma serovars have been associated with disease syndromes more commonly than with normal flora (Zheng et al., 1992). However, these findings are limited and difficult to confirm because of problems with conventional methods. Traditionally, detection of Ureaplasma in clinical specimens relies on selective culture methods, which are labor intensive, time consuming, and low sensitive. In addition, these culture methods do not allow for the differentiation
374
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
between U. urealyticum and U. parvum. Conventional polymerase chain reaction (PCR) methods have been used to detect and distinguish the 2 Ureaplasma spp. (Kong et al., 2000). However, the PCR protocols require further processing of the amplification products, which is time consuming and prone to false-positive results because of possible cross-contamination. The real-time TaqMan PCR can circumvent these problems. Real-time TaqMan PCR, by sequence-specific TaqMan probes, amplifies and simultaneously detects a target gene with closed tube formats, thus, increasing the specificity and reducing the chance of cross-contamination. In addition, further down-stream analysis is not required, which minimizes the time needed to obtain results by electrophoresis on agarose gel. The whole real-time TaqMan PCR takes only about 1.5 h if previously extracted template is used, whereas conventional PCR with agarose gel electrophoresis takes about 4 h. Not only the differentiation but also the quantification of U. urealyticum and U. parvum may provide important information of the epidemiology of Ureaplasma infections. PCR products are monitored and analyzed during every cycle as they accumulated in the real-time PCR. DNA copy numbers, determined on the basis of the threshold cycle number (C T), are directly proportional to the initial copy number (Higuchi et al., 1993; Holland et al., 1991). The aim of the present work was to develop 2 real-time TaqMan PCR assays that would allow for rapid, specific, sensitive, quantitative detection and convenient differentiation of U. urealyticum and U. parvum. To evaluate the applicability of the assays to clinical specimens, we studied 128 samples of vaginal swabs and compared with results obtained by culture methods and conventional PCR.
2. Materials and methods 2.1. Bacterial strains Two standard strains (the typical strains of biovar 1 and biovar 2) were obtained from China National Institute for the Control of Pharmaceutical and Biological Products (CNICPBP, Beijing, China). They were cultivated by using Urea-Arginine LYO 2 broth and Mycoplasma A7 Agar (Biome´ rieux China, Beijing, China) according to the manufacturers’ instructions. These 2 Ureaplasma standard strains were used for conventional PCR, sequencing after cloning, and real-time TaqMan PCR. Additional reference strains from the CNICPBP were used to test the specificity of primers and probes: Bordetella pertussis, Gardnerella vaginalis, Haemophilus influenzae, Mycoplasma hominis, and Neisseria gonorrhoeae. They were grown in the appropriate media and growth conditions. These reference strains were tested for conventional PCR and real-time TaqMan PCR. Escherichia coli DH5a, as the host for recombinant plasmid pUCm-T, was obtained from the Laboratory of Microbial Genetics, College of Life Sciences, Wuhan University, Wuhan, China.
2.2. Clinical isolates and specimens Twelve strains of Ureaplasma were isolated and cultured by the Urea-Arginine LYO 2 broth and Mycoplasma A7 Agar from vaginal swabs of pregnant women in Hubei Maternal and Child Health Hospital, Wuhan, China. These culture isolates were tested for conventional PCR, sequencing after cloning, and real-time TaqMan PCR. A total of 128 vaginal swabs of pregnant women and women attending a sexually transmitted disease (STD) clinic during the period from March to June in 2005 from Hubei Maternal and Child Health Hospital were collected and used in this study. These clinical specimens were collected according to the method described by Barton et al. (2003). These clinical specimens were used for traditional culture methods, conventional PCR, and real-time TaqMan PCR. Clinical specimens were prepared for PCR (see hereinbelow) as soon as possible after receipt of specimens in the laboratory. 2.3. Primers and TaqMan probes Urease gene sequences of 14 Urealyticum serovars were downloaded from the GenBank sequence database (http:// www.ncbi.nlm.nih.gov). Because of the high A+T content of the target region, TaqMan minor groove binder (MGB) probe was chosen to enhance the melting temperature (T m) of the probe. Moreover, TaqMan MGB probe can differentiate allele with only 1 base variation. Primers and TaqMan MGB probes were selected by comparing the urease gene sequence information of all 14 serovars using Clustalw (www.ebi.ac.uk/clustalw/) and designed using the Primer Express 2.0 software (Applied Biosystems, Foster City, CA). The oligonucleotide sequences for primers and TaqMan MGB probes are shown in Table 1. Both TaqMan MGB probes were labeled with the reporter dye 6-FAM at the 5V end and MGB at the 3V end. All the primers were Table 1 Primers and TaqMan MGB probes used in real-time TaqMan PCR assays for amplification and detection of U. urealyticum and U. parvum Primer/probe
Sequence (5VY3V)
UPure primersa UPure Fb cattgatgttgcacaaggagaaa UPure Rc ttagcaccaacataaggagctaaatc UPure TaqMan MGB probe UPure FPd ttgaccacccttacgag UUure primerse UUure F atCgaCgttgcCcaaggGga UUure R ttagcaccaacataaggagctaaatc UUure TaqMan MGB probe UUure FPf ttgTccGccTttacgag
Size (nt)
T m (8C)
23 26
59 58
17
68
20 26
59 58
17
69
Both TaqMan probes were labeled with the reporter dye 6-FAM at the 5V end and MGB at the 3V end. In the UUure F and UUure FPf, the capital letters mean the different bases between U. parvum and U. parvum. a Primers of U. parvum. b Forward primer. c Reverse primer. d TaqMan MGB probe of U. parvum. e Primers of U. urealyticum. f TaqMan MGB probe of U. urealyticum.
