Recent gene multiplication and evolution of a juvenile hormone esterase-related gene in a lepidopteran pest

Gene Reports 4 (2016) 139–152

Contents lists available at ScienceDirect

Gene Reports journal homepage: www.elsevier.com/locate/genrep

Recent gene multiplication and evolution of a juvenile hormone esterase-related gene in a lepidopteran pest Dimitrios Kontogiannatos a, Luc Swevers b,1, Anna Kourti a,⁎ a

Department of Biotechnology, School of Food, Biotechnology and Development, Agricultural University of Athens, Iera Odos 75, 11855 Athens, Greece Insect Molecular Genetics and Biotechnology Group, Institute of Biosciences & Applications, National Centre for Scientific Research “Demokritos”, Patriarchou Grigoriou & Neapoleos 27, 15310 Agia Paraskevi, Attiki, Greece b

a r t i c l e

i n f o

Article history: Received 21 February 2016 Received in revised form 8 April 2016 Accepted 22 April 2016 Available online 10 May 2016 Keywords: Juvenile hormone esterase Carboxylesterase Juvenile hormone Sesamia nonagrioides

a b s t r a c t Juvenile hormone esterase (JHE) is a carboxylesterase that plays critical roles in regulating larval to adult transition by hydrolyzing the key developmental and reproductive hormone, juvenile hormone (JH). In the current work, we have cloned and sequenced a superfamily of juvenile hormone esterase related genes in Sesamia nonagrioides (JHERs). These seemed to have been recently multiplied from a common ancestral gene and consequently were inherited in the resulting populations as intron-less and intron-rich genes (loci). We sequenced three JHER genes (one intron-rich and two intron-less) and four cDNAs encoding for juvenile hormone esterase related sequences. Three cDNAs presented nucleotide deletions similar to alternative splicing events when compared with the introns of the intron-rich gene. The exons of the intron-rich gene were N98% identical with one of the intron-less gene and the homologous sequences of all the four cDNAs. Moreover, the second intron-less gene seemed to be almost identical with one of the four cDNAs. The fourth cDNA contained an extensive (in-frame) deletion inside its ORF. This mRNA seems to be encoded by another gene which's deletion was generated by homologous recombination. Interestingly, our data revealed differential expression patterns for the four cDNAs. This study provides an initial assessment of the diversity of JHER genes in a population of Sesamia and presents this species as an attractive model to study the diversification of JHE-like esterase genes and their functional consequences. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Juvenile hormone (JH) is a key endocrine regulator for the control of growth, development, metamorphosis, diapause and reproduction in insects (Riddiford et al., 2003). JH belongs to a group of structurally related sesquiterpenes that regulate the transition of insects through their various developmental stages and determine their metamorphic transitions. JHs directly transcriptionally induce several genes, (e.g. juvenile hormone esterase, calmodulin and vitellogenin), while via indirect regulation, JHs deactivate genes that have been induced by 20hydroxyecdysone (20E) (Gullan and Cranston, 2010). Important is also their role in the reproductive processes of insects (Hartfelder, 2000). The regulation of JH titers is thus critical in the entire life of the insect. One key event is the clearing of JH that generally precedes the molt from the last larval stage to the pupal stage of holometabolous insects (Campbell et al., 2001). The very low JH titer at this time is Abbreviations: JHE, juvenile hormone esterase; JHER, juvenile hormone esterase related; JH, juvenile hormone; 20E, 20-hydroxyecdysone; JHEHs, JH epoxide hydrolases; OTFP, 3-octylthio-1,1,1- trifluropropan-2-one. ⁎ Corresponding author. E-mail addresses: [email protected] (D. Kontogiannatos), [email protected] (L. Swevers), [email protected] (A. Kourti). 1 Tel.: +30 2 106 503 681.

http://dx.doi.org/10.1016/j.genrep.2016.04.010 2452-0144/© 2016 Elsevier Inc. All rights reserved.

generally achieved by the combined effect of reduced JH synthesis and the action of JH degrading enzymes (Roe and Benkatesh, 1990). Degradation of JHs is an important mechanism by which insects control the JH titer, while JH esterases (JHEs) and JH epoxide hydrolases (JHEHs) constitute regulating enzymes for this process (Roe and Benkatesh, 1990; Hammock, 1985; Goodman and Granger, 2005). JHEs belong to the α/β hydrolase fold superfamily of proteins which degrade JHs with high selectivity even if they are found in very low concentrations. They contain a well conserved active center with the characteristic GxSxG motif (Wogulis et al., 2006). At the primary amino acid sequence level JHEs possess seven highly conserved sequence motifs (RF, DQ, GQSAG, E, GxxHxxD, R/Kx(6)R/KxxxR, and T) (Kamita and Hammock, 2010; Ward et al., 1992; Feng et al., 1999; Kamita et al., 2011; Munyiri and Ishikawa, 2007). Six major forms of JH (JH 0, JH I, JH II, JH III, 4-methyl JH I and JH III bisepoxide) have been isolated from insects; all possess an α,β-unsaturated methyl ester at one end of the molecule and an epoxide at the other (Kamita et al., 2011). But these JH forms do not constitute all possible types of JH hormones that could be found in insects. Likewise JHE is not always the major JH-degrading enzyme. In Trichoplusia ni researchers revealed evidence for the existence of a JH-like compound that is catabolized by juvenile hormone esterase related (JHER) enzyme, which has a cysteine residue immediately adjacent to the catalytic

