Rearrangements of host and viral DNA in mouse cells transformed by Simian virus 40

J. Mol. Biol.

(1984) 177, 431-460

Rearrangements of Host and Viral DNA in Mouse Cells Transformed by Simian Virus 40 PHOERE MOUKTS~ AXI) THOMAS ,J. KELLY, JR Department of Molecular Biology and Genetics The Johns Hopkins University School of Medicine Baltimore, Md 21205. I’.S.A. (Received

27 April

1983, and in revi.sed form 25 January

1984)

We have determined the structure of host DKA and viral DNA at the site of integration of Simian virus 40 (SV40) in a line of transformed Balb/c-3T3 cells (SVB400) isolated by single cell cloning after virus infection. Recombinant phage containing integrated viral DNA and flanking host DNA were purified from a genomic library and, in conjunction with restrict*ion endonuclease cleavage analysis of the transformed cell DNA, were used to determine the organization of the integrated viral sequences. There is heterogeneity in the arrangement of the viral sequences resulting from tandem duplications of all or part of the XV40 genome with preservation of the viral-host junctions. The predominant arrangement is the result of tandem duplication of 41% of the SV40 genome from 0.64 to 0.23. Analysis of the structure of integrated viral DKA in SVB400 at different passage numbers and in single cell clones derived from the 20th passage indicated that rearrangements of viral D?U’A occur after the integration event and continue with passage of the cells. The organization of host sequences before and after the integration of SV40 was determined by restriction endonuclease cleavage analysis of parental 3T3 DKA and SVB400 DNA, and by analysis of recombinant phage isolated from genomic libraries. A deletion of at least 15 x lo3 bases of host DR;A occurred at the site of integration, which indicates that viral integration was not a result of a simple insertion of SV40. Kucleotidr sequence analysis of the virus-host junctions showed that. retained SV40 sequences were colinear with the viral genome, and that the junctions with SV40 DP;A occurred at nucleotide numbers 1377 and 3610. There was no evidence of duplications of viral or host sequences at the junctions, and a comparison of the flanking mouse sequences with the deleted SV40 sequences revealed no significant homology at the point of joining of the t,wo genomes.

1. Introduction The transformation of mammalian cells by tumor viruses is the result of the stable integration and expression of the viral genome (for a review, see Topp et al., 1981). One approach to the understanding of tumorigenesis is to reconstruct the integration event by examining the arrangement of the integrated viral sequences and the cellular attachment sites. In the case of the DNA tumor virus, t Present address: Department of Immunology and Infectious Diseases, The Johns Hopkins rniversity School of Hygiene and Public Health. Baltimore. Md Z120.5,I’.S.A. 431 0022%2838/84/230431-30

$03.00/O

ci‘) I98-1 Academic Press Inc. (London) Ltd.

I’

432

MOI

S’l‘h

,\NI)

‘I’

.I

l
*IIt

sl udiw ha\-ts utiliwd t Ire Sout hem i 1975~r) (.r;ulsti~r tt~hnology to show that t.htb inirgrai ion of the viral sequtwtw in noll-l)c,rtl’issi~~. InolIsc~ (*ells (Kotnw & Kt~lly. 1976.19X0) alIt rat c*tblls (t3otcahan (4 f//.. l!~i~i,l!M)). 197X) ant1 tliLrllSt?i (.(bIIs anti srmi-I)c:rrnissi~r human c.t,lls (( ‘amp0 d t/l.. ((‘ht~pilinsky d ~1.. 1980) is not sittwpecifita: thwart> is no single attacahment sittb ill t’hr viral grnomt’ or in t,hr host genorne. However. a more tlrtailt~tl analysis ma> indeed reveal prefttrrt~tl sites of int,t:grat.ion or nuclrwlide stqurnc*t~ spetaitititx. To (Jxaminr in d&ail both the organization of the integrated viral gtwomt’ and. mow importantly. the cellular seyuentw into which thr virus integrated. it is nc~cwsar>~ t’o isolate physically that viral srt~urnt:t~s with t htb atljacrnt host’ I>NA. \I’ts havIA dontt this by creating a genomit* library from a mouse cell line transformed by SV4OP (SVl<400). Anal,vsis of the genomes of thta rwomhinant phayca carrying t,h(a integrated SV40 1ISA and flanking mouse wqut-‘nces. in c~onjurwt.ion fvit,h restriction endonuclease tbleavage analysis of thr t ransformrd wll DSA by t,htl method of Southern ( 197%), rtavealeti that the viral srqurntw undergo rearrangements as the t:t~lls arts propagated. The generat,ion of tandem duplications of all or part of t,he SV40 genome without the involvement of t.hr adjacent host sequences results in a complex pattern of viral sequences in a Southern transfer. Rearrangement,s of integrated viral sequtwws have also hwn reported in mouse t~:lls t’ransforrnrd by SV40 (H’,Irtwtt rt a/., 1980: Kender H; Krockman. 1981: Sager et nl.. 19X1). Analysis of’ t hew rearrangement’s ma) suggest a recombination mechanism that could be responsible for generating thtk tandem duplications seen in multigene families and satellit’e I)NA common in thtx mammalian genome. We have also investigated t,he rrcombination between S\rlO and mouw wlls b\ examining the cellular sequences into whiczh the virus integrated to generate SVK400. The molec*ularly chItmet host sryuenws flanking t)he integrated vira,l T)?;A were used t’o examine the corresponding sequences in t,he parental Kalb/c3T3 f>NA prior to integration. Our analysis indicated that a rearrangement of the mouse genomr. a d&titm of at least 15 kb of I)NA, otw~rretl as a result. of the fC:videnw consistent with the loss of integration of the SV40 genome. chromosomal DNA at, the site of integrat)ion in S\T40 transformed rat t*cll lines has been presented by Kott>han et (I/. (1980) and St,ringw (1982). A nucleotide sequencr analysis of recombinant junctions in S\‘40 transformed rat t+ells by Stringer (1981) revealed no evidcnw of homology brtween the viral and host sequences. The nucleot~idr sequence anulJ.sis of the virus-host junt%ons in SVR400 showed no tluplications of viral or host st~~uentw at thr junc+ions and revealed no of thr flanking moust~ f)NA anti S\‘-CO srquenws a comparison significant, homology at thP point of joining of the two genomes. simiitn

virus 40. wvt*raI

2. Materials

and Methods

(a) ( ‘Pll.Uunrl ?~ir/tsr.s Balb/c-ST3 wlls and SVB400. Eagle’s minimal essential media t Abbreviations used sulfate: hp. bawpair.

SV40.

simiwl

a IMh/c~-ST~~/SV10 transformant. (MEM: l\lic~robiological Assoviatrs) virus 10; kh, IO” hasrs or has+pairs:

aerr

maintainrtl

supplrmrntrd

in with

SDS. sodium dodecyl

REARRANGEMENTS

1N SV40

TRABSPORMEI)

(‘ELLS

433

10% (w/v) fetal bovine serum. SVB400 was derived from an infection of Balb/c-3T3 cells with SV40 (small plaque, strain 776) at a multiplicity of 0.1 plaque forming units (p.f.u.) per cell. Three weeks after the infection, a focus was removed from the confluent monolayer with trypsin and a cloning rylinder, and single cell clones were obtained by end-pomt dilut,ion in a 1.6 cm microwell plate (Linbro). The clones were confirmed as SV40 transformants by an indirect immunofluorescent assay for T antigen (Shah et al., 1977). The transformed phenotype of the selected clone (SVB400) was established by determining that in comparison to the parental cells there was (1) altered morphology and growth pattern, (2) a shortened generation time. (3) reduced serum dependence. and (4) anchorageindependent growth when assayed by suspension in O.ZZ”,, (bv/v) agarose. SV40 DNA (form I) was prepared from African green monkey kidney cells (BBC-I) infected at, 10m3 p.f.u./cell according to the procedure of Hirt (1967) as modified by Danna & Xathans (1971). Viral DSA was separated from contaminating host sequences by elrc%rophoresis in a 1.4% agarose gel. The form I DNA was excised from the gel, dissolved in potassium iodide (Blin et al.. 197.5). and recovered by hydrox-lapatite chromatograph) (Southern. 1975b). (b)

Gcnomic

215.4

puri$ication

For the isolation of high molecular weight cellular DNA, cells were collected by c*ent,rifugation and lysed in 0.15 M-NaCl, 0.1 M-EDTA (pH 8), 1% sodium dodecyl sulfate and 100 pg Pronase B/ml (Calbiochem; heat inactivated). After an incubation at 37°C for at least 4 h, the lysate was extracted twice with phenol (distilled, saturated with 50 m,Yr-Tris (pH 8). I mM-EDTA and containing 0.1% %hydroxyquinoline; Sigma), and then extracted twice with chloroform/isoamylalcohol (24 : 1. v/v). The DNA was dialyzed exhaustively against 10 mM-Tris (pH 7.4), 1 mM-EDTA, 0.15 M-NaCl at 4°C. Following a 2-h incubation at 37°C: with RNase A (Calbiochem; previously heated to 80°C to inactivate DNase) at 20 pgjml, t,he DNA was again extracted with phenol and chloroform as described above, and dialyzed against TE buffer (10 mM-Tris (pH 7.4). 1 mM-EDTA) at 4°C. (lell DNA (20 pg) was digested with restriction endonucleases (purchased from Bethesda Research Laboratories or New England Biolabs) in 200.~1 volumes under the buffer and temperature conditions recommended by the vendors. The reactions were stopped by addition of SDS t,o 0.1% and the reaction mixtures were extracted with phenol and chloroform as above. The DNA was precipitat,ed with ethanol and dissolved in 50 ~1 of TE buffer for gel elrctrophoresis. (r)