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
synthesized by Shanghai Invitrogen Biotechnology, Shanghai, China. Both TaqMan MGB probes were synthesized and modified by Shanghai Genecore Biotechnology, Shanghai, China. 2.4. DNA preparation and conventional PCR DNA preparation was performed as previously described elsewhere (Kong et al., 1999). The same primer pairs that were used in the real-time TaqMan PCR were used in the conventional PCR formats to directly compare the 2 PCR methods. Reaction and cycling conditions of the conventional PCR in this case were the same as those in the realtime TaqMan PCR, except the TaqMan MGB probes were omitted. PCR buffer (10) without MgCl2, 25 mmol/L MgCl2, 20 mmol/L deoxynucleotide mixture (dATP, dTTP, dCTP, and dGTP), and Taq DNA polymerase were purchased from TaKaRa Biotechnology Dalian, Liaoning, China. The conventional PCR system in a final volume of 50 AL mixture contained 1 PCR buffer without MgCl2, 2.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide mixture, 1.5 U Taq DNA polymerase, and 2.5 AL DNA template. For the U. parvum assay, 0.35 Amol/L each of primers UPureF and UPureR was used, whereas for the U. urealyticum assay, 0.3 Amol/L each of primers UUureF and UUureR was added. The positive (DNA of the 2 standard strains) and negative (sterile water) controls were included in each PCR experiment. The amplification reaction was carried out on the DNA thermal cycler 2400 (Perkin-Elmer, Life science, Boston, MA). Cycling condition was 94 8C for 3 min; 40 cycles of 94 8C for 15 s and 58 8C for 30 s; and 72 8C for 5 min for a final elongation. PCR products (5 AL) and DNA size marker (100-bp DNA ladder; Sino-American Biotechnology, Luoyang, Henan, China) were analyzed by electrophoresis on 2.0% agarose gels containing 0.5 Ag of ethidium bromide per milliliter with 4 V/cm for 60 to 75 min. A visible band of the appropriate size on ultraviolet transillumination was considered a positive result. 2.5. Cloning and sequencing To identify standard strains and clinical isolates of Ureaplasma to the species level, we purified and ligated the positive amplification products of the aforementioned conventional PCR to plasmid vector pUCm-T (Shanghai Sangon Biological Engineering Technology and Service, Shanghai, China). The ligation products were transformed into E. coli DH5a, and transformants were screened by blue/white colony (Sambrook and Russell, 2001). Positive transformants were identified by conventional PCR and digesting recombinant plasmid with EcoRI and BamHI, and then sequenced in 2 directions using M13 universal primer by Huanuo Biological Science and Technology, Shanghai, China. The obtained nucleotide sequences were queried against the GenBank database by using BLAST to confirm their identity as the corresponding urease gene fragment of U. urealyticum and U. parvum.
375
2.6. Real-time TaqMan PCR Plasmids containing target fragments of U. urealyticum (UUure plasmids) and U. parvum (UPure plasmids) were conducted as the external standards to develop the real-time TaqMan PCR and to determine the sensitivity of each assay. Based on the target amplicons’ size, the amount of purified recombinant plasmids was calculated after measuring the concentration spectrophotometrically. Ten-fold serial dilutions with copy numbers ranging from 1.0 101 to 1.0 108 copies per microliter of UPure plasmids and UUure plasmids were performed, and 1 AL of each dilution was added to the real-time TaqMan PCR reaction mixture. In each run with clinical specimens, negative control (sterile water instead of sample) and standards containing 1.0 101 to 1.0 108 copies per reaction mixture in triplicate were included. Real-time TaqMan PCR mixtures contained 1 PCR buffer without MgCl2, 3.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide mixture (dATP, dTTP, dCTP, and dGTP), 0.5 U Hotstart Taq DNA Polymerase (the aforementioned 4 PCR reaction reagents were purchased from TaKaRa Biotechnology Dalian), and 1 AL DNA template. For the U. urealyticum assay, 0.2 Amol/L UUure TaqMan probe and 0.3 Amol/L each of primers UUureF and UUureR were used; whereas for the U. parvum assay, 0.2 Amol/L UPure TaqMan probe and 0.35 Amol/L each of primers UPureF and UPureR were added. Ultrapure sterile water was added to bring the final volume to 20 AL. Cycling conditions were as follows: 94 8C for 10 min, followed by 40 cycles of 95 8C for 15 s and 58 8C for 30 s. The Rotor-Gene real-time analysis software (Corbett Life Science, Sydney, Australia) read each sample every few seconds and computed a mean baseline reading for early PCR cycles. A sample was considered positive when its cycle threshold (C T) value was 35 or less. 3. Results 3.1. Sequence identification Two standard strains and 12 clinical Ureaplasma isolates were selected for cloning and sequencing to identify them to the species level. Both standard reference strains were found
Fig. 1. The standard curve of UPure plasmids (plasmids containing target fragments of U. parvum) using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture by the real-time TaqMan PCR. Concentration = 10( 0.327d CT + 12.161), R value = .9895. Concentration = copies per reaction mixture; C T = threshold cycle number.
376
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
Fig. 2. The standard curve of UUure plasmids (plasmids containing target fragments of U. urealyticum) using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture by the real-time TaqMan PCR. Concentration = 10( 0.325d CT + 11.973), R value = .9956. Concentration = copies per reaction mixture; C T = threshold cycle number.
to have a 100% sequence similarity to the corresponding GenBank sequence. The sequencing results of 12 clinical isolates were as follows: 9 were U. parvum and 3 were U. urealyticum (all with 100% sequence similarity).