140

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

serine, in contrast to most other described esterases, including JHE, which have alanine at this position (Jones et al., 1994). Moreover in Sesamia nonagrioides, it was found that the JH titer remained high in the presence of high JHE activity in diapausing larvae, indicating that JHE was not a major factor involved in the regulation of JH at this developmental stage (Schafellner et al., 2008). The authors (Schafellner et al., 2008) also discovered that the JHE-specific inhibitor 3-octylthio-1,1,1trifluropropan-2-one (OTFP) did not provoke a developmental response in S. nonagrioides as observed in the sphingid Manduca sexta and some other insects, where JHE is required for metamorphosis and the enzyme's activities peak after the larvae reach a critical body mass for pupation (Schafellner et al., 2008). It was concluded that in S. nonagrioides the JH titer is regulated by several mechanisms, of which hydrolysis by the hemolymph JHE does not seem to be the major one (Schafellner et al., 2008). Similarly, Pérez-Hedo et al. (2010) discovered that in S. nonagrioides the molting process can occur in the absence of the brain. It was consequently concluded that an unknown head factor outside of the brain is needed for the pupal– adult molt (Pérez-Hedo et al., 2010). Orthologs and paralogs are two fundamentally different types of homologous genes that evolved, respectively, by vertical descent from a single ancestral gene and by duplication (Koonin, 2005; Bratlie et al., 2010). For practical reasons, paralogs are defined as protein-coding sequences that have at least 30% sequence identity over more than 60% of their lengths (Bratlie et al., 2010; Mira et al., 2006; Blattner et al., 1997). According to Ohno (1970), there are three possible outcomes for a duplication event in which the gene duplicate is kept: neofunctionalization, sub-functionalization and conservation of function (Bratlie et al., 2010; Hahn, 2009). If there is no biological advantage in keeping the duplicated gene, then the gene may become inactivated by mutations (non-functionalization), reduced to a pseudogene and finally removed from the genome by deletion (Bratlie et al., 2010). Gene duplication can result from unequal crossing-over, retrotransposition, or chromosomal (or genome) duplication, the outcomes of which are quite different (Zhang, 2003). Unequal crossing-over usually generates tandem gene duplication (the duplicated genes are linked in the chromosome) (Zhang, 2003). In contrast retro-transposition occurs when a messenger RNA (mRNA) is retro-transcribed to complementary DNA (cDNA) and then inserted into the genome, while chromosomal or genome duplication occurs by a lack of disjunction among daughter chromosomes after DNA replication (Zhang, 2003). JHE genes are usually present as single copy genes in the genomes of insects belonging to different orders: for lepidopterans, this is the case for Heliothis virescens (Harshman et al., 1994), Choristoneura fumiferana (Feng et al., 1999), M. sexta (Hinton and Hammock, 2001) and Bombyx mori (Hirai et al., 2002). In T. ni the natural JHE and a JHER gene are physically juxtaposed suggesting that a gene duplication event has occurred (Jones et al., 1994). At that time, it represented the first reported evidence of a duplication event for a gene encoding a JH-inducible larval protein. The only other documented case of a duplication of a JH inducible gene was vitellogenin (Pearce and Yamamoto, 1993), but in that case both genes were still inducible by JH, while in the T. ni's case only JHE, and not JHER, was JH-inducible (Jones et al., 1994). Likewise, in Drosophila, three candidates for additional JHE esterases were reported, of which one candidate gene represented an adjacent duplication of the known, characterized JHE gene (Crone et al., 2007). However, functional analysis established that none of the three candidates could metabolize different JH substrates with sufficient sensitivity to suggest an important role in the degradation of JH during development (Crone et al., 2007). Also in the silkworm, B. mori, several additional genes were identified that encode members of the carboxyl/ cholinesterase (CCE) family and that contain the GQSAG motif that is characteristic of JHE (Tsubota et al., 2010). Functional analysis however established also in this case that Bombyx JHE represents the canonical JH degrading enzyme and that the newly identified CCE enzymes with GQSAG motif may have other functions in animals, for instance in