Gel electrophowsis

a,nd transfer

DSA was electrophoresed on a 1% or lWO (w/v) agarose (Sigma) slab gel in 40 mMTris. HCl (pH 7.5). 20 m&%-sodium acetate, 1 mw-EDTA at 2 V/cm. The gel was stained with ethidium bromide (0.5 pg/ m 1) and photographed under ultraviolet light with Polaroid type 57 film. The DNA was then denatured in situ with 0.5 sf-NaOH, 1.5 M-NaCI. neutralized in 1 M-Tris (pH 5) (\‘g h-1 ma 7.9), 1.5 M-NaC1. and transferred to nitrocellulose in 20 x SS(I (RX is 0.15 M-NaCl, 0.015 M-sodium citrate) according to the method of Southern (197%). The filt~rr was rinsed in 2 x SW. dried and baked under a vacuum at 80°C for 2 h. (d) Hybridization DNA probes were radioactively labeled with [u-~‘P]TTP and [cr-32P]dCTP (Amersham. 400 Ci/mmol) to a specific activity of 10’ cts/min per /lou by in vitro nick translation as previously described (Rigby et al., 1977; Maniatis et a,Z., 1975). The nick-translation reaction was terminated by the addition of SDS to WI?&. The reaction mixtures were then cbxtracted with phenol and ether, and the unincorporated nucleotides were removed b2 passage over a Sephadex G-50 (Pharmacia) column. In later experiments, the reaction was t’erminated by the addition of 4 vol. of 2.5 M-ammonium acetate and unincorporated nucleotides were removed by 2 precipitations with ethanol (Maxam & Gilbert, 1980). Prior to hybridization, filters containing immobilized DNA were incubated at 65°C for 3 h in IO x Denhardt,‘s solution (0.23,, Ficoll (Pharmacia). 0.204 polyvinylpyrrolidonr

434

I’

X101-N’I’S

ANI)

‘I’. .I

KEI,I,l-.

,lIi

(PVP-360, Sigma), 0.X(!/, (w]v) hovine serum albumin (Sigma): Denhardt’. 1966: Jeffreys & Flavell, 1977) in 6 x SSC. The filters were incubated in hybridization buffer (4 x SSC’. 20 m?n-sodium phosphate (pH 6.8), 2 mM-EDTA. W;i’!;, SDS. I x Dmhardt,‘s solution) containing the labeled probe for 48 h at 68°C in a rotating glass cylinder (Dunn & Samhrook, 1980). Following hybridization, filters were washed in 2 x SW, 0.5~~0 SDS at 68°C for 4 h, rinsed in 1 x SSC at room temperature and air dried. The filters were exposed to Kodak XR film with a C:ronex Hi-plus intensifying screen (DuPont) at, -70°C’ or to Kodak XS film at room temperature. (tl)

Molecular

cloning

Libraries of genomic DNA from Balb/c-3T3 and tenth passage SVB400 cells were constructed in the phage lambda derivative Charon 4A (Blattner et al.. 1977) by the procedure of Maniatis et al. (1978). The libraries were constructed in collaboration with Keith Peden using an EK2 host ~vector system and in P3 containment facilities in accordance with the NIH guidelines. Genomic DNA was digested with EcoRI in 4 separate reaction mixtures under conditions designed to yield 3 degrees of partial digestion as well as complete digestion, and the reaction products were mixed. Charon 4A DNA was digested with EcoRI and the end fragments annealed at 45°C for 1 h. The end fragments of Charon 4A and the high molecular weight fragments (15 to 20 kb) of genomic DNA were purified on a 10% to 40% linear sucrose gradient as described by Maniatis et al. (1978). The size-selected 3T3 or SVB400 fragments (16 pg) were ligated to the vector (45 pg) in a reaction mixture (335~1) containing 3 units of bacteriophage T, polynucleotide ligase (BRL) and ligase buffer. The ligation conditions were designed to produce concatemers that would be efficiently packaged in vitro (Hohn, 1979) and the extent of ligation was assayed by electrophoresis on a 0.3% agarose gel. The resulting recombinant DNA was coli strains NS428 and packaged into phage particles with extracts from the Escherichia N’s433 according to the procedure of Enyuist & Sternberg (1979). The phage particles were purified on a C&l step gradient as described by Maniatis et al. (1978), and the phage were titered on E. coli DP50su~F. The yield of recombinant phage was 8 x 106. a lo-fold excess over the number estimated by Maniatis et al. (1978) to be necessary for a 9976 probahility of obtaining a single copy sequence in a mammalian library with 17.kb inserts. The recombinant phage were amplified in E’. coli DP50supF and screened by hybridization with radioactive DNA by the method of Benton & Davis (1977). A total of 16,000 phage were plated per 15 cm Petri dish and screened in duplicate by sequent,ial application of nitrocellulose filters (Schleicher and Schuell, BA85). Th e recombinant phage of interest was plaque-purified 3 times before being grown in preparative liquid cultures. Phage were with polyethylene glycol. followed 1)) purified from the lysatr by precipitation centrifugation in C&l as described by Blattner (personal communication). The plasmid vectors pBR322 (Bolivar et al., 1977) and pBR325 (Bolivar. 1978) were used to subclone DNA fragments from recombinant phage. The plasmid vector DNA4 was digested with the appropriate restriction endonuclease and treated with calf intestinal alkaline phosphatase (Boehringer-Mannheim) according to Goodman & MacDonald (1979). Phage DNA was digested with the appropriate enzyme and ligated to the vector DNA using T, DNA ligase (BRL) in standard conditions (Dugaiczyk et al., 1975). The ligation mixture was used to transform E. coli strain HBIOI by the calcium c*hloride method (Mandel & Higa, 1970; Lederberg & Cohen, 1974), and colonies with the appropriate antibiotic phenotype were selected. The recombinants of interest were identified by the 1975) and by the alkaline screen colony hybridization method (Grunstein & Hogness, method (Birnboim & Daly, 1979). Plasmid DNAs were isolated and purified by C&l gradient centrifugation as described by Peden et al. (1982). (f) Preparation

and

analysis

qf phage

D.VA

Phage preparations were dialyzed against TE buffer for 4 h to remove incubated for 2 h at 37°C in 1% SDS, 100 pg proteinase K/ml (Merck).

C&l and then The resulting

REARRANGEMENTS

IN

SV40

TRANSFORMED

CELLS

43.5

solution was extracted with phenol and chloroform as described above. The phage DNA was collected by precipitation with ethanol and dissolved in TE buffer. The DNA was analyzed by restriction endonuclease digestion as described above and by electron microscopy as described by Newell et al. (1979). For heteroduplex analysis, a 10 ~1 solution containing 50 ng of recombinant phage DNA, 50 ng of Charon 4A DNA and 150 ng of SV40 DNA (linearized by digestion with EcoRI) was adjusted to 0.1 M-NaOH to denature the DNA. After 5 min at room temperature, the solution was neutralized by the addition of Tris HCI (pH 7.0), to 0.1 M and formamide (MCB) was added to a final concentration of 50:/,. The DNA was allowed to renature at room temperature for 1 h and was then mounted for electron microscopy as described by Davis et al. (1971). (a) Nucleotide sequencing DNA sequences were determined by the method of Maxam & Gilbert (1980). Restriction enzyme sites in the recombinant DNA used for sequence analysis were localized by the partial digestion mapping procedure described by Smith & Birnstiel (1976). The nucleotide sequence for the left junction was obtained from labeling a Hind111 site at SV40 map position 0+359 and confirmed by sequencing the opposite strand by labeling a BstNI site in the 3T3 DNA. The nucleotide sequence for the right junction was obtained by labeling a DdeI site in the 3T3 DNA and confirmed by labeling the HinfI site at SV40 map position 0.35. I)NA was radioactively labeled at 3’ ends of restriction fragments with a suitable 32Plabeled deoxynucleoside triphosphate (2000 to 3000 Ci/mmol; Amersham) and Micrococcus luteus DNA polymerase I (Miles) as described by Shortle & Nathans (1978). Using a 0.4 mm thick, 85 cm long gel system (BRL; Sanger & Coulson, 1978) the nucleotide sequence could be determined for more than 300 nucleotides from the labeling site. The nucleotide numbering system for SV40 is taken from Tooze (1981).