approximately 7 logs (1.0 101 to 1.0 108 copies). An initial copy number of 10 copies yielded a C T value of 32.42, whereas an initial copy number of 1.0 108 copies yielded a C T value of 12.18. As expected, every 10-fold decrease in the copy number brought an increase in the C T value of about 3. The standard curve of UUure plasmids was shown in Fig. 2, which was linear over 7 orders of magnitude with a correlation coefficient of .9956. Both standard curves showed a linear relationship between the C T values and the initial DNA copy number. The detection limit of each assay was 10 copies per reaction mixture. 3.4. Comparison of real-time TaqMan PCR with culture methods and conventional PCR
The 2 real-time TaqMan PCR assays, based upon base variation in the urease gene sequence, were designed to quantitatively detect and conveniently differentiate U. parvum and U. urealyticum. Two standard strains, 12 clinical isolates, 5 additional reference strains, and negative control (sterile water instead of template) were tested in triplicate in both UPure and UUure real-time TaqMan PCR assays. In the UPure assay, only U. parvum standard strain and the 9 clinical isolates (identified as U. parvum through sequencing) amplified. Only U. urealyticum standard strain and 3 U. urealyticum clinical isolates produced amplification curves in the UUure assay. Five additional reference strains and negative control showed negative results in both the UPure and UUure assays after 40 cycles of amplification, suggesting that these assays had a high degree of specificity.
The results by 3 different methods in 128 clinical specimens were compared in Table 2. The positive rate of real-time TaqMan PCR (59.4%, 76 of 128) was higher than that of culture methods (42.2%, 54 of 128) and conventional PCR (50%, 64 of 128). Ureaplasma was detected more frequently in vaginal swabs of antenatal clinic clients than in those of STD clinical clients. Convenient differentiation of U. parvum and U. urealyticum will be of great value to prove if there is correlation between the biovar and pathogenicity. In our study, of 76 (66+8+2) clinical specimens that were found positive by real-time TaqMan PCR, 86.8% (66 of 76) contained U. parvum only, 10.5% (8 of 76) contained U. urealyticum only, and 2.6% (2 of 76) contained both. Quantification is very important to determine the microbial burden of infection in relation to pathogenic potential. The accurate copy numbers per reaction mixture of all 76 positive specimens were automatically calculated according to the standard curves. The copy numbers of 11 positive specimens were in the range of 101 to 103 copies per reaction mixture, 18 in the range of 103 to 105, and 47 in the range of 105 to 108.
3.3. Standard curves and sensitivity of real-time TaqMan PCR assays
4. Discussion
Standard curves for each assay were constructed by using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture of UPure plasmids and UUure plasmids, respectively. The standard curve of UPure plasmids was shown in Fig. 1. The linear range was
Studies of epidemiology and pathogenesis of infections with Ureaplasma have received much attention in recent years. In the present study, we described the development and evaluation of 2 real-time TaqMan PCR assays to quantitatively detect and differentiate U. parvum and
3.2. Specificity of real-time TaqMan PCR assays
Table 2 Comparison of real-time quantitative PCR with culture methods and conventional PCR for detecting Ureaplasma in clinical specimens Subjects
No. (%) of specimens with positive result Culture methods
STD clinic clients (40) Antenatal clinic clients (88) Total (128) a b c
U. parvum. U. urealyticum. both U. parvum and U. parvum.
11 (27.5) 43 (48.9) 54 (42.2)
Conventional PCR 14 (35) 50 (56.9) 64 (50)
Real-time quantitative PCR U.pa
U.ub
Mixedc
15 (37.5) 51 (57.9 66 (51.6)
2 (7.5) 5 (5.7) 8 (6.3)
0 (0) 2 (2.3) 2 (1.6)
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
U. urealyticum. The whole real-time TaqMan PCR assays took only about 1.5 h if previously extracted template was used, whereas conventional PCR with agarose gel electrophoresis took about 4 h. Real-time TaqMan PCR, by sequence-specific TaqMan MGB probes, amplified and simultaneously detected a target gene, thus, reducing the chance of cross-contamination and increasing the specificity. TaqMan MGB probes can discriminate allele with only 1 base variation. By the variation of 4 bases in the forward primers and 3 in the TaqMan MGB Probes, the real-time TaqMan PCR assays can absolutely differentiate U. parvum from U. parvum in our study. When applied to references and clinical isolates, the real-time TaqMan PCR assays of U. parvum and U. urealyticum showed to be highly specific. At the same time, convenient differentiation of U. parvum and U. urealyticum will be of great value to prove if there is correlation between the biovar and pathogenicity. The results of previous studies had indicated that the majority in clinical specimens belong to U. parvum (Kong et al., 2000). In our study, the percentage of U. parvum, U. urealyticum, and both species in 76 positive vaginal swabs was 86.8% (66 of 76), 10.5% (8 of 76), and 2.6% (2 of 76), respectively. Quantification is very important to determine the microbial burden of infection in relation to pathogenic potential. The accurate copy numbers per reaction mixture of all 76 positive specimens were successfully gained and analyzed according to standard curves. Real-time TaqMan PCR exhibited 10-fold–greater sensitivity than the conventional PCR results reported in the study by Nakao et al. (1997). In the present study, real-time TaqMan PCR showed at least 100-fold–greater sensitivity than the conventional PCR with the same primer sets and cycling conditions. Remarkably, all positive specimens with copy numbers in the range of 101 to 103 by real-time TaqMan PCR were negative by conventional PCR in the present study. That is to say, the real-time TaqMan PCR allowed for the detection at 100 times greater sensitivity than the conventional PCR with the same primer sets and cycling conditions. Recently, Mallard et al. (2005) have reported similar protocols of real-time PCR for differential detection and quantification of U. parvum and U. urealyticum. However, no clinical specimen was applied to evaluate the assays qualitatively and quantitatively. At the same time, the linear range of standard curve was only 5 orders of magnitude in their study that was 100 times lower than our research results. Yi et al. (2005) have presented protocols of real-time PCR in the allelic discrimination format in which the primers and the 2 biovar-specific probes were contained in 1 reaction well to amplify, and biovar-type Ureaplasma at the same time. Nevertheless, a few problems remained to be solved when operating aforementioned double real-time PCR. The competition of different biovar templates may affect the amplification efficiency of each biovar, the interaction of 2 biovar-specific probes may affect the detection efficiency of each biovar, and the sensitivity of
377
each biovar of double real-time PCR may be lower than that of single real-time PCR. Moreover, it is difficult to obtain the standard curve and quantify the study subjects. In conclusion, we developed and evaluated 2 real-time TaqMan PCR assays that would allow for rapid, specific, sensitive, quantitative detection and convenient differentiation of U. parvum and U. urealyticum. Further investigation is to apply our methods to more clinical specimens. In the future, quantitative detection and convenient differentiation of real-time TaqMan PCR assays will assist in the study of the pathogenesis and epidemiology of Ureaplasma infections.