digestion or xenobiotic detoxification, although a role in the metabolism of JH-related compounds for some of them cannot be excluded (Tsubota et al., 2010). These studies illustrate that several genes encoding esterases that have structural similarities with JHE can exist in insect genomes, while their exact role in JH metabolism or development remains to be established. In a previous study in order to identify and clone a JHE gene in S. nonagrioides, we performed RT-PCR using degenerate primers based on homologous sequences of JHE genes of other insect orders (Kontogiannatos et al., 2011). After 3′- and 5′-RACE PCR, we cloned the full length cDNA sequence of 1838 bp which seemed to be homologous to the sequences of the JHE genes of the other insect orders. Predicted amino acid sequence data however showed that this esterase had a unique GQSCG catalytic motif surrounding the catalytic serine of the predicted protein, which is identical to the motif found in the JHER gene of T. ni, but different from the characteristic QQSAG motif of canonical JHEs. Moreover semiquantitative RT-PCR data showed a unique gene expression pattern: the mRNA levels were not responsive to methoprene but were positively regulated by ecdysteroid analogs as well as by the xenobiotic bisphenol A (BPA). For all the reasons outlined above, we therefore characterized this cDNA as JHE related (JHER) rather than as JHE (Kontogiannatos et al., 2011). In a following paper we functionally characterized SnJHER by RNAi (Kontogiannatos et al., 2013): our data showed that SnJHER deficiency leads to larval–larval, larval–pupal and pupal–adult transition blockage, which indicates a function in the regulation of development, possibly through the metabolism of JH-like substances (Kontogiannatos et al., 2013). In the current work, the existence of different JHER genes that encode multiple mRNAs that may encode for additional JHER enzyme isoforms was investigated. Furthermore, we performed semi-quantitative PCR-analysis to evaluate the expression of different isoforms in order to clarify their potential biological role. 2. Methods 2.1. Insect rearing and staging of larvae S. nonagrioides insects were maintained at 25 °C, 55 ± 5% relative humidity on an artificial diet (Kontogiannatos et al., 2011, 2013). Larvae reared under applied LD conditions (16:8, light:dark) completed their larval stage in 6 instars. The age of analyzed larvae within each instar was measured in days after the preceding ecdysis, using physiological markers such as body mass and head capsule width. Larvae were checked daily for molting. At the 9th day of the last (6th) larval instar (L6d9), larvae transformed into prepupae and entered metamorphosis. 2.2. RNA isolation and cDNA synthesis Total RNA was isolated from larvae and insect cells using TRIzol® reagent (Sigma) according to the supplier's instructions and stored at −80 °C. After treatment with RNase-free DNAse I (Promega), 1.5 μg of RNA was used as template for the first strand cDNA synthesis using oligo-dT primer and Superscript™ II RNase H-Reverse Transcriptase (Invitrogen). In all experiments the RNA was extracted from the whole body tissue of the analyzed animals. 2.3. PCR and semiquantitative RT-PCR For semiquantitative RT-PCR analyses primers were selected which, because of the high homology of the 4 SnJHER cDNAs, could distinguish 2 or 3 isoforms each time. JHE3RTf/JHE3RTr primer set (Table 1) was used to amplify SnJHER, SnJHER3 and SnJHER4 cDNAs after 33 cycles (Fig. 2). The JHEMf/JHEMRTr primer pair was used to amplify both SnJHER and SnJHER3 cDNAs after 36 cycles of polymerization, while JHEWhof/JHE5RTr was used for SnJHER and SnJHER2 (39 cycles) (Table 1 and Fig. 2). As control, a part of the coding region of

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152 Table 1 Primers used in this study. Primer 5′ → 3′ used as

Name

Sequence

Tm °C

Forward Reverse Reverse Forward Reverse Reverse Forward Reverse Forward Reverse

JHEWhof JHE5RTr JHE5r JHE3RTf JHE3RTr JHEMr JHEMf JHEMRTr TubF TubR Oligodt

AACATGTTACTGTTGCGGAAGC GCTGACTAAATATTCGGGTCCA GTACCCATTTGAGCAAAGTGATG AGGGACGACCTCATGAAATACTG GACACTAGGATGACGCACTCTTG CTGCATCGCATAAAGTTGAC CAACGTGTTCGGATATCTCTC TTTATGGTCACAAATTGGGTGG GAGCAGTTCACCGCTATGTTC GGTGTGAGTGCTTTAGTTGTCC GTCGACCTCGAG(T17)

58 58 60 59 57 58 58 61 59 58

S. nonagrioides b-tubulin gene (GenBank: DQ147771) was amplified by TubF/TubR (30 cycles; Table 1). The RT-PCR products were separated on 1–1.5% agarose gels. 2.4. DNA isolation and DNA blot hybridization Genomic DNA was prepared from larvae according to the protocol described previously (Kourti, 2006). Fifteen larvae were used for genomic DNA extraction and the Southern blot therefore reflects the detection of JHER in genomic DNA of different individuals. Fifteen microgram of DNA samples were digested with BglII, EcoRI, EcoRV, NcoI and NdeI (New England Biolabs) according to the manufacturer's instructions, analyzed on 0.7% agarose gels and blotted onto Hybond N + nylon membrane (Amersham). The blot was hybridized with a digoxigenin-UTP Chemiluminescent Probe using the DIG High Prime labeling system (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions. A 1725 bp fragment of SnJHER cloned into pGEM®-T Easy Vector

141

(Promega) was used as probe. Hybridization was performed at 60 °C in 1% w/v BSA, 1 mM EDTA, 0.5 M sodium phosphate buffer pH 7.2 and 7% w/v SDS. Membranes were washed twice at 60 °C with 5% w/v SDS, 40 mM sodium phosphate buffer and 1 mM EDTA, and three times at 50 °C with 1% w/v SDS, 40 mM sodium phosphate buffer and 1 mM EDTA. The detection procedure was performed using DIG High Prime DNA Labeling and Detection Starter Kit II (Roche), according to the manufacturer's instructions. 2.5. Isolation and sequencing of SnJHER cDNAs and SnJHEgR genes RT-PCR reactions of cDNA prepared from an RNA pool isolated from whole bodies of the 2nd day 5th instar larvae were performed with the JHEWhof/JHE3RTr primer pair (Table 1). RNA was extracted from 5 different individuals and the RT-PCR therefore reflects the presence of cDNAs in different individuals. Four PCR products of 1725 bp, 1411 bp, 1556 bp and 1119 bp were gel extracted using a commercial kit (NucleoSpin® Extract II, Macherey-Nagel), T–A cloned into the pGEMT Easy vector (Promega) and sequenced using the T7 and SP6 promoters. The product of 1725 bp was identical with the previously sequenced SnJHER cDNA (GenBank: EU178813). The products of 1556 bp, 1411 bp, and 1119 bp corresponded to three new JHER mRNA isoforms designated as SnJHER2, SnJHER3 and SnJHER4 (Genbank accession numbers: HQ588155, HQ588156 and HQ588157, respectively). In order to isolate SnJHEgR genes, three primer sets were designed according to the SnJHER cDNA sequence. The first primer pair, JHEWhof/JHE5r (Table 1), was designed at the 5′ end of the SnJHER cDNAs, the second one, JHEMf/JHEMr (Table 1) in the middle region, and the third one, JHE3RTf/JHE3RTr (Table 1) at the 3′ end. PCR reactions were performed using DNA from pooled 4th instar larvae (total number of 5). PCR using JHEWhof/JHE5r resulted in 3 products of 1990 bp, 596 bp and 282 bp, using JHEMf/JHEMr resulted in 1 product of 1019 bp and using JHE3RTf/JHE3RTr resulted in 2 products of