3. Results (a) Arrangement restriction

of integrated S V40 DXA in SVB400: endonuclease cleavage analysis

The arrangement of the integrated SV4O sequences in the transformed cell SW400 was examined using the Southern transfer technology. SV40 DNA, labeled in vitro with 32P by nick translation, was hybridized to Southern transfers of transformed cell DNA digested with various restriction enzymes. Analysis of the transformed cell DNA with rest’riction enzymes whose recognition sequence is not present in the SV40 genome allows one to count the number of sites at which the viral genome has integrated. The results of such an analysis of SVB400 are shown in Figure 1, lanes 2 to 4. Digestion with SstI (lane 2) or its isoschizomer Sac1 (lane 3), or BgZII (lane 4) produced one band that hybridized to SV40 DNA, indicating one integration site. No specific bands of hybridization were observed in undigested SVB400 DNA (data not shown) indicating the absence of free viral genomes. Southern transfer analysis of transformed cell DNA with enzymes that cleave SV40 DNA at multiple sites demonstrated that there was more than one copy of t,he viral genome integrated. Figure 2 shows the hybridization patterns obtained when SVB400 DNA was digested with HpaI (lane 2) and PvuII (lane 4). For comparison, lanes 1 and 3 show the hybridization patterns of SV40 DNA, which was added to 3T3 DNA at a single copy per diploid genome equivalent and digested with the same enzymes. It is apparent that all of the authentic PvuII and HpaI fragments of SV40 DSA are represented in the transformed cell DNA.

* FIG. 1. Analysis of SVB4oU DNA digested with XstI, SKY and Bg1II. Kestriction of SVB409 DNA were fractionated by agarosr gel elertrophomsis, and the DNA to nitrocellulose filters by t,hr method of Southern (1975a). Fragments containing detwted by hybridization wit.h radioact,ivr viral DNA. Lane 2. 8stI digest: lane Q/I1 digest: lanr I wntains a HumHI tligvst of 2’“” I)N:I hybridized with molecular weight standards of’ 1!).543, lli.WX. 7226. 64.986 and 56% bp.

endonuclease digests fragments transferred SV40 sequences were 3. Sac1 digest: lane 4. rstlioactivr DXA for

Since there is a single integration site, this result suggests that there is a tandem duplication of the viral genome. Also detected were fragments that did not comigrate with authentic SV40 markers. These fragments are presumed to represent “junction fragments”. which contain adjacent host sequences as expected for an integrated genome. For example, in the PwuII digest of SVB400 (lane 4) there are two such junction fragments of about 3 kh and 1 .fi kb, which do not have a counterpart in the PvuII digest of SV40 I)SA (lane 3). Only one junction fragment is visible in the HpaT digest (lane 2). A juncation fragment may not be detected for any one of several reasons: the location of the enzyme recognition sequence may be close to the junction so that the junction fragment may not contain sufficient W40 sequences for detection: the junction fragment may comigrate with an authent,ica fragment; there may be inefficient transfer of a large junction fragment; or there may be inefficient binding to the nitrocellulose of a small junction fragment. The integration of the viral genome as a tandem duplication was confirmed by analysis with enzymes bhat cleave the SV40 genome once, as shown in Figure 3. The production of a unit-length linear fragment of 52 kb in each digest is diagnost’ic of a tandem repeat. Also expected are two bands that represent the junction fragments. For example, in t,he BamHI digest (Fig. 3, lane 2) there are, in addition to the fragment, wit’h the mobility of a full-length linear SV40 DNA molecule (lane l), two bands of approximately 6.7 kb and 4.8 kb. However, in the digests with T~QT (Fig. 3. lane 5). NpaII (lane 4) or EcoRI (lane 3) more than two

REAKRANGEMEXTS

IN SV40 I

2

TKANSFOKhIEI) 3

(‘ELLS

43;

4

FIG. 2. Analysis of SVB400 DNA digested with Hpnl and Pvull. Fragments containing SV40 sequences were detected in the Southern transfer analysis by hybridization with radioactive viral DNA. Lane 2, Hpd digest,; lane 4, PwII digest. For comparison. HV40 DNA was added to Balb/c-3T3 DNA at a single copy per diploid genome equivalent prior to restriction endonuclease digestion. Lane 1. HpaI digest with fragments of 2147, 1992 and 1067 hp: lane 3. PwTT digest with fragments of 1990. 1790 and 1446 bp.

bands were present. Appropriate control experiments demonstrated that these bands were not due to incomplete enzyme digestion or contaminating enzyme activity. Thus, the results from Southern transfer analysis with numerous restriction enzymes indicated that’the viral genome was integrated as a tandem duplication at a single site in the mouse genome. However. due to the presence of unexplained fragments in certain digests (e.g. TagI? HpaII and EcoRI). it was not possible to construct a linear structural map of the integrated SV40 DNA consistent with all of the data. To define further the structure of t,he integrat)ed viral sequences in SVB400, we isolated the integrat’ed SV40 sequences from t,he transformed cell DNA using recombinant DNA methods. (b) Arrangement

of integrated 81’40 DNA structure of the cloned D-VA

in SVB400:

As described in Materials and Methods. an EcoRI library of SVB400 DNA was constructed in the phage lambda derivative Charon 4A. In a screen of 260,000 I6

3

5

6

_

. ‘,

8

.

.

DC:. 3. Analysis of SVB400 DNA digwtrtl with BarnHI containing SV40 sequences wwc dntrctrd in the Southern transfer analysis hy hvbridization with radioactive viral DNA. Lane 2, HamHI digest: lane 3. EcoKl digest. lane 4, HpII digest: lane 5, TapI digest; lane 1 is a BczmHl digest of SV40 T)NS added to Balb/v3T3 DSA at a single copy per cell genome equivalent; lane 6 is an EcoRI plus Hind111 digest of 2’s” DNA hybridized with radioactive DNA for molwular weight standards of 2 I.864. 5355. 53.012. 4324. 2113. 1671 and 1621 bp.

plaques from the phage library. t’wo phage were identified as containing SV40 sequences, using the plaque hybridization method of Renton & Davis (1977). This number is in good agreement with the estimate of Maniatis et al. (1978) for the frequency of occurrence of a single copy sequence present in a mammalian library with 17-kb inserts (l/180,000). The phage containing viral sequences were plaquepurified three times so that 1000,; of the phage were positive by hybridization, and DNA was prepared as drscribed in Mat’erials and Methods. Since the structures of t’he two recombinant phage were found to be identical. only one, 01 l-48, will be described. The analysis of the recombinant phage 011-48 indicated the presence of more than one species of recombinant genome despite three plaque purifications. The structure of the major species was determined by heteroduplex analysis and restriction endonuclease digests. An electron microscopic examination of DNA

REARRANGEMENTS

IN

SV40

TRANSFORMED

CELLS

(b)

A Long arm ol Charon 4A (DS) S Short am 09 Charon 41 (DS) C Displocrd SS Charm 4A D SV4D DS E Ywu DNA SS F Your DNA SS G SV4D SS Toil H sv4D ss Toil

(cl

011-48 12.5 kb

2.57kb

to.07

k47k.b,004 IO.9 hb f QI

t o*i+_oo4

t 031 io.01 Clockwise on sv40 mop

Fro. 4. Electron microscopic analysis of recombinant phage 011-48 DNA. (a) A heteroduplex composed of 1 strand of 011-48 DNA, 1 strand of Charon 4A, and 2 strands of SV40 DNA (linearized by digestion with EcoRI). The arrows indicate the junctions between SV40 and mouse DNA. (b). The interpretive drawing where the double-stranded (DS) regions are shown thicker than the singlestranded (SS) regions. (c) Length measurements of heteroduplex molecules. The thin lines represent the arms of Charon 4A. The solid bar represents the integrated SV40 and the open bar represents the flanking mouse sequences. Single- and double-stranded +X174 phage DNA molecules were used as length standards.

tCtBtDt

A

tFtEt

C

t

B

t

H/ndILt

tA

t0

t

ct

PVUII

IJIG. 5. The restriction endonuclease vlravagr map of the major recombinant phage in the 01 l-48 population. The integrated SV40 DNA is denoted by the thick line and the flanking mouse DSA is denoted by the thin lines.

from 011-48 indicated that the predominant phage in the population contained an insert of 12.5 kb with 1.6 copies of the SV40 genome flanked by non-SV40 sequences (Fig. 4). A mixture of 011-48 DNA, Charon 4A DNA, and SV40 DNA linearized by digestion with EcoRT was denatured, allowed to anneal, and analyzed by electron microscopy as described in Materials and Methods. Figure 4(a) shows a typical heteroduplex containing two SV40 genomes hybridized to the 01 l-48 insert. Length measurements on similar heteroduplex molecules are summarized in Figure 4(c). The lengths of the two single-stranded tails of SV40 DNA (segments G and H) were 0.06 and 0.69 SV40 map units. respectively. The orientation of the SV40 DNA segment was det’ermined by heteroduplex analysis with SV40 DNA linearized by digestion with RglT. These data place the termini of the integrated viral DNA at SV40 map positions O-94 and 0.31. The 8.5 kb of SV40 DNA is flanked by single-stranded regions of 2.5 kb and 1.5 kb, which do not c*ont,ain viral sequences and are cellular in origin. The structure of the major DNA species present, in t.he 011-48 population was confirmed by analysis of restriction endonuclease cleavage product,s. The fine structure map shown in Figure 5 was derived from size determinations of restriction fragments by electrophoresis in agarose gels wit,h lambda DNA (Charon 4A, Rlattner et al., 1977) and SV40 DNA (Fiers et al., 1978; Reddy rt al.. 1978) as standards (Fig. 6(a)). The SV40 sequences were localized in the restriction digests by Southern transfer analysis with an SV40 probe (Fig. 6(b)).