Acknowledgments This work was supported by the Bureau of Science and Technology of Wuhan, Hubei, PR China. (grant 20066002053).
References Barton PT, Gerber S, Skupski DW, Witkin SS (2003) Interleukin-1 receptor antagonist gene polymorphism, vaginal interleukin-1 receptor antagonist concentrations, and vaginal Ureaplasma urealyticum colonization in pregnant women. Infect Immun 71:271 – 274. Gerber S, Vial Y, Hohlfeld P, Witkin SS (2003) Detection of Ureaplasma urealyticum in second-trimester amniotic fluid by polymerase chain reaction correlates with subsequent preterm labor and delivery. J Infect Dis 187:518 – 521. Goldenberg RL, Thompson C (2003) The infectious origin of stillbirth. Am J Obstet Gynecol 189:861 – 873. Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. Bio/Technology 11:1026 – 1030. Holland P, Abramso R, Watson R, Gelfand D (1991) Detection of specific polymerase chain reaction product by utilizing the 5V–3V exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88:7276 – 7280. Horner P, Thomas B, Gilroy CB, Egger M, Taylor-Robinson D (2001) Role of Mycoplasma genitalium and Ureaplasma urealyticum in acute and chronic nongonococcal urethritis. Clin Infect Dis 32:995 – 1003. Kong F, James G, Ma Z, Gordon S, Wang B, Gilbert GL (1999) Phylogenetic analysis of Ureaplasma urealyticum—support for the establishment of a new species, Ureaplasma parvum. Int J Syst Bacteriol 49:1879 – 1889. Kong F, Ma Z, James G, Gordon S, Gilbert GL (2000) Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays. J Clin Microbiol 38:1175 – 1179. Mallard K, Schopfer K, Bodmer T (2005) Development of real-time PCR for the differential detection and quantification of Ureaplasma urealyticum and Ureaplasma parvum. J Microbiol Methods 60:13 – 19. Nakao H, Mazurova IK, Glushkevich T, Popovic T (1997) Analysis of heterogeneity of Corynebacterium diphtheriae toxin gene, tox, and its regulatory element, dtxR, by direct sequencing. Res Microbiol 148: 45 – 54. Ollikainen J, Heiskanen-Kosma T, Korppi M, Katila ML, Heinonen K (1998) Clinical relevance of Ureaplasma urealyticum colonization in preterm infants. Acta Paediatr 87:1075 – 1078. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. 3rd ed. New York, USA7 Cold Spring Harbor Laboratory Press, pp 1–146. Tully JG (1993) Current status of the mollicute flora of humans. Clin Infect Dis 17(Suppl 1):S2 – S9.
378
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
Yi J, Yoon BH, Kim EC (2005) Detection and biovar discrimination of Ureaplasma urealyticum by real-time PCR. Mol Cell Probes 19: 255 – 260. Yoon BH, Romero R, Lim JH (2003) The clinical significance of detecting Ureaplasma urealyticum by the polymerase chain reaction in the
amniotic fluid of patients with preterm labor. Am J Obstet Gynecol 189: 919 – 924. Zheng X, Watson HL, Waites KB, Cassell GH (1992) Serotype diversity and antigen variation among invasive isolates of Ureaplasma urealyticum from neonates. Infect Immun 60:3472 – 3474.
Real-time TaqMan polymerase chain reaction assays for quantitative detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum Xuan Caoa, Yefu Wanga,4, Xingwen Hub, Hong Qingc, Hanhua Wangc a
The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China b Department of Clinical Laboratory, Hubei Maternal and Child Health Hospital, Wuhan 430070, China c Hubei Entry-Exit Inspection and Quarantine Bureau, Wuhan 430022, China Received 16 June 2006; accepted 19 September 2006
Abstract Evidence has been presented that the species currently known as Ureaplasma urealyticum should be separated into 2 species— Ureaplasma parvum (previously, U. urealyticum biovar 1) and U. urealyticum (previously, U. urealyticum biovar 2). Differentiation and quantification of U. parvum and U. urealyticum can provide important information of the epidemiology of Ureaplasma infections. We developed 2 real-time TaqMan polymerase chain reaction (PCR) assays that would allow rapid, specific, sensitive, quantitative detection and convenient differentiation of U. parvum and U. urealyticum. One hundred twenty-eight clinical specimens were studied and compared with results obtained by culture methods and conventional PCR. The positive rate of real-time TaqMan PCR (59.4%, 76 of 128) was higher than that of culture methods (42.2%, 54 of 128) and conventional PCR (50%, 64 of 128). Of 76 positive specimens, 86.8% (66) contained U. parvum only, 10.5% (8) contained U. urealyticum only, and 2.6% (2) contained both. The copy numbers of 11 positive specimens were in the range of 101 to 103 copies per reaction mixture, 18 in the range of 103 to 105, and 47 in the range of 105 to 108. In the future, quantitative detection and convenient differentiation of real-time TaqMan PCR assays will assist in the study of the pathogenesis and epidemiology of Ureaplasma infections. D 2007 Elsevier Inc. All rights reserved. Keywords: Ureaplasma urealyticum; Ureaplasma parvum; Real-time TaqMan PCR; TaqMan probe; Standard curve