Fig. 1. Cloning and sequence analysis of SnJHER cDNA isoforms. (A) Gel electrophoresis of PCR products obtained with JHEWhof and JHE3RTr primers in a pooled cDNA sample from the 2nd day 5th instar larvae. SnJHER (major) corresponds to the first isolated SnJHER cDNA (major isoform, GenBank EU178813, (Kontogiannatos et al., 2011)). Numbers 2–4 correspond to SnJHER2–4 cDNA isoforms. (B) Schematic representation of SnJHER mRNA isoforms. Different shadings represent homologous nucleotide sequences, while numbers indicate their positions in the cDNA. (C) Schematic representation of SnJHER predicted protein isoforms. The consensus catalytic motifs and their positions are indicated (RF, DA, GxSxG, E, xxxH/Rxxx). Different shadings and shapes indicate the homologous amino acid parts.

142

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

1095 bp and 256 bp. The PCR products were gel extracted and T–A cloned into the pGEM-T Easy vector and sequenced using T7 and SP6 primers. Resulting sequences were in silico assembled in three genes designated as SnJHEgR (GenBank HQ588158), SnJHEgR1 and SnJHEgR3 (S1 Text). To confirm the correct assembly of the three genes, PCR was performed on Sesamia genomic DNA using the JHEWhof/JHE3RTr primer set. Three DNA products of the expected lengths, 3958 bp, 1725 bp and 1411 bp, were amplified corresponding to SnJHEgR, SnJHEgR1 and SnJHEgR3 respectively (data not shown). 2.6. Hormone treatments The fifth-instar day-3 larvae (L5d3) which were maintained under LD 16:8 h conditions were topically treated with 25 μg of the JH analog methoprene (Sigma-Aldrich) diluted in dimethylsulfoxide (DMSO)

(Sigma-Aldrich), while the sixth-instar day-2 larvae (L6d2) were topically treated with 10 μg of the ecdysone agonist RH-5992 (Rohm & Haas) diluted in DMSO. Controls were topically treated with DMSO only.

2.7. Phylogenetic tree construction and analysis Phylogenetic analysis was performed as described by Kontogiannatos et al. (2011). Homology searches were performed by BLAST and putative orthologs were aligned using CLUSTALX (http://www.clustal.org). A phylogenetic tree was constructed using the neighbor-joining method and distances were estimated by the Jones–Taylor–Thornton (JTT) amino acid matrix provided by MEGA 4.0 phylogenetics software. Accuracy of tree topology was assessed by bootstrap analysis with 500 resampling replicates.

Fig. 2. Multiple sequence alignment of SnJHER cDNAs. Arrows indicate the annealing positions of several primers used in this study. Sequences in different shadings correspond to the different regions in the mRNA isoforms that are indicated in Fig. 1B. Start and stop codons are indicated in black and white boxes.

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

3. Results 3.1. Cloning and sequence analysis of SnJHER cDNA isoforms To investigate whether SnJHER is unique in S. nonagrioides, we performed RT-PCR reactions using cDNA prepared from whole bodies of the 2nd day 5th instar larvae with primers specific for the 5′- and 3′ends of the SnJHER cDNA sequence (JHEWhof: position 58–79 of the SnJHER sequence, 35 bp downstream of the first ATG; JHE3RTr: position 1760–1782 of the SnJHER sequence, 17 bp downstream of the stop codon TTA; Table 1 and Fig. 2). These reactions resulted in 4 PCR products of 1725 bp, 1411 bp, 1556 bp and 1119 bp respectively (Fig. 1A). The product of 1725 bp was sequenced and found to be identical with the first isolated SnJHER cDNA sequence (major isoform, GenBank EU178813, (Kontogiannatos et al., 2011)), while the products of 1556 bp, 1411 bp, and 1119 bp corresponded to 3 new JHERs named SnJHER2 (GenBank HQ588155), SnJHER3 (GenBank HQ588156) and SnJHER4 (GenBank HQ588157), respectively. These 3 new JHER cDNAs presented nucleotide similarities of N98% with the SnJHER cDNA (Fig. 2). The main difference in the nucleotide sequences of these 3 new JHER cDNAs was the presence of large deletions (Figs. 1B and 2). For SnJHER2, a 169 bp fragment was deleted that corresponded to nucleotide positions 1585–1754 of the SnJHER sequence (Figs. 1B and 2). Similarly, SnJHER3 and SnJHER4 corresponded to deletions of 314 and 605 bp, respectively (248–562 and 159–764, respectively, of the SnJHER sequence; Figs. 1B and 2). The new 3 cDNAs' predicted amino acid sequences lacked functional motifs which are present in most esterases, proteases and lipases (Figs. 1C and 3). While SnJHER (major isoform) and SnJHER2 contained identical RF, DA, Ec and GQSCG motifs, SnJHER2 also differed by the GGARVEG instead of the GGAHVED motif that was present in SnJHER (Figs. 1C and 3). SnJHER3 lacked the RF motif while SnJHER4 lacked the RF, DA and the catalytic GQSCG motif (Figs. 1C