FIG. 6. Restriction endonuclease analysis of rwombinant phage 011-48 DNA. DNA fragments were fractionated by electrophoresis in a 19, agarosc gel. (a) Ethidium-bromide-stained gel. (b) Southern transfer of gel shown in (a) hybridized with radioactively labeled SV40 DNA. Lanes a and p, EcoRl digests of 011-48 DNA; lanes b and y. EroRI digests of Charon 4A DNA; lane c, BeoRI digest of SV40 DNA; lane d, Z’uqI digest of 01 l-48 DNA: lane e. Tu9I digest of Charon 4A DNA; lane f, TagI digest of SV40 DNA; lane g, KpnI digest of 01 l-48 DNA: lane h, KpnI digest of Charon 4A DNA; lane i, KpnI digest of SV40 DNA; lane j, BgZI digest of 011-48 DNA; lane k, BgZI digest of Charon 4A; lane 1, BgZI digest of SV40 DNA; lane m, BumHI digest of 011-48 DNA; lane n, BamHI digest of Charon 4A DNA: lane o, BamHI digest of SV40 DNA.

KEAKKANGEMENTS

0

b

c

d

e

IN Si’40

f

g

h

TKANSFOKMEI)

I

(b)

Fro. H

J

k

(‘ELLS

1

m

441

”

0

P

142

I’

MO17S’I‘S

AisI)

‘I’. .I. KKI.I,\‘.

*II{

,\-\s an example of this typck of analysis. digestion of 01 I-48 with EcoKI (Fig. 6(w). Iatl~ a) produced three major fragments of 7.5. 4.4 and 0.38 kb. whic~)r Alice r~c)t present in EcoRI digests of the parental Charon 4A vector (lane b). Two of thestt fragments (7.5 and 4.4 kb) contained SV40 sequences. while the third (0.38 kb) caontained only cellular sequences (Fig. 6(b), lane a), The estimate by gel electrophoresis of the insert] size of 12.3 kb compares well with the size of 12.5 kh as determined by electron microscopy. Analysis of the data in Figure 6, as well as additional digests, placed the virus-host junctions at SV40 map positions 0.9% and 0.3.5, which is also in agreement with the electron microscopic measurements. The Southern transfer analysis in Figure 6(b) revealed hybridization to fragments that are not readily visible in the ethidium-bromide-stained gel. The presence of these bands in non-stoichiometric amounts is the result of thtx heterogeneit’y in the phage population. The heterogeneity in the recombinant phage population was due to the presence of two minor species cont’aining t’andem duplications of the SV40 genome. The structure of the phage present as minor by restriction endonuclease digests and elect’ron specsirs was determined microscopic analysis. One minor species was found to (Bontain an additional complete SV40 genome inserted in tandem. The minor 5.2 kb fragment visible in the EcoRI digest of the autoradiogram shown in Figure 6(b) (lane a) is a fulllength linear molecule of the SV40 genome. Electron micaroscopic: studies (‘onfirmed the rxistencar of a minor species of phage T)NA cont’aining 2.6 copies of the SV40 genome. whi& would generate such a full-length linear molrc~ule in addition to t,he fragments of 7.5. 4.4. and 0.38 kl ) when digested with KcYJRI. A sample of 01 l-48 DNA was denatured. allowed t,o reanneal. and then examined by electron microscopy. A few molecules were found t,o contain a single-stranded displacement loop of 5.2 kb (Fig:. 7(a)). These molecules represent heteroduplexes formed when a phagr genome containing 1.6 copies of the SV40 genome (the major species) annealed to a phage genome containing 2.6 copies. The struct’ure of the latter phage genome is shown diagrammatically in Figure 9(c). The electron microscope analysis revealed the presence of a second minor species of recombinant phage genome, which cont,ained a tandem duplication of part of the SV40 genome. The single-stranded displacement loop shown in Figure 7(b) is 2.2 kb and represent,s a duplication of approximately 41’$) of the SV40 genome. The limits of the partial duplication were mapped in the elect~ron microscope by digesting 01 l-48 DNA with EcoRT before the denaturation for the elec%ron microscopic analysis and determining the position of the displacement loop relative to the EcoRI ends (not shown). Length measurements indicated that t,he position of the 2.2 kb displacement loop was variable as a result of branch rnigration within the duplicated region. The limits of the branch migration define the length of the duplication. The results of such measurements indicated that the duplication extended from SV40 map co-ordinate 0.64 t,o 0.23 and was contained on the 7.5 kb EcoRT fragment. The size and position of the partial duplication was confirmed by analysis of rrst,riction endonuclease digestion products of 01 l-48 DKA. If the region from 0.64 to 0.23 is duplicated. then digestion with an enzyme that cuts the SV40 genome once within t,his region should generate a fragment t,hat is the size of the

REARRANGEMENTS

IN SV40

TRANSFORMEI)

(‘ELLS

ation of TIC;. 7. Electron micrographs of heteroduplex molecules formed by denaturation-renatur -48 DSA. (a) Heteroduplex generated by the hybridization of a phage genome contail ning I.6 )ies of the ST40 genome (the major component of the 01 l-48 population) with a phage genome staining 2.6 copies of the SV40 genome. The average length of the single-stranded loop matrked by arrow was 5.2 kb (unit length SV40). (b) Heteroduplex generated by the hybridization of tl le major ties of phage DNA in the 01 l-48 population with a minor species containing partial tandem Jlication of SV40 DNA. The length of the single-stranded loop marked by the arrow is 2.2 Ikh (41°, iv40\.

FIG. 8. Southerr transfer analyxis of wvmbinant phage 01 I-48 UNA. Lane 1. 7’qI digest,: lane 2. Pstl digest: lanr 3. 7’ql plus I’sfl digest. lane 1. Hind111 digest; lane 5. PculI digest. The arrow indicates a minor band of 2.3 lib. which ix l~rw’ent in thP 7’uyI and EstI digests. Double digestion of 011-48 DNA with ‘/‘r/r/I I)luh I’.rtI prwretrs a t’ragmrnt of approximately 0.5 kh. This fragment is visible in a longer vxl~~~uw (insrt ) whew it c~ourigrates with thr Hiad 1) frapmrnt (5% bp).

tandem duplication. Digestion of’ 01 1-48 I)NA wit,h TagI, which cuts the SV40 genome at, 0.56. or PsfT. which cut)s at 0.28, produced fragments that were present amounts and were 2.3 kb; in agreement with in the digest’ in non-stoichiometri(s the microscopic. est)imat.e of 1.2 kh (Fig. 8. lanes 1 and 2). A double digest of Tag1 plus Pstl (Fig. 8. lane 3) should eliminate the fragment representing the tandem duplication and generate a novel fragment of about 570 base-pairs that extends

445

sv40 0 92

(c)

+

057

75kh

0270

-

57

0 27

0

0 57

52kb

0 35

+44kb+

FIG. 9. Restriction endonuclease cleavage maps of the 3 recombinant phage DNA species present in t,he 011.48 population. The solid bar represents the integrated SV40 DNA and the thin lines the flanking mouse DNA. The co-ordinat,es of the SV40 genomt’ WC given beneath the viral DNA and the sizes of the EcoRI fragments are given above.

from the PstI site to the TuqI site (see Fig. 9 for diagram). The inset in Figure 8 shows a longer exposure in which the novel junction fragment is visible (indicated by an arrow) and has a mobility approximately the same as that of the 526 bp HindIIID fragment. EcoRI digestion of the phage containing the 2.2 kb partial genome duplication would generate a minor 9.2 kb fragment, as was observed (Fig. 6(b), lane a). This fragment contains the 7.5 kb fragment plus the tandem duplication of the SV40 genome from O-64 to 0.23 as shown diagrammatically in Figure 9. Thus, all of the bands in the EcoRI digest of 011-48 hybridizing to the SV40 probe (Fig. 6(b), lane a) can be accounted for by one of the phage structures in Figure 9. (c) Arrangement romparison

of the integrated S 1’10 lILYA in SVH400: of the structure of thr cloned DIVA and transformed cell DLVA

The relationship between the cloned D?;A and the integrated viral RVB400 was examined by restriction endonuclease cleavage analysis.