1. Introduction Ureaplasma urealyticum is a common human pathogen that has been implicated in nongonococcal urethritis and intrauterine infections in association with adverse pregnancy outcomes such as preterm delivery or stillbirth (Gerber et al., 2003; Goldenberg and Thompson, 2003; Horner et al., 2001; Yoon et al., 2003). However, it is commonly found in healthy people, and its pathogenic role is difficult to prove in a small proportion of individuals (Ollikainen et al., 1998; Tully, 1993). Studies of epidemiology and pathogenesis of infections with Ureaplasma have received much attention in recent years. U. urealyticum consists of 14 serovars that can be divided into 2 biovars, biovars 1 and biovars 2, on the basis
4 Corresponding author. Tel.: +86-27-6875-4627. E-mail address: [email protected] (Y. Wang). 0732-8893/$ – see front matter D 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2006.09.006
of phenotypic and genotypic characteristics. Biovar 1 includes 4 serovars (serovars 1, 3, 6, 14), whereas biovar 2 comprises 10 serovars (serovars 2, 4, 5, and 7–13). Evidence has been presented that the species currently known as U. urealyticum should be separated into 2 species, namely, Ureaplasma parvum (previously, U. urealyticum biovar 1) and U. urealyticum (previously, U. urealyticum biovar 2). The majority of human Ureaplasma isolates belong to the new species U. parvum. U. urealyticum (biovar 2) is isolated less often but is not uncommon (Kong et al., 1999). Some Ureaplasma serovars have been associated with disease syndromes more commonly than with normal flora (Zheng et al., 1992). However, these findings are limited and difficult to confirm because of problems with conventional methods. Traditionally, detection of Ureaplasma in clinical specimens relies on selective culture methods, which are labor intensive, time consuming, and low sensitive. In addition, these culture methods do not allow for the differentiation
374
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
between U. urealyticum and U. parvum. Conventional polymerase chain reaction (PCR) methods have been used to detect and distinguish the 2 Ureaplasma spp. (Kong et al., 2000). However, the PCR protocols require further processing of the amplification products, which is time consuming and prone to false-positive results because of possible cross-contamination. The real-time TaqMan PCR can circumvent these problems. Real-time TaqMan PCR, by sequence-specific TaqMan probes, amplifies and simultaneously detects a target gene with closed tube formats, thus, increasing the specificity and reducing the chance of cross-contamination. In addition, further down-stream analysis is not required, which minimizes the time needed to obtain results by electrophoresis on agarose gel. The whole real-time TaqMan PCR takes only about 1.5 h if previously extracted template is used, whereas conventional PCR with agarose gel electrophoresis takes about 4 h. Not only the differentiation but also the quantification of U. urealyticum and U. parvum may provide important information of the epidemiology of Ureaplasma infections. PCR products are monitored and analyzed during every cycle as they accumulated in the real-time PCR. DNA copy numbers, determined on the basis of the threshold cycle number (C T), are directly proportional to the initial copy number (Higuchi et al., 1993; Holland et al., 1991). The aim of the present work was to develop 2 real-time TaqMan PCR assays that would allow for rapid, specific, sensitive, quantitative detection and convenient differentiation of U. urealyticum and U. parvum. To evaluate the applicability of the assays to clinical specimens, we studied 128 samples of vaginal swabs and compared with results obtained by culture methods and conventional PCR.
2. Materials and methods 2.1. Bacterial strains Two standard strains (the typical strains of biovar 1 and biovar 2) were obtained from China National Institute for the Control of Pharmaceutical and Biological Products (CNICPBP, Beijing, China). They were cultivated by using Urea-Arginine LYO 2 broth and Mycoplasma A7 Agar (Biome´ rieux China, Beijing, China) according to the manufacturers’ instructions. These 2 Ureaplasma standard strains were used for conventional PCR, sequencing after cloning, and real-time TaqMan PCR. Additional reference strains from the CNICPBP were used to test the specificity of primers and probes: Bordetella pertussis, Gardnerella vaginalis, Haemophilus influenzae, Mycoplasma hominis, and Neisseria gonorrhoeae. They were grown in the appropriate media and growth conditions. These reference strains were tested for conventional PCR and real-time TaqMan PCR. Escherichia coli DH5a, as the host for recombinant plasmid pUCm-T, was obtained from the Laboratory of Microbial Genetics, College of Life Sciences, Wuhan University, Wuhan, China.