143

and 3). Moreover SnJHER3 and SnJHER4 were characterized by a different N-terminal sequence (Figs. 1C and 3). SnJHER2 also presented a modified C-terminus motif (RSSKSASS; Figs. 1C and 3). 3.2. Cloning and sequence analysis of SnJHEgR genomic DNA In order to assess whether these three new SnJHER cDNAs were products of multiple alternative splicing events from a single gene or products of different genes, we performed Southern blot hybridization analysis using as a probe the JHEWhof/JHE3RTr part of the SnJHER cDNA (Fig. 4A). Based on the results that we gathered by this analysis, we would recommend that multiple JHEgR genes are present in the genomes of different S. nonagrioides larvae (Fig. 4B). PCR and sequencing data from DNA isolated from a pool of the 2nd day 5th instar larvae, revealed the presence of at least three SnJHER genes in the combined genomes of S. nonagrioides larvae (Figs. 5–8). These genes were named SnJHEgR (GenBank HQ588158), SnJHEgR1 and SnJHEgR3 (Figs. 5–8; note that cDNA sequences are denoted as JHER and genome sequences as JHEgR). Of the three genes SnJHEgR, SnJHEgR1 and SnJHEgR3, only SnJHEgR contains introns. When comparing the structure of SnJHEgR gene with the cDNA SnJHER, four different introns with canonical splice sites that conform to the “GT/AG rule” (referring to the dinucleotides at the 5′- and 3′-ends of the introns) are found: between nucleotides 921 and 1420, 1733 and 1899, 2921 and 3025, and 3193 and 3930 (Figs. 5 and 8). However, the sequence between positions 17 and 755 in the SnJHEgR gene sequence which is lacking in the SnJHER cDNA sequence (Figs. 5 and 8), cannot be explained by a splicing event since no canonical splice junctions are observed. It is therefore proposed that SnJHERs are not derived from alternative splicing events of SnJHEgR but from a highly similar gene with a deletion at the 5′-end (Fig. 9). It is noted that the sequence at the 5′-end of the SnJHEgR gene that is deleted in the SnJHER cDNAs and the SnJHEgR1 and SnJHEgR3 genes contains the

Fig. 3. Multiple sequence alignment of different predicted SnJHER protein isoforms. Sequences in different shadings correspond to the different regions in the mRNA isoforms that are indicated in Fig. 1C. Note that the N-terminal sequences of SnJHER3 and SnJHER4 are derived from the same nucleotide sequence as SnJHER and SnJHER2 but are predicted to be translated in a different frame to allow continuity with more C-terminal sequences.

144

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

Fig. 4. SnJHER sequences map to multiple loci in the S. nonagrioides genome. (A) Restriction map of corn stalk borer SnJHER cDNA. The bar above the cDNA indicates a 1725 bp fragment used as a probe for the genomic Southern blot analysis. (B) Genomic DNA from a pool of the 5th instar larvae was digested with BglII, EcoRI, EcoRV, NcoI or NdeI and subjected to the Southern blot analysis. Hybridization was performed using as a probe the 1725 bp fragment from the SnJHER cDNA. DNA sizes are being shown to the left of the autoradiogram.

sequences CTGTTGCG/GAAGCCTT and TCTTCCAG/GAAGCCCG at the 5′and 3′-end respectively (/ indicates the boundaries at which the sequences differ; Figs. 5–12). Strikingly, the boundaries contain a repeat of the GAAGCC hexanucleotide and it is proposed that this sequence can act as a hot-spot to induce self-recombination for removal of the intervening sequences (Figs. 5 and 8). Similarly, the comparison of the sequence of the SnJHER4 cDNA with the SnJHEgR gene structure led us to conclude on the existence of a fourth SnJHEgR gene in the Sesamia genome (SnJHEgR4). The large deletion in the SnJHER4 cDNA, from position 832 to 2101 in the SnJHEgR gene structure, also cannot correspond to a splicing event since the removed sequence does not follow the GT/AG rule for intron splicing (Figs. 5 and 8). However, the removed sequences are characterized by the repetition of the heptanucleotide TGTGGGA at the junctions (TTGTGGGA/GAGTCTGG at the 5′ boundary and CTGTG GGA/GTACTGAA at the 3′ boundary) that could function as hot-spots for the recombination and removal of intervening sequences (as discussed above). We propose a potential mechanism which could partially explain how these genes were evolved. In the first step (Fig. 9) SnJHEgR was duplicated to form a second SnJHEgR′ gene. Both genes contained the CTGT TGCG/GAAGCCTT and TCTTCCAG/GAAGCCCG sequences at their 5′- and 3′-ends of their first (probably non-functional 5′ intron) respectively. The GAAGCC duplication potentially acted as a hot-spot for a selfrecombination event and its intervening sequences were removed to form the hypothetical SnJHEgR′ gene (Fig. 9). In the second step (Fig. 10) the transcriptionally “active” SnJHEgR′ gene (the 5′ splice