sequences in An example

o-

b-

FK:. 10. Southern transfer analyhis of DNA from thr recombinant phage 01 l-48, the transformed cell line SVB400, and SV40 digestrd I\ ith 1’wlI and hybridized with radiowtivrl~labeled SV40 DNA. The 3 SV4O/PvuII fragments. Ixbrl~~l a (1990 bp), h (1790 bp). and c’ (1446 bp), represent a rwonstruction of a single col’y of’ S1.4o prr ST.1 wlI grnomr wluivalent.

is presented in Figure IO. which compares the hybridization pattern of SVB400 DKA digested with PvuTI, when SV40 DNA is used as a probe. The three fragments generated by a f’~ulT digestion of SV40 T)XA are also shown. In addition to the authentic SV40 fragments. the two junction fragments of 3 and 1.6 kb, which contain both SV40 and mouse DNA. are present in t,he recombinant, phage and have the same mobility as their counterparts in t’he transformed cell DNA. Thus, there was no detectable rearra,ngement of the junction fragments during the construction or propagation of the recombinant phage. Figure 11 shows a comparison of the hybridization patterns of SVB400 DNA and 01 1-48 DNA digested wit,h k:coRI. An &oHT linear molecule of SV40 is also shown. Since all of the bands seen in the 01 l-48 digest have counterparts in an EcoRl digest of WB400. all three species det,ec:ted in the 011-48 recombinant phage population are present in the transformed cell. However, since the relative intensities of t’hr various bands are different in the two digests, it is evident that) the relative abundance of the three species in SVB400 DNA is different from that in the 01 l-48 DNA. In particular, in 011-48

REARRANGEMENTS sv40

IN SV40

TRAXSFORMED

SVB400

CELLS

447

011-48

5.2

FIG. 11. Southern transfer analysis of DNA from the recombinant phage 011-48, the transformed cell line SVB400, and SV40 digested with EcoRI and hybridized with radioactively-labeled SV40 DXA. The sizes of the fragments are given in kb. The SV40 marker has been added to 3T3 DNA at a single copy per wll genome equivalent.

DKA the 7.5 kb fragment is present in considerably greater amount than the 9.2 kb fragment, but the relative intensities of these two fragments is reversed in SVB400 DNA. It follows that the majority of t’he integrated viral DNA segments in SVB400 contain the 2.2 kb partial tandem repeat of XV40 DNA, which is present in only a small fraction of molecules in the 011-48 population. The 5.2 kb unit-length linear fragment remains a minority species in the SVB400 DNA (compare the intensities of the 5.2 and 4.4 kb fragments), although its abundance relative to the other fragments is somewhat greater than in 011-48 DNA. In summary, the transformed cell population is heterogeneous with regard to the structure of the integrated viral sequences. The most prevalent structure contains approximately 10.7 kb of viral sequences arranged as a tandem duplication of 1.6 copies containing an additional internal tandem duplication of 41% (2.2 kb) of the early region. Two variations of this basic structure are observed at lower frequencies. One lacks the internal partial tandem duplication, the other contains an additional complete SV40 genome inserted in tandem. (d) Evolution

of the integrated

viral

sequences

The heterogeneity in the organization of the int,egrated viral sequences in SVB400 was examined at cell passage number 10, number 20, and in five single

cell clones derived from the 20th passage populat,ion. t)NA was isolated, digested with E’coRT, fractionated on a I(),, agarose gel. transferred to nitrocellulose, and hybridized with 32P-lat~rled SV40 DNA. Thp results shown in Figure 12 demonstrate that rearrangements in t,he int*egra,ted viral sequences continue wit,h passage of cells in culture. Lanes I and 2 compare 1)N.A from passage 10 and passage 20 cells. respwtirrly. In t,he passage 20 population. the 5.2 kb band is reduced in relative intensity and hence in relative abundance. ,Minor bands that are not present at passage 10 are visible at passage 20. For example. the minor band of approximately A.6 kb (indicat,ed hy an arrow) is not visible at passage 10 but, is present in the passage 20 population and in t,he single cell cllone (1 (lane 4) derived from t)he 20th passage. 4n analysis of the I)NA prepsred from t hr single cell clones at the fourth passage is shown in Figure 12. Two of the, clones. SVR4WIC (lane 6) and SVR4OOF (lane 7). have the arrangement3 of integrated SV40 I)XA that predominates in the parent,al population (lam, 2). Tn pticular. c*lones E and F possrss the 9.2 and 4.4 kb tc:coRl fragments diagnostic. of IO.7 kh of viral I)N;A including t,he tandem duplic-ation of the SV40 grnome from 0.64 to 0.23. Since neither of these suhclones contains the 7.5 or 5.2 kb bands. the heterogeneity observed in the parental population is a result’ of the rearrangemrnt~s of the viral sequences occurring in

REARRANGEMENTS

IN SV40

TKANSFORMEI)

(‘ELLS

449

difierent cells. Clones B, (: and I> (lanes 3, 4 and 5, respectively) contain rearrangements that were detected as minor species in the parental population. The structural of the viral DNA in these three clones that could not be determined from the analysis of the recombinant phage is being investigated. Nevertheless, t)hr EcoRI digests indicate that one or the other of the SV40-host junctions are preswvrd in these three clones since either t)he 9.2 kb fragment or the 4.4 kb fragment is int,act in each of the lines. It is also interesting to note that none of the single cell clones analyzed contained either a tandem duplication of t.he wholr S\‘U) genome, or the 7.5 kb fragment. The faint bands in clones C: and I) also suggest the presence of minor species as early as the fourth passage. Thus. the generation of tandem duplications in the integrated viral sequences may be resl)onsiblr for the complex viral structures commonly seen in t,ransformed cells. (fa)

Arrangew~ent

of wbouse sequences at the sitr of S V30 indegmtion: restriction endonuclraw analysis

The arrangement of the mouse sequences into which the SC’40 genome integrated to produce SVB400 was analyzed by using the molecularly cloned host I)?iA flanking the integrated viral genome as probes in a Southern transfer analysis of Balb/c-3T3 DNA. Regions of the flanking host sequences were subcloned from t’he recombinant phage, 01 I-48. and are shown diagrammatically in Figure 13(a). The five recombinant plasmids were independently labeled with 32P by nick translation and hybridized to 3T3 Dh’A digested with EcoRI to analyze the structure of the mouse sequences prior to integration (Fig. 13(b)). The plasmid pRP0. which contains 2.5 kb of flanking mouse sequences from the left side of the integrated viral genome, hybridized to a 9 kb EcoRI fragment (lane 1). The plasmid pBd23, which contains 800 bp of mouse DNA and 300 bp of SV40 spanning the left virus-host) junction, hybridized to the same fragment (lane 2) indicating that the flanking host sequences from the left side are unique in the 3T3 genome and are contained on a 9 kb fragment,. The flanking host DNA from the right side cont’ained repeat’ed sequences that hyljridize throughout the genome. The plasmid pR8, which contains 380 bp of mouse DNA, hybridized extensively to the 3T3 genome (lane 5) and pR44, which cont’ains 1.1 kb of mouse DNA and 400 bp of SV4C) DNA, hybridized to many fragments but predominantly to a 2.5 kb fragment’ (lane 4). The plasmid pBd3, which contains 300 bp of mouse DNA and 400 bp of SF’40 DNA from the right virus-host, junction, hybridized exclusively to a 2.5 kb EcoRI fragment. Eo hybridization is seen when SV40 is used as a probe (data not shown). The fact that mouse sequences at the junctions hybridized to different segments of the cell genome indicated that a rearrangement occurred as a result, of. or subsequent t,o, the integration of SV40 DNA. (f) Arrangement

of mouse sequences at the site of S 1’40 integration: structure of the cloned DNA

To determine the nature of the rearrangement of the host sequences at the integration site of SV40, we ut’ilized the molecularly cloned flanking mouse

I’. MoI.S’l’S

450

+-------EcoRI 1

pR20

,JNl)

-~-pm. EcoRI 1

0 92 0 67 f t BumHI h’hdEI kpBd23 i

Skb

‘I‘ .I. KEI,L\‘.

0

.lR

pR44+pRBl EcoRI EcoRl 4 1 0 67

0 35 t t r‘f/ndYUI Bum HI +pBd3+

-

-

25kb

(b)

FIG. 13. Analysis of Balb/c-3T3 DNA homologous to the sequences flanking the integrated SV40 genome in the cell line SVB400. Balb/c-3T3 DNA was digested with EcoRI, fractionated by electrophoresis on a 1% agarose gel and transferred to a nitrocellulose filter. The filter was divided into 5 strips, which were hybridized independently with radioactively labeled probes derived from cellular sequences flanking the integrated SV40 DNA m the transformed line SVB400. (a) The map of integrated SV40 DNA (thin line) and flanking mouse DNA (thick lines) in SVB400 as isolated in the recombinant phage 011-48. The map co-ordinates of the SV40 genome are given with the virus-host junctions at map positions 0.92 and 0.35. The fragments transferred to plasmid vectors and used in the hybridization analysis are indicated by arrows. The EcoRI fragments were cloned in pBR325: pR20 contains the 7.5 kb fragment, pR44 contains the 4.4 kb fragment, and pR8 contains the 0.38 kb fragment. The virus-host junction fragments were cloned in pBR322 as BarnHI-Hind111 fragments: pBd23 contains the 1.1 kb fragment representing the left junction and pBd3 contains the 0.72 kb fragment representing the right junction. (b) The results of the Southern transfer analysis of Balb/c3T3 DNA with the recombinant plasmids identified in (a). Lane 1, pR20; lane 2, pBd23; lane 3, pBd3; lane 4, pR44; lane 5, pR8.