2.2. Clinical isolates and specimens Twelve strains of Ureaplasma were isolated and cultured by the Urea-Arginine LYO 2 broth and Mycoplasma A7 Agar from vaginal swabs of pregnant women in Hubei Maternal and Child Health Hospital, Wuhan, China. These culture isolates were tested for conventional PCR, sequencing after cloning, and real-time TaqMan PCR. A total of 128 vaginal swabs of pregnant women and women attending a sexually transmitted disease (STD) clinic during the period from March to June in 2005 from Hubei Maternal and Child Health Hospital were collected and used in this study. These clinical specimens were collected according to the method described by Barton et al. (2003). These clinical specimens were used for traditional culture methods, conventional PCR, and real-time TaqMan PCR. Clinical specimens were prepared for PCR (see hereinbelow) as soon as possible after receipt of specimens in the laboratory. 2.3. Primers and TaqMan probes Urease gene sequences of 14 Urealyticum serovars were downloaded from the GenBank sequence database (http:// www.ncbi.nlm.nih.gov). Because of the high A+T content of the target region, TaqMan minor groove binder (MGB) probe was chosen to enhance the melting temperature (T m) of the probe. Moreover, TaqMan MGB probe can differentiate allele with only 1 base variation. Primers and TaqMan MGB probes were selected by comparing the urease gene sequence information of all 14 serovars using Clustalw (www.ebi.ac.uk/clustalw/) and designed using the Primer Express 2.0 software (Applied Biosystems, Foster City, CA). The oligonucleotide sequences for primers and TaqMan MGB probes are shown in Table 1. Both TaqMan MGB probes were labeled with the reporter dye 6-FAM at the 5V end and MGB at the 3V end. All the primers were Table 1 Primers and TaqMan MGB probes used in real-time TaqMan PCR assays for amplification and detection of U. urealyticum and U. parvum Primer/probe
Sequence (5VY3V)
UPure primersa UPure Fb cattgatgttgcacaaggagaaa UPure Rc ttagcaccaacataaggagctaaatc UPure TaqMan MGB probe UPure FPd ttgaccacccttacgag UUure primerse UUure F atCgaCgttgcCcaaggGga UUure R ttagcaccaacataaggagctaaatc UUure TaqMan MGB probe UUure FPf ttgTccGccTttacgag
Size (nt)
T m (8C)
23 26
59 58
17
68
20 26
59 58
17
69
Both TaqMan probes were labeled with the reporter dye 6-FAM at the 5V end and MGB at the 3V end. In the UUure F and UUure FPf, the capital letters mean the different bases between U. parvum and U. parvum. a Primers of U. parvum. b Forward primer. c Reverse primer. d TaqMan MGB probe of U. parvum. e Primers of U. urealyticum. f TaqMan MGB probe of U. urealyticum.
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
synthesized by Shanghai Invitrogen Biotechnology, Shanghai, China. Both TaqMan MGB probes were synthesized and modified by Shanghai Genecore Biotechnology, Shanghai, China. 2.4. DNA preparation and conventional PCR DNA preparation was performed as previously described elsewhere (Kong et al., 1999). The same primer pairs that were used in the real-time TaqMan PCR were used in the conventional PCR formats to directly compare the 2 PCR methods. Reaction and cycling conditions of the conventional PCR in this case were the same as those in the realtime TaqMan PCR, except the TaqMan MGB probes were omitted. PCR buffer (10) without MgCl2, 25 mmol/L MgCl2, 20 mmol/L deoxynucleotide mixture (dATP, dTTP, dCTP, and dGTP), and Taq DNA polymerase were purchased from TaKaRa Biotechnology Dalian, Liaoning, China. The conventional PCR system in a final volume of 50 AL mixture contained 1 PCR buffer without MgCl2, 2.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide mixture, 1.5 U Taq DNA polymerase, and 2.5 AL DNA template. For the U. parvum assay, 0.35 Amol/L each of primers UPureF and UPureR was used, whereas for the U. urealyticum assay, 0.3 Amol/L each of primers UUureF and UUureR was added. The positive (DNA of the 2 standard strains) and negative (sterile water) controls were included in each PCR experiment. The amplification reaction was carried out on the DNA thermal cycler 2400 (Perkin-Elmer, Life science, Boston, MA). Cycling condition was 94 8C for 3 min; 40 cycles of 94 8C for 15 s and 58 8C for 30 s; and 72 8C for 5 min for a final elongation. PCR products (5 AL) and DNA size marker (100-bp DNA ladder; Sino-American Biotechnology, Luoyang, Henan, China) were analyzed by electrophoresis on 2.0% agarose gels containing 0.5 Ag of ethidium bromide per milliliter with 4 V/cm for 60 to 75 min. A visible band of the appropriate size on ultraviolet transillumination was considered a positive result. 2.5. Cloning and sequencing To identify standard strains and clinical isolates of Ureaplasma to the species level, we purified and ligated the positive amplification products of the aforementioned conventional PCR to plasmid vector pUCm-T (Shanghai Sangon Biological Engineering Technology and Service, Shanghai, China). The ligation products were transformed into E. coli DH5a, and transformants were screened by blue/white colony (Sambrook and Russell, 2001). Positive transformants were identified by conventional PCR and digesting recombinant plasmid with EcoRI and BamHI, and then sequenced in 2 directions using M13 universal primer by Huanuo Biological Science and Technology, Shanghai, China. The obtained nucleotide sequences were queried against the GenBank database by using BLAST to confirm their identity as the corresponding urease gene fragment of U. urealyticum and U. parvum.
375
2.6. Real-time TaqMan PCR Plasmids containing target fragments of U. urealyticum (UUure plasmids) and U. parvum (UPure plasmids) were conducted as the external standards to develop the real-time TaqMan PCR and to determine the sensitivity of each assay. Based on the target amplicons’ size, the amount of purified recombinant plasmids was calculated after measuring the concentration spectrophotometrically. Ten-fold serial dilutions with copy numbers ranging from 1.0 101 to 1.0 108 copies per microliter of UPure plasmids and UUure plasmids were performed, and 1 AL of each dilution was added to the real-time TaqMan PCR reaction mixture. In each run with clinical specimens, negative control (sterile water instead of sample) and standards containing 1.0 101 to 1.0 108 copies per reaction mixture in triplicate were included. Real-time TaqMan PCR mixtures contained 1 PCR buffer without MgCl2, 3.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide mixture (dATP, dTTP, dCTP, and dGTP), 0.5 U Hotstart Taq DNA Polymerase (the aforementioned 4 PCR reaction reagents were purchased from TaKaRa Biotechnology Dalian), and 1 AL DNA template. For the U. urealyticum assay, 0.2 Amol/L UUure TaqMan probe and 0.3 Amol/L each of primers UUureF and UUureR were used; whereas for the U. parvum assay, 0.2 Amol/L UPure TaqMan probe and 0.35 Amol/L each of primers UPureF and UPureR were added. Ultrapure sterile water was added to bring the final volume to 20 AL. Cycling conditions were as follows: 94 8C for 10 min, followed by 40 cycles of 95 8C for 15 s and 58 8C for 30 s. The Rotor-Gene real-time analysis software (Corbett Life Science, Sydney, Australia) read each sample every few seconds and computed a mean baseline reading for early PCR cycles. A sample was considered positive when its cycle threshold (C T) value was 35 or less. 3. Results 3.1. Sequence identification Two standard strains and 12 clinical Ureaplasma isolates were selected for cloning and sequencing to identify them to the species level. Both standard reference strains were found
Fig. 1. The standard curve of UPure plasmids (plasmids containing target fragments of U. parvum) using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture by the real-time TaqMan PCR. Concentration = 10( 0.327d CT + 12.161), R value = .9895. Concentration = copies per reaction mixture; C T = threshold cycle number.