junction is not a prohibitive factor for efficient splicing procedure anymore) could transcribe the SnJHER and SnJHER3 mRNAs. These then were re-inserted to the S. nonagrioides' genome (maybe through retrotransposition) (Fig. 10). In the third step, (Fig. 11) two copies of SnJHER cDNA formed the SnJHEgR1 and SnJHEgR1′ genes while SnJHER3 formed the SnJHEgR3 genes (after retrotransposition). In this step a second hot-spot for self-recombination, and the repetition of the heptanucleotide TGTGGGA (TTGTGGGA/GAGTCTGG at the 5′ boundary and CTGTGGGA/GTACTGAA at the 3′ boundary) acted as a hot-spot for a self-recombination event and its intervening sequences were removed to form the hypothetical SnJHEgR4 gene (Figs. 11 and 12). We therefore obtained evidence that currently up to 5 genes could be fixed in the Sesamia's genome: a. the parental intron-containing SnJHEgR gene, which seems to be transcriptionally inactive due to its 5′ nonfunctional splice junction, b. the intron-less SnJHERgR1 and SnJHERgR3 genes which could transcribe the SnJHER and SnJHER3 mRNAs and c. the hypothetical intron-containing SnJHEgR′ and intron-less SnJHEgR4 genes. SnJHEgR′ could transcribe the SnJHER, SnJHER2 and SnJHER3 mRNAs and the SnJHEgR4 could only transcribe the SnJHER4 mRNA. 3.3. Semiquantitative analysis of SnJHER isoform expression In order to answer the question whether SnJHER cDNAs are differentially expressed in several developmental stages or hormonal conditions of S. nonagrioides we performed semiquantitative RT-PCR analyses. Due to the high sequence identity among the different cDNAs, only primers

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

145

Fig. 5. Cloning and sequence analysis of SnJHEgR genomic DNA. Schematic representation of SnJHEgR gene versus SnJHER cDNAs. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' and cDNAs' sequences. Lines indicate intronic sequences while dotted lines indicate alternative splicing or “splicing-like” junctions. The GAAGCC and TGTGGGA duplications are indicated.

that distinguish 2 or 3 isoforms simultaneously could be selected (Table 1 and Fig. 2). SnJHER isoform mRNA levels were analyzed in non-diapausing larvae during two larval instars (5th–6th) (Fig. 13A). SnJHERm corresponds to the major SnJHER isoform (Fig. 13). Our results showed that all the SnJHER mRNA isoforms are expressed in the 5th larval instar while only SnJHER2 and SnJHER4 are expressed in the last (6th) larval instar (Fig. 13A). SnJHER4 was the only isoform expressed at the beginning of the 5th instar (L5d1 sample; Fig. 13A). Moreover, the application of 25 μg of the JH analog methoprene revealed that SnJHER, SnJHER2 and SnJHER4 transcription is not influenced by methoprene while SnJHER3 and/or SnJHER4 are down-regulated by methoprene (Fig. 13B). In addition SnJHER2 and SnJHER4 are up-regulated after the

application of 10 μg of the ecdysone agonist RΗ-5992 while SnJHER3 and SnJHER are not or only slightly up-regulated (Fig. 13C). 4. Discussion Insect JHEs have gained extensive attention, due to their physiological role in regulating insect development. Chemical inhibitors of JHE and juvenile hormone analogs have been studied in the past for their potential use in pest management and crop protection (Doucet et al., 2008). However, a recently considerable discussion was raised regarding JHE and related enzymes with respect to their role in the degradation of JH-like substances and the regulation of development. While

Fig. 6. Cloning and sequence analysis of SnJHEgR1 genomic DNA. Schematic representation of SnJHEgR1 gene versus SnJHER cDNA. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' and cDNAs' sequences.

Fig. 7. Cloning and sequence analysis of SnJHEgR3 genomic DNA. Schematic representation of SnJHEgR1 gene versus SnJHER cDNA. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' and cDNAs' sequences.

146

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

Fig. 8. Cloning and sequence analysis of SnJHER genomic DNA. Multiple sequence alignment of the SnJHEgR genes and SnJHER cDNAs. Arrows indicate the annealing positions of primers used for the isolation of the SnJHEgR genes. Start and stop codons are indicated in black and white boxes.

canonical JHE, together with JHEH, are regarded as the main enzymes involved in catabolism of JH, the more recent availability of genome and transcriptome sequences from different insect species allowed the identification of several additional “JHE-like” esterases. The identification of such enzymes raised naturally the question regarding their involvement

in development in similar or perhaps complementary manner to canonical JHE (Crone et al., 2007; Tsubota et al., 2010). This paper describes an expansion of JHER genes in the agricultural pest S. nonagrioides which suggests a potential for considerable evolutionary diversification of “JHE-like” esterases in insects.

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

147

Fig. 9. Proposed mechanism of SnJHEgR genes evolution step 1. Schematic representation of SnJHEgR evolution. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' sequences. Simple lines indicate the intronic sequences while the dotted lines distinguish the genes from the cDNAs. The GAAGCC and TGTGGGA duplications are indicated.

Fig. 10. Proposed mechanism of SnJHEgR genes evolution step 2. Schematic representation of SnJHEgR evolution. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' sequences. Simple lines indicate the intronic sequences while the dotted lines distinguish the genes from the cDNAs. The GAAGCC and TGTGGGA duplications are indicated.

148

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

Fig. 11. Proposed mechanism of SnJHEgR genes evolution step 3. Schematic representation of SnJHEgR evolution. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' sequences. Simple lines indicate the intronic sequences while the dotted lines distinguish the genes from the cDNAs. The GAAGCC and TGTGGGA duplications are indicated.