REARRANGEMENTS

IN

SV40

TRANSFOKMEI)

(‘ELLS

4.51

sequences to obtain the host sequences as they existed in the 3T3 genome prior to viral integration. The recombinant plasmids containing the virus-host junctions were used to screen the Balb/c3T3 genomic library constructed in Charon 4A as described in Materials and Methods. In a screen of 128,000 plaques from the phage library, two phage were identified by hybridization with the plasmid containing the left junction, pBd23. The two phage were plaque-purified three times so that all of the phage were positive by hybridization with pBd23 and pR20. There was no detectable hybridization to these phage with pBd3 or pR44, which contain tlanking mouse sequences from the right side. Despite screening 385,000 plaques, no phage were found that hybridized to the plasmid containing the right junction, pBd3. This 2.5 kb EcoRI may not be represented in the library due to size constraints inherent in the construction of a library in phage or to instability of the insert in phage. DNA of the two phage that hybridized to pBd23 was isolated from preparative liquid cultures and since the structures were found to be identical only one, 015. A I. will be discussed. Analysis of the restriction endonuclease cleavage products of DNA from the recombinant phage 015Al indicated there was a 17.kb insert of mouse DNA. For example, digestion of 015Al DNA with EcoRI (Fig. 14(a), lane c) produced two fragments of 9.4 and 7.6 kb, which are not present in the parental Charon 4A vector (lane b). The mapping of restriction enzyme sites in 015Al is summarized in Figure 15(b). A comparison of these sites with the map of the recombinant phage 011-48 presented in Figure 15(a) suggested that the flanking mouse DNA from the left side of the integrated SV40 DNA was located in the 9.4 kb EcoRT fra’gment of 015-Al. Using the pBd23 probe, the host sequences at the left junction were localized to fragments in restriction digests of 015-Al DNA using Southern transfers. For example, Figure 14(b) is an autoradiogram demonstrating the hybridization pattern obtained from the gel shown in Figure 14(a). There was hybridization of pBd23 to the 9.4 kb EcoRI fragment (Fig. 14(b), lane a) where t,here was partial digestion, a 2-8 kb BarnHI fragment (lane c), a 4.2 kb PstI fragment (lane f), and a 2.2 kb TaqI fragment (lane h). The results of the hybridization analysis where homology with pBd23 was localized to a 1.7 kb BanjHI-TuqI fragment are summarized in Figure 15(c). Also shown (Fig. 15(d)) are the results of the localization of the homology by heteroduplex analysis in the electron microscope when 015-Al DNA was denatured and allowed to anneal in the presence of denatured pR20 DNA (data not shown). LA heteroduplex analysis of 015-Al with 01 l-48 demonstrated that the 3T3 sequences in 015-Al were homologous only to the DNA flanking the left side of the SV40 genome in 011-48 and not to the DNA flanking the right side (Fig. 16). This confirms the absence of hybridization of the pBd3 probe to the phage in the plaque hybridization assay as described above. There was no evidence of deletions or substitutions in the homologous region. In the heteroduplex analysis, our size estimates of the double-stranded regions were 22.1 and 10.9 kb. and of the singlestranded regions were 14.7 and 10 kb (Fig. 16(b)). These estimates are consistent with the sizes of the short arm of lambda (10.8 kb), of the long arm of lambda (19.X kb) plus 2.5 kb of the mouse DNA in 01 I-48 and 015Al. and of the

0

b

c

d

e

f

D

h

/

1

k

REARRANGEMENTS 0

b

IN SV40 c

TKANSFOKMEU e

d

f

(‘ELLS 9

453

h

(b 1 FK:. 14. Restriction endonuclease analysis of recombinant phage 015.Al DNA. DNA fragments were separated by electrophoresis in a lyk agarose gel. (a) Ethidium-bromide-stained gel. Lane a, Ic’8a7DNA digested with EcoRI for molecular weight standards: lane b. Charon 4A DNA digest,ed with EcoRI; lane c. 015Al DNA incompletely digested with EcoRI; lane d, 015.Al DNA digested with EcoRI plus BarnHI; lane e, 015.Al DXA digested with BarnHI; lane f, 01%Al DNA digested with BamHI plus HindHI; lane g, 015-Al DSA digested with HindHI; lane h. 015.Al DNS digested P8t1; lane i. 015.Al DNA digested with PstI plus EcoRI: lane j. 01.5.Al DNA digest)ed with TagI; lane k. I”*“’ DSA digested with Hind111 for molecular weight standards. (b) Southern transfer of gel shown in (a) hybridized with radioactively labeled pBd23 D9$. Lane a. 015-Al DNA incompletely digested with EcoRl; lane b, 015-Al DNA digested with EcoRI plus BarnHI; lane c. 015.Al DNA digested with BarnHI; lane d, 015.Al DNA digested with &vnHI plus NindlII: lane e. 015.Al DNA digested with HindIII; lane f. 015-Al DNA digested with P&I; lane g. 01.5.Al DNA dig&ed with PstI plus &oRl; lane h, 015Al DXA digested with TqI.

remaining single-stranded insert DNA of 01 l-48 (10 kb) and 015Al (14.7 kb). These results suggest that the deletion of at least 15 kb of mouse DNA occurred as a result of the integration of the SV40 genome. The Southern transfer analysis showed the flanking host sequences on the left side hybridizing to a 9 kb EcoRI fragment (Fig. 13(b), lane I), which probably corresponds to the 9.4 kb EcoRI fragment contained in 015-Al. Of the 9.4 kb fragment’, 2.5 kb has been retained as flanking host sequences. Therefore, the remaining 6.9 kb, plus the adjacent 7.6 kb EcoR#I fragment present’ in 015-A], plus the 1 kb missing from the 2.5 kb EcoRI

t------75kb-44kb-

(cl

(d)

-

PIG:. 15. (‘omprison of the restriction rndonucleas~ cleavage maps of the recombinant phagr 01 I-48 and 016-Al. (a) Map of integrated S\‘40 DNA (thin line) and flanking mouse DNA (thick lines) in the cell lint, SVBIOO as isolated in t,hr rrcomhinant phage 01 I-48. The sizes of the EeoRl fragments are given. (h) Map of Balb/c-STY DNA containing homology to thr mouse seyurnce~ of the left virus--host junction as rrc*overed from a genomic library in the rrcvmbinant phage 015-41. The sizes of the EcoKl fragmrsnts are given. (e) Region of homology in 015A1 DSA drtected bp Southern transfer analysis with t,he plasmid plZd23, which contains the left virus-host junction of 011-48. (d) Region of homology in Olf,-Al I)NA detected by hrteroduplrx analysis with the plasmid pR20. which contains the 2.5 kh of mouse DNA flanking the irrtrgrnted viral genomr in 01 I-48.

fragment flanking the left side (detected by Southern transfer analysis; Fig. 13(h), lane 3) gives the minimum estimate of the size of the deletion as I.5 kb. (,pj Arrangement

of mouse nuclrotidr

sequences

at th,u sitr

of 8 V40 integratim:

srqzLence arbalpis

The nucleotide sequence of the virus-host, junctions of SVR400 contained in the plasmids pRd23 and pKd3 was det’ermined by the method of Maxam & Gilbert (1980). Figure 17 shows 75 nucleotides of flanking 3T3 DNA and 15 nucleotides of SV40 at each of the junctions in the 5’ to 3’ polarity. At the left junction, SV40 is joined to 3T3 T>XA at nucleot,ide number 1377 and the right junction is at SV40 nucleotide number 3610. The S\‘40 sequences at the virus-host junctions were colinear with the published sequence of SV4O (Fiers et al.. 1978; Reddy et al., 1978; Tooze, 1981). No duplications of either SV40 or 3T3 sequences were found at the junction. There is no unusual sequence organization such as tandem or direct repeat)s, or a simple sequence in the mouse J>NA. As shown in Figure 17, the SV40 DNA t)hat could have participated in basepairing at the site of integration is aligned below the 3T3 JINA. The comparison of the host sequences with t,he deleted SV40 sequences showed no significant, homologies.

REARRANGEMENTS

IN

SV40

TRANSFORMED

455

CELLS

(b)

19.6

IO-9 kb

kb

015

Al

313

Fig. 16. Electron microscopic analysis of recombinant phagr 015-81. (a) Heteroduplex composed of 1 strand of 015.Al and 1 strand of 011-48 DNA. (b) Imerpretative drawing giving length measurements of heteroduplex molecules where the thinnest lines represent Charon 4A DNA. the thick black line represents 8V40 DNA, and the thickest black line represents mouse DNA. Single and double-stranded 1$X174 phage DNA molecules were used as length standards.