376
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
Fig. 2. The standard curve of UUure plasmids (plasmids containing target fragments of U. urealyticum) using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture by the real-time TaqMan PCR. Concentration = 10( 0.325d CT + 11.973), R value = .9956. Concentration = copies per reaction mixture; C T = threshold cycle number.
to have a 100% sequence similarity to the corresponding GenBank sequence. The sequencing results of 12 clinical isolates were as follows: 9 were U. parvum and 3 were U. urealyticum (all with 100% sequence similarity).
approximately 7 logs (1.0 101 to 1.0 108 copies). An initial copy number of 10 copies yielded a C T value of 32.42, whereas an initial copy number of 1.0 108 copies yielded a C T value of 12.18. As expected, every 10-fold decrease in the copy number brought an increase in the C T value of about 3. The standard curve of UUure plasmids was shown in Fig. 2, which was linear over 7 orders of magnitude with a correlation coefficient of .9956. Both standard curves showed a linear relationship between the C T values and the initial DNA copy number. The detection limit of each assay was 10 copies per reaction mixture. 3.4. Comparison of real-time TaqMan PCR with culture methods and conventional PCR
The 2 real-time TaqMan PCR assays, based upon base variation in the urease gene sequence, were designed to quantitatively detect and conveniently differentiate U. parvum and U. urealyticum. Two standard strains, 12 clinical isolates, 5 additional reference strains, and negative control (sterile water instead of template) were tested in triplicate in both UPure and UUure real-time TaqMan PCR assays. In the UPure assay, only U. parvum standard strain and the 9 clinical isolates (identified as U. parvum through sequencing) amplified. Only U. urealyticum standard strain and 3 U. urealyticum clinical isolates produced amplification curves in the UUure assay. Five additional reference strains and negative control showed negative results in both the UPure and UUure assays after 40 cycles of amplification, suggesting that these assays had a high degree of specificity.
The results by 3 different methods in 128 clinical specimens were compared in Table 2. The positive rate of real-time TaqMan PCR (59.4%, 76 of 128) was higher than that of culture methods (42.2%, 54 of 128) and conventional PCR (50%, 64 of 128). Ureaplasma was detected more frequently in vaginal swabs of antenatal clinic clients than in those of STD clinical clients. Convenient differentiation of U. parvum and U. urealyticum will be of great value to prove if there is correlation between the biovar and pathogenicity. In our study, of 76 (66+8+2) clinical specimens that were found positive by real-time TaqMan PCR, 86.8% (66 of 76) contained U. parvum only, 10.5% (8 of 76) contained U. urealyticum only, and 2.6% (2 of 76) contained both. Quantification is very important to determine the microbial burden of infection in relation to pathogenic potential. The accurate copy numbers per reaction mixture of all 76 positive specimens were automatically calculated according to the standard curves. The copy numbers of 11 positive specimens were in the range of 101 to 103 copies per reaction mixture, 18 in the range of 103 to 105, and 47 in the range of 105 to 108.
3.3. Standard curves and sensitivity of real-time TaqMan PCR assays
4. Discussion
Standard curves for each assay were constructed by using serial dilutions with copy numbers from 1.0 101 to 1.0 108 copies per reaction mixture of UPure plasmids and UUure plasmids, respectively. The standard curve of UPure plasmids was shown in Fig. 1. The linear range was
Studies of epidemiology and pathogenesis of infections with Ureaplasma have received much attention in recent years. In the present study, we described the development and evaluation of 2 real-time TaqMan PCR assays to quantitatively detect and differentiate U. parvum and
3.2. Specificity of real-time TaqMan PCR assays
Table 2 Comparison of real-time quantitative PCR with culture methods and conventional PCR for detecting Ureaplasma in clinical specimens Subjects