4.1. Sequence analysis of SnJHER cDNA isoforms Even though JHE has been considered as the main JH-catabolizing enzyme, scientific reports have alleged the existence of JHE-related or JHE-like enzymes which could catabolize JH-related or JH-like hormones with different or similar biological functions to those of the normal JHs (Jones et al., 1994). For instance, T. ni JHER is a carboxylesterase possessing the canonical catalytic residues of serine, histidine and aspartate, which is similar to conventional JHE (Jones et al., 1994). However, the different N-terminus and the occurrence of small motifs

throughout the coding sequence revealed that this cDNA seems to be more similar to cholinesterases than to conventional JHE. Additionally, cytochrome P450s have also been documented to play roles in JH degradation (Sutherland et al., 1998). TniJHER and the three isoforms SnJHER, SnJHER2 and SnJHER4 are characterized by the GQSCG, which contrasts with the motif GQSAG found in conventional JHEs. Interestingly, the existence of four protein isoforms of SnJHER was implicated in this study, which differs by point mutations and several wide deletions throughout the ORF. The point mutations could be a result of different genotypes (strains)

Fig. 12. Proposed mechanism of SnJHEgR genes evolution step 4. Schematic representation of SnJHEgR evolution. Different shades represent homologous nucleotide parts, while numbers indicate the positions of these parts in the genes' sequences. Simple lines indicate the intronic sequences while the dotted lines distinguish the genes from the cDNAs. The GAAGCC and TGTGGGA duplications are indicated.

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

149

Fig. 13. Semiquantitative RT-PCR analysis of expression SnJHER mRNA isoforms at several developmental stages and after hormonal treatment. (A) Analysis of expression in nondiapausing larvae (LD 16:8) from the 5th up to the 6th (last) larval instar. (B) The fifth instar larvae were topically treated with 25 μg of methoprene and analyzed for SnJHER isoform expression. Controls were topically treated with DMSO. (C) The sixth instar larvae were topically treated with 10 μg of RH-5992 and analyzed for SnJHER isoform expression. Controls were topically treated with DMSO. S. nonagrioides β-tubulin was used as the reference gene. Abbreviations: “L” indicates the number of instar and “d” indicates the number of days after the molt.

among the analyzed populations (cDNA was isolated from a pool of S. nonagrioides larvae). Deletions likely have functional consequences since they result in the lack of the catalytic RF motif in SnJHER3 and the removal of the RF, DA and GQSCG motifs in SnJHER4. SnJHER3 and SnJHER4 are also predicted to have completely different N-termini while a deletion at the 3′-end resulted in a modified C-terminus for SnJHER2. Whether these differences drive distinct biological functions or cellular or tissue compartmentalization needs to be explored in future studies. Our sequencing data therefore support the existence of genetic diversity and plasticity of SnJHER mRNAs and derived proteins. When a phylogenetic tree was constructed (Fig. 14), the different Sesamia JHER sequences grouped closest with Trichoplusia JHER, as expected. The phylogenetic tree also shows that the JHE esterases of Lepidoptera are clearly distinct from other insect groups. Interestingly, one of the “JHE-like” sequences closest in the phylogenetic tree was isolated from antenna in Spodoptera littoralis (Durand et al., 2010). This suggests that “JHE”-like esterases can undergo evolutionary changes to acquire new functions, such as the metabolism of odorants. It has been suggested before that a close phylogenetic position to canonical JHE does not necessarily indicate that the enzyme is capable to metabolize JH or JH-like substances efficiently (Crone et al., 2007). To confirm a role for SnJHER

in JH metabolism, functional tests are therefore necessary (see also further discussion below). While our previous study (Kontogiannatos et al., 2013) indicated a role for SnJHER (major isoform) in the regulation of development, more biochemical and genetic studies are necessary to unravel the mechanism. 4.2. Semiquantitative analysis of SnJHER isoform expression Expression studies of the 4 SnJHER cDNAs with primers which could distinguish 2–3 isoforms per analysis revealed that all isoforms were abundant during the larval molt from the 5th to the 6th larval instar while only SnJHER2 and/or SnJHER4 cDNAs were abundant during the intermolt period of the 6th instar. Interestingly, the expression was limited to the earlier part of the 6th instar stage and disappeared after metamorphic commitment (later part of the 6th instar stage). This pattern of expression was similar to that reported in TniJHER and other genes that are highly expressed before, but not after the metamorphic commitment, such as arylphorin (Jones et al., 1994, 1993). Like TniJHER (Jones et al., 1994), SnJHER, SnJHER2 and SnJHER4 transcription is not influenced by methoprene while SnJHER3 and/or SnJHER4 genes are down-regulated by methoprene. In addition SnJHER2