4. Discussion We have demonstrated that rearrangements of integrated viral sequences in an SV40 transformed cell line occur after the integration event. The nature of the rearrangements was determined by analysis of a recombinant phage containing the integrated viral sequences as well as the flanking host sequences and was shown to be a result of tandem duplications within the viral genome. One arrangement consisted of 1.6 copies of the SV40 genome and another arrangement contained a tandem duplication of a full-length viral genome resulting in 2.6 copies of SV40 (Fig. 9). The predominant arrangement in the transformed cell line is the result of the tandem duplication of 41% of the SV40 genome from 0.64 to 0.23 (Fig. 9). These tandem duplications involved only the SV40 sequences and not the flanking mouse sequences, and preserved the virus-host junctions at SV40 map positions 0.92 and 0.35. There is no evidence of mutations, deletions or inversions in the viral sequences as determined by restriction endonuclease

l:iti

I’

MOI’S’I’S

ASI)

‘I’

.I.

liI~:I,I.\‘.

.IK

5' Left junction

Right junction

31J TAGAACTTCCTCCTTACACTGTGGTGGGAGGCAGGAAGGAGTGTGGCTTGGGCCTGGAACCCCC

sv40 CTGCACATTAGGACI...

AGGCAACATCCACTGAGGAGCA~rTCTTT(;ATT'TGCACCACCAGGAGCCTCAAATTTTTCAATAAAT'TCACCTGA CTGCACATTACCACi‘... sv40 sv40 1371 SV40 3T3 . ..GCCCAAAATGGATTC TAATGTGTGCTCCTATGTCTCTGGCCGGTGTGGGGGAGGGACTT~GCTGACTTCT~rCCAGGGGAGCTG~~l~CA AAAAAAGATACTGGCTGTTTAAAGGACCAAT . ..GCCCAAAATGGATTC AGTGGTGTATGACTTTTTAAAATGCATGCATGGTGTACAACATTCCTA sv40 sv40 3610

mapping, and the viral sequences present in thr recombinant phagr arc infectious and capable of t,ransformation (Mounts & Peden. unpublished ohservnt,ions). The rearrangements we have characterized in SVB400, which do not involve rrintegration. include partial genome duplications a,t the unique integration site. The dupticatjions c~utd not he g,renerattd 1)-y replication only prior t)o integration since rearrangements o(a(‘ur after tjhe intr:grat,ion ftvfmt itntl continuc~ wit,h passqy of t)he cells. b’e have detjec*ted structural rearrangements of the viral sequences during passagt’ of t)tie parental population derived from a single c-r11clone. and in tivc single (~11 clones derived from the dOt,h passage of the parental poputat ion, Rearrangements of integrated viral sequences havfl been rrport~ed by Basilic0 it nl. (1979) and Kirg rt nl. (1979) in semi-prrmissivck rat cells transformed by potyoma virus and in mouse cr~tts transformed hy SV40 1)~ Hiscott rf (11. (I 980). Bender & tbockman (1981). and Sager rt crl. (1981). The rearrangemrnts caharacterized t-q these workers inc+&d new integrat,ion sites as wctt as rrarrangemrnts involving the flanking mouse sequences. The occurrence of rearrangements during t,hrb propagation of transformrd WIIS may explain the complexity of the hphridiza.tion patterns seen in a Southern tra,nsfrr analysis of t hr integrated viral sequence in 1980: 13otcahan rt ccl.. 1980). \Vhite thr non-permissive cells (Kctnnr 8 Kelly. mechanism for generating the t.andem duplications of t)he S\‘40 srctuencrs that we havr observed is unknown, t,andrm duplications in rnultigene families and satellit’r t)NA arca common in t’trcb mammalian genome. Thr~ heterogenrity of the SV40 sequences that are presentj in t,hr t,ransformed cell population is also evident- in t.hr rrcomhinant, phage drspite rigorous plaque purification (Fig. 11). Tt seems tikrt> that the original recombinant phage that we isolated corresponds to the most prevalent species of integrated viral fINA, i.e. the species cont’aining 10.7 kb of SV40 f>NA arranged as a t,andem duplication of 1% copies of the viral genomt’ containing an internal tandem duplication of 2.2 kt). The presence of multiple phage species. which may be a result of intramolecular homologous recombination or unequal crossing over. is not uncommon with lambda genomes containing duptic&ions. For c~xarnplr, Arnheirn & Kur~hn (1979) rrpor%rtt that rearrangements of cloned rihosomal f)NA containing tandemly arranged repeat’s were mimicking the het,rrogeneity in ribosomal DNA that they detected in wild

I~EARKAN(:EMENTS

1X SV40

TRASSFOIIMET)

(‘ELLS

357

and inbred mouse strains. These investigations of the behavior of the integrated may not only provide information on viral SV40 genome in SVB400 t,ransformation but also on the organization and evolution of the mammalian host’s genome. The functional significance of the tandem duplication in SV K400 of 41 o/; of the SV40 genome from map co-ordinates 0.64 to 0.23 is important when one considers that, the dupliaatIion lies within the gene for T antigen. which is responsible for the initiation and maintenance of the transformed state (for a review, see Topp rt nl.. 1981). I>uplications of part of the early region of SV40 smaller than reported here have been found in transformed rat cells by May ut nl. (1981~1; 0.57 kb), and in mouscl ~11s by Sager et al. (1981; 1.75 kb). In an investigation of the functional significance of the partial genome duplication. we have detected immunoextracts of SVB400, all of precipitable T antigens in [ 35S]methionine-labrled which are larger t#han authentic T antigen (unpublished observations). Such super T antigens have been described in SV40 transformed cells and found to contain multiple copies of some tryptic peptides (Smith et trl., 1979: Kress et nl.. 1979). The presf’nce of these T antigens is related to the occurrence of duplications of the viral getiome (May et al., 198lb: Lovett et d.. 19X2). \Ve are at present analyzing t.he ‘I‘ antigens in the single cell clones to correlate the grnotnic duplications with the T antigens produced. \;C’e are also investigat’ing the phenotJ@c consequences of t.hc super T ant,igens by examining the growth properties of the single cell clones and the, nature of T antigen in t’he transformed cell. One could speculate that since the cc~lls containing the large partial-genome duplication predominat’e in the population. they have a selective advantage. and hrncr super T ant.igens. produced by tandem duplications within the viral genome, confer the selecative advantage by perhaps accelerating the cell’s generat’ion time. L\‘e have also demonstrated that a rearrangement, probably a deletion of at least 15 kb. has occurred at the site of integration of SV40 in SVB400. This is a minimum estimate for the size of the deletion since there may be additional int.ervrning EwRT fragments between the 7% kb fragment obtained in the rcc*omhinant, phage 015Al and the 2.5 kb fragment c~ontaining the right jun&ion. \lre cannot eliminate the possibility that the recombination event involved not a deletion but a more complicatfbd inversion or translocation. However, we assume that S\‘40 sequences are lost as a result) of t)tie recombination event, and in support of this assumption there was no evidence for SV40 I)SA in SVB400 other than at the single integration site. When grnomic I)h’A from SVB400 was analyxed 1)~ hybridization with an SV40 probe, either in Southern transfers or in a s(~re~~nof the lambda library. no additional S\‘40 sequences were detected. We caannot clliminatr the possibility that the deletion of host I)?;.-\ occurred after the integration event. However, there has been no rvidencae of rearrangement in the flanking mouse sequences during propagation of thcb t,ransforrned cells that have hertl analyzed f’rom passage 4 to passage 60. Jn addition, there is no evidence for any change in the mouse sequences at the left virus-host junction when compared to t)htJ parental 3T3 sequences by fine-structure mapping or electron microscopy. The rearrangement of host DSA may be a general consequence of t’he integration of SV40. since there is evidence consistent with the loss of chromosomal DKA at

45x

I’. Mol’s’I‘s

.\SI)

‘I’. .I. Kb:I‘I,\‘.