No. (%) of specimens with positive result Culture methods
STD clinic clients (40) Antenatal clinic clients (88) Total (128) a b c
U. parvum. U. urealyticum. both U. parvum and U. parvum.
11 (27.5) 43 (48.9) 54 (42.2)
Conventional PCR 14 (35) 50 (56.9) 64 (50)
Real-time quantitative PCR U.pa
U.ub
Mixedc
15 (37.5) 51 (57.9 66 (51.6)
2 (7.5) 5 (5.7) 8 (6.3)
0 (0) 2 (2.3) 2 (1.6)
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
U. urealyticum. The whole real-time TaqMan PCR assays took only about 1.5 h if previously extracted template was used, whereas conventional PCR with agarose gel electrophoresis took about 4 h. Real-time TaqMan PCR, by sequence-specific TaqMan MGB probes, amplified and simultaneously detected a target gene, thus, reducing the chance of cross-contamination and increasing the specificity. TaqMan MGB probes can discriminate allele with only 1 base variation. By the variation of 4 bases in the forward primers and 3 in the TaqMan MGB Probes, the real-time TaqMan PCR assays can absolutely differentiate U. parvum from U. parvum in our study. When applied to references and clinical isolates, the real-time TaqMan PCR assays of U. parvum and U. urealyticum showed to be highly specific. At the same time, convenient differentiation of U. parvum and U. urealyticum will be of great value to prove if there is correlation between the biovar and pathogenicity. The results of previous studies had indicated that the majority in clinical specimens belong to U. parvum (Kong et al., 2000). In our study, the percentage of U. parvum, U. urealyticum, and both species in 76 positive vaginal swabs was 86.8% (66 of 76), 10.5% (8 of 76), and 2.6% (2 of 76), respectively. Quantification is very important to determine the microbial burden of infection in relation to pathogenic potential. The accurate copy numbers per reaction mixture of all 76 positive specimens were successfully gained and analyzed according to standard curves. Real-time TaqMan PCR exhibited 10-fold–greater sensitivity than the conventional PCR results reported in the study by Nakao et al. (1997). In the present study, real-time TaqMan PCR showed at least 100-fold–greater sensitivity than the conventional PCR with the same primer sets and cycling conditions. Remarkably, all positive specimens with copy numbers in the range of 101 to 103 by real-time TaqMan PCR were negative by conventional PCR in the present study. That is to say, the real-time TaqMan PCR allowed for the detection at 100 times greater sensitivity than the conventional PCR with the same primer sets and cycling conditions. Recently, Mallard et al. (2005) have reported similar protocols of real-time PCR for differential detection and quantification of U. parvum and U. urealyticum. However, no clinical specimen was applied to evaluate the assays qualitatively and quantitatively. At the same time, the linear range of standard curve was only 5 orders of magnitude in their study that was 100 times lower than our research results. Yi et al. (2005) have presented protocols of real-time PCR in the allelic discrimination format in which the primers and the 2 biovar-specific probes were contained in 1 reaction well to amplify, and biovar-type Ureaplasma at the same time. Nevertheless, a few problems remained to be solved when operating aforementioned double real-time PCR. The competition of different biovar templates may affect the amplification efficiency of each biovar, the interaction of 2 biovar-specific probes may affect the detection efficiency of each biovar, and the sensitivity of
377
each biovar of double real-time PCR may be lower than that of single real-time PCR. Moreover, it is difficult to obtain the standard curve and quantify the study subjects. In conclusion, we developed and evaluated 2 real-time TaqMan PCR assays that would allow for rapid, specific, sensitive, quantitative detection and convenient differentiation of U. parvum and U. urealyticum. Further investigation is to apply our methods to more clinical specimens. In the future, quantitative detection and convenient differentiation of real-time TaqMan PCR assays will assist in the study of the pathogenesis and epidemiology of Ureaplasma infections.
Acknowledgments This work was supported by the Bureau of Science and Technology of Wuhan, Hubei, PR China. (grant 20066002053).
References Barton PT, Gerber S, Skupski DW, Witkin SS (2003) Interleukin-1 receptor antagonist gene polymorphism, vaginal interleukin-1 receptor antagonist concentrations, and vaginal Ureaplasma urealyticum colonization in pregnant women. Infect Immun 71:271 – 274. Gerber S, Vial Y, Hohlfeld P, Witkin SS (2003) Detection of Ureaplasma urealyticum in second-trimester amniotic fluid by polymerase chain reaction correlates with subsequent preterm labor and delivery. J Infect Dis 187:518 – 521. Goldenberg RL, Thompson C (2003) The infectious origin of stillbirth. Am J Obstet Gynecol 189:861 – 873. Higuchi R, Fockler C, Dollinger G, Watson R (1993) Kinetic PCR analysis: Real-time monitoring of DNA amplification reactions. Bio/Technology 11:1026 – 1030. Holland P, Abramso R, Watson R, Gelfand D (1991) Detection of specific polymerase chain reaction product by utilizing the 5V–3V exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88:7276 – 7280. Horner P, Thomas B, Gilroy CB, Egger M, Taylor-Robinson D (2001) Role of Mycoplasma genitalium and Ureaplasma urealyticum in acute and chronic nongonococcal urethritis. Clin Infect Dis 32:995 – 1003. Kong F, James G, Ma Z, Gordon S, Wang B, Gilbert GL (1999) Phylogenetic analysis of Ureaplasma urealyticum—support for the establishment of a new species, Ureaplasma parvum. Int J Syst Bacteriol 49:1879 – 1889. Kong F, Ma Z, James G, Gordon S, Gilbert GL (2000) Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays. J Clin Microbiol 38:1175 – 1179. Mallard K, Schopfer K, Bodmer T (2005) Development of real-time PCR for the differential detection and quantification of Ureaplasma urealyticum and Ureaplasma parvum. J Microbiol Methods 60:13 – 19. Nakao H, Mazurova IK, Glushkevich T, Popovic T (1997) Analysis of heterogeneity of Corynebacterium diphtheriae toxin gene, tox, and its regulatory element, dtxR, by direct sequencing. Res Microbiol 148: 45 – 54. Ollikainen J, Heiskanen-Kosma T, Korppi M, Katila ML, Heinonen K (1998) Clinical relevance of Ureaplasma urealyticum colonization in preterm infants. Acta Paediatr 87:1075 – 1078. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. 3rd ed. New York, USA7 Cold Spring Harbor Laboratory Press, pp 1–146. Tully JG (1993) Current status of the mollicute flora of humans. Clin Infect Dis 17(Suppl 1):S2 – S9.
378
X. Cao et al. / Diagnostic Microbiology and Infectious Disease 57 (2007) 373–378
Yi J, Yoon BH, Kim EC (2005) Detection and biovar discrimination of Ureaplasma urealyticum by real-time PCR. Mol Cell Probes 19: 255 – 260. Yoon BH, Romero R, Lim JH (2003) The clinical significance of detecting Ureaplasma urealyticum by the polymerase chain reaction in the
amniotic fluid of patients with preterm labor. Am J Obstet Gynecol 189: 919 – 924. Zheng X, Watson HL, Waites KB, Cassell GH (1992) Serotype diversity and antigen variation among invasive isolates of Ureaplasma urealyticum from neonates. Infect Immun 60:3472 – 3474.