*III

the de of’ viral integration in tra,nsformed rat (sell lines (Botchan it nl.. 1980: Stringer. 1982). An examination of the nuclrotide sf3penc.t’ of the virus-host junctions of’ SVR400 revealed no unusual feature of sequence organization to suggest an int,egration mechanism. For example. there were no direct repeats of host sequences at the virus-host junct,ions as have been found for retroviral integration (for a review, see Varmus. 1982). The viral DSA at t)he junctions was not A +Trich as found in some virus-host junctions of SV4O transformed rat cells by Stringer (1981) and of defective SV40 molecules by Gutai & sathans (1978). The base composition of the 15 SV40 nucleotides at the virus-host junct,ions in SVK400 is 460/, G +CJ but 73?& G +C for the 15 3T3 nucleotidex at the left junction and 40’!& G+C: for the 15 3T3 nucleotides at the right junction (Fig. 17). LVit,h the exception of the mouse sequences at t)he left junction, the base composition of the junctions conforms to the overall G +C: content of the SV4O genome (40.7O/,; Tooze. 1981) and mammalian genome (400;: Lewin. 1982). We did not detect the “patchy” homology seen at some recombinant junctions of SV40 and the monkey genome in defectjive HV40 genomes (Gutai & Nathans. 1978) and at’ adenovirus-host> junctions (Deuring it al.. 1981). However, in a computer analysis for nucleotidc sequence homologies (Queen & Kern, 1980), several regions of homology between the flanking 3T3 sequences and the sequences of the SV40 genomr not at the integrat’ion site were detected. The significance of these homologies is unknown. To invest’igate further the role of base-pairing in the integrative recombination of SV40. we are at present sequencing the region of cellular DSA molecularly cloned in 015Al as it existed prior to viral int,egration. In the sequence analysis of rat D?L’A at the sit.e of SV40 integration for one virus-host junction, Stringer (1982) has found five base-pairs of homology where the two genomes were joined. It, is interesting that this same sequence (T-G-T-C-T) was found in mouse DNA at four nucleotides from the right virus-host junction of SVR400. To determine if there is a requirement’ for homology at the site of recombination between virus and host, it’ will be necessary to examine the nucleotide sequence of host 1)NA at more sites of SV40 integration. The nucleotide sequence analysis of integration sites will also determine if arrangement*s of the host DNA are limited to the deletion of DNA. in the construction of the phagr libraries, for We thank Keith Peden for collaboration helpful discussions, and for critical comments on the manuscript. This research was supported by grant 5 PO (:A16519 from the National Cancer Institute. I’. Xl. was supported by Public Health Service training grant 2 T32 CA09139.

REFERENCES Iv. & Keuhn, M. (1979). J. Mol. Biol. 134, 7344765. Rasilico. C:., Gattoni. S., Zouzias, D. & Della Valle, G. (1979). Cell, 17, 645-659. Bender, M. A. & Brockman, W. W. (1981). J. Viral. 38, 872-879.

Arnheim,

Benton, W. D. & Davis. R. W. (1977). Science, 196, 180-182. Birg, F., Dulbecco. R.. Fried, M. & Kamen, R. (1979). J. Viral. 29, 633-648. Birnboim, H. C. & Daly. J. (1979). LVucl. Acids Res. 7. 1513-1529.

KEARRANGEMESTS

IN SV40

TK.L\NSFO1~ME1)

(‘ELLS

459

Blattnrr. F.. Williams. B. G.. Blechl. R. E., Denniston-Thompson. K.. Faber. H. E.. Furlong, L.-A.. Grunwald, D. J., Kiefer, D. O., Moore, D. D., Schumm. ,J. IV.. Sheldon, E. L. & Smithies, 0. (1977). Science, 196. 161-169. Blin. S.. Gabain. A. V. & Bujard, H. (1975). FEBS Letters. 53. 84-86. Bolivar. F. (1978). Gene, 4, 121-136. Bolivar. F.. Rodriguez, R. L., (Greene, P. ,J., Betlach. $1. C’.. Hryneker. H. L.. Bayer. H. VI’.. (Irosa. J. H. & Falkow. S. (1977). Gene, 2. 95-113. Botchan. M.. Topp, W. & Sambrook. J. (1976). (‘ell. 9. d69-28i. Botchan. M.. Stringer. ,J.. Mitrhison. T. & Sambrook. .I. (1980). (‘~11,20, 143Gl.52. C‘amJio. M. S.. (‘ameron. 1. R. 8r Rogers, M. E. (1978). c’c’ll. 15. 1411.-1426. Cheplinsky. A. R.. Seiff, R. 8r Mart)in. K. Q. (1980). J. l~irol. 35. 184 193. Danna. K. .J. & Nathans. I). (1971). Proc. ,Vat. Acad. Sci.. lT.S.A. 68, 2913-2917. Davis. R W.. Simon, M. & Davidson, 5. (1971). In &1rthods in I?;‘nzymology (Grossman. 1,. & Moldavr. K., eds). vol. 21. 413-428, Academic3 Press. Sew York. Ijenhardt. 1). T. (1966). Riochrm. Riophys. Res. (‘onlmun 23. 641l646. Ijruring. R.. \l’interhoff. 1’.. Taminoi. F.. Stabel. S. & 1)orflrr. iv. (1981). .VCI~UW (London). 293, 81-84. I)ugaiczyk. A.. Bayer, H. 11’. & (Goodman. H. M. (1975). .I. Mol. Riol. 96. 1’7-194. Dunn A. 8 Sambrook. ,J. (1980). In N&ods in Enzyrn&ggy ((Grossman. 1,. & Moldavr. K.. ~1s). vol. 63. pp. 468-478. Academic Press. New \r-ork. Encluist. L. Br Sternberg, IT. (1979). In Methods in E’nzymology ((Grossman. 1,. Rr Moldavr. K.. rds). vol. 68, pp. 281-298, Academic Press. !Xew York. Firrs. W.. t’ontreras. R.. Hargrman. (1.. Rogiers. ;\.. van de Voordr. .J., van Heuverswyn. 11.. van Htrrrweghr. .J.. Volckarrt. (:. RTYsebarrt. M. (1978). Snturr (London). 273. I l:J~lPO. (Goodman. H. M. & MacDonald, R. ?J. (1979). In Method:: in JCnzymology ((Grossman. I,. & .lloldave. K.. cds), vol. 6X. pp. 75-89. Academic Press, Sew \r-ork. (:runst~rin, Yl. X: Hogness. 1). S. (1!)75). hoc. Xat. Acod. Sci., I-.S’..A. 73. 1102p1 106. (irrtai. M. \T. & Nathans. 1). (1978). .J. Xol. Hiol. 126. 27528X. Hirt. 13. (I 967). .J. Mol. Hiol. 26. 365 369. Hiscot~t. ,J . Murphy, I). & Defendi. 1’. (1980). (‘rll, 22. :5:i5-543. Hahn. 11. (1979). In Methods in l+ymology (Grossman. I,. & Moldave. K.. eds). vol. 68. JIJI. 299309. Academic Press. Xew York. .Jrffreys. .A. .J. Cy;Flavell, R. A. (1977). (,‘elZ, 12. 429~4X). Ket’nrr. t:. & Krlly, T. ,J. ,Jr (1976). hoc. IV&. Acad. Sci , I:.S’.A, 73, 1102-I 106. Krtner, (:. & Kelly. T. -1. ,Jr (1980). .J. Mol. Hiol. 144. 16:l 182. Krrss. 11.. May. E.. (:assingena. I~. 62.May. I’. (1979). .J. i’irol. 31, 472-483. Lrdrrberg. E. J1. & (‘ohen. S. iY. (19i4). J. Brrctrriol. 119. 1072~1054. Twwin. Il. (1980). Cenr Il=xpression. vol. 2, *John Wiley and Sons. Xea York. 1,ovett. 11.. t’lavton. C. E., Murphy. 11.. R,igby. I’. \V. ,J.. Smith. A. E. & Chaudry, F. (l!W). .J. I’irol. 44. 963&97X Mandel. M. Pr Higa. A. (1970). J. Mol. Kiol. 53. 159-162. Maniatis. T., CJeffrey, A. & Kleid. D. G. (1975). I’roc. Abut. Acad. Sci., I’.S.A. 72, 1184-1188. Maniat’is. T., Hardison. It. t:.. Lacy. E.. Latter. .J.. O’t’onnrll. C‘.. Quon. I).. Sim. (:. K. & 1Sf’stradiatis. A. (1978). (‘~11. 15. 6H7~701. Maxant. A. 11. 8~ (Gilbert, W. (1980). In :l4ethods in E7/zyn&ogy (tirossman, I,. & Moldavre. K ~1s). vol. 65, pp 499955!#. Academic Press, ?irw York. May. E.. .Jelt,sch. *J.-M. K: (:annon. F. (19Xln). SW/. .4cid,s Re,s. 9, 41 1l-4126. May. E.. Krrss. M.. Daya-C:rosjran, L.. Monier. R. & May. P. (19810). J. J’irol. 37. p4~-;15,. Newell. Ii.. Shah, K. V. & Kelly. T. ,J. .Jr (1979). ,J. 17iro/. 30. 6%-fj:jA. l’etlcn. K. W. C’.. Mounts. I’. & Hayward. (:. S. (198%). C’rll. 31. 7ll~0. QUPPII. (‘. I,. & Kom. L. .J. (1980). In Methods in Enzymology ((:rossman. I,. & Jloldave. K.. ~1s). vol. 65,. JIJI. 595609. A(.ademic Press, New York. J%rtltly. V. 11.. Thimmappaya. Ii.. I)har, R.. Subramanian. K. N., Zain. B. S.. Pan, .J.. (:hosh. I’. K.. (‘elma, 11. 1,. I!+\+‘eissmari. S. M. (1978). Science. 299. 494-502, Rigby. 1’. \V. .I.. Ijirckrnann. M.. Rhodes. C‘. & Berg. 1’. (l!J77). .J. dJol. Hiol. 113. z:j7-2;il.