150

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

Fig. 14. Neighbor-joining tree of JHEs and other carboxylesterases in Lepidoptera and other insects. The full names of species, the abbreviations and the accessions are: SnJHER, juvenilehormone related esterase of S. nonagrioides, accession numbers ABW24219 (major isoform) and HQ588155, HQ588156 and HQ588157 (SnJHER2, SnJHER3 and SnJHER4); TniJHER, juvenile-hormone related esterase of T. ni, accession number S55233; SpoliAnt-estCXE15 (Antennal esterase CXE15 [Spodoptera littoralis], GenBank: ACV60242); BmaACChE (Acetylcholinesterase [Bombyx mandarina], GenBank: ABM46999); HarACChE (Acetylcholinesterase [Helicoverpa armigera], GenBank: AAN37403); PxyACChE (Acetylcholinesteraselike [Plutella xylostella], GenBank: XP_011552371); BmoJHE (Juvenile hormone esterase 1 precursor [Bombyx mori],GenBank: NP_001037027); BmoCOE-6 (Alpha-esterase 45 [Bombyx mori], GenBank: NP_001104822); MyseJHE (Juvenile hormone [Mythimna separata],GenBank: ACO81854); HviJHE (Juvenile hormone esterase precursor [Heliothis virescens], GenBank: AAC38822); MseJHE (Juvenile hormone esterase precursor [Manduca sexta],GenBank: AAG42021); AcaCOE (Carboxylesterase [Anisopteromalus calandrae], GenBank: AAC36245); ChoCOEE3 (Carboxylesterase E3 [Cochliomyia hominivorax], GenBank: ACR56068); CsuEst (Esterase, partial [Chilo suppressalis], GenBank: ABD62772); LcuE3 (E3 [Lucilia cuprina], GenBank: AAB67728); AmeJHEL (Juvenile hormone esterase isoform X1 [Apis mellifera], GenBank: XP_006563937); AaeJHE (AAEL005200-PA, partial [Aedes aegypti], GenBank: XP_ 001650480); CquJHE (Juvenile hormone esterase [Culex quinquefasciatus], GenBank: XP_001863697); DmeJHE (Juvenile hormone esterase [Drosophila melanogaster], GenBank: AAK07833); HarCCE016a (Carboxyl/choline esterase CCE016a [Helicoverpa armigera], GenBank: ADF43478); HarCCE014a (Carboxyl/choline esterase CCE014a [Helicoverpa armigera], GenBank: ADF43475); OfuJHE (Juvenile hormone esterase [Omphisa fuscidentalis], GenBank: ACB12192); AroCOE (Carboxylesterase [Athalia rosae], GenBank: BAD91555); CfuJHE (Juvenile hormone esterase [Choristoneura fumiferana], GenBank: AAD34172); Bmoa-est48 (Carboxyl/cholinesterase 5BL [Bombyx mori], GenBank: BAI66485); BmaCOE4 (Carboxylesterase 4 variant 1 [Bombyx mandarina], GenBank: ACF98320).

and SnJHER4 were up-regulated after the application of RΗ-5992 while the SnJHER3 and maybe SnJHER are not or are slightly up-regulated by RΗ-5992. The data indicate that certain SnJHEgR genes respond differently to hormone treatments and thus apparently have evolved differently from other genes and acquired different functions. Alterations in gene regulation are considered to be a prerequisite for macroevolutionary change and species divergence (Brady and Richmond, 1990). Esterase 6 (EST 6; carboxylic-ester hydrolase, EC 3.1.1.1) enzyme in Drosophila melanogaster and its homolog in Drosophila pseudoobscura, EST 5, present similarities in their protein products, transcripts, and DNA sequences. Despite their common evolutionary origin, EST 6 and EST 5 exhibit remarkable differences in their tissue- and sex-specific expression. EST 5 is found in the eyes and hemolymph of adult D. pseudoobscura of both sexes. EST 6, on the other hand, occurs primarily in adult male D. melanogaster, and its activity is mainly in the anterior ejaculatory duct. Lower levels of EST 6 are also found in the hemolymph of both sexes (Brady and Richmond, 1990). Also in Bombyx, several additional candidate JHEs were identified that belong to the CCE family (Tsubota et al., 2010). While a role in JH catabolism was not confirmed, their differential expression patterns suggest a functional diversification of the different genes, with roles in the regulation of molting to the detoxification of foreign chemical substances. Contrary to the studies with Drosophila and Bombyx, however, the genomic regions of SnJHEgR genes at the population's or at the individual's level

have not been analyzed and it is therefore difficult to reach clear conclusions. Further studies are needed to establish Sesamia populations with uniform SnJHEgR gene content in which regulatory regions of individual SnJHEgR genes can be analyzed. 4.3. Proposed mechanism of SnJHEgR genes evolution Southern blot hybridization and DNA data revealed the presence of at least three SnJHER genes in S. nonagrioides' genome. We propose two mechanisms for the diversification or amplification of SnJHEgR genes: homologous self-recombination can remove deleted sequences between short repeats, and retro-transposition of SnJHER mRNA sequences (after removal of the introns) into the genome and the formation of processed genes. In addition, it is clear that the SnJHER diversity cannot be solely generated through alternative splicing from introncontaining genes, such as SnJHEgR. Because of the complexity of the gene evolution and taking into account the PCR's technical restrictions as well, however, it is easy to imagine that additional copies of JHEgR (e.g. SnJHEgR′ and SnJHEgR4) in the genomes of the Sesamia population could not be amplified by the selected primers. Moreover, the Southern blot analysis was performed using DNA obtained from a pool of larvae, which makes it impossible to evaluate whether the crosshybridization pattern is mainly derived from the use of genomic DNA from different individuals or whether multiple genes in a single

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

individual's genome contribute to the complexity. Further studies, employing both Southern hybridization and multiple primer PCR, are needed to clarify the pattern of the occurrence of different SnJHEgR genes in the genomes of different Sesamia larvae and if this occurrence can be correlated with distinct populations collected in the field. One observation is the existence of SnJHEgR genes as processed genes that could be generated by the process of retrotransposition. Analysis of genes that were duplicated through retrotransposition events in Drosophila indicates that such genes can acquire quickly different expression patterns (Langille and Clark, 2007), an observation that is confirmed in our study. Retrotransposition in insects is also involved in the acquisition of immunity against (non-retro) virus infection through the incorporation of viral sequences in the genome that subsequently can function as a source of small RNAs (Goic et al., 2013). Pseudogenes, generated by retrotransposition events, also can remain transcriptionally active and exert regulatory roles, for instance in the chorion locus of B. mori (Chen et al., 2015). While roles as the production of antiviral small RNAs and regulatory antisense RNAs were proposed for retrotransposed transcripts (Goic et al., 2013; Chen et al., 2015), such role may not apply for the putative retrotransposed transcripts in the genome of S. nonagrioides since few or no nonsynonymous mutations have accumulated. However, the latter could also reflect the relatively recent multiplication event after which not sufficient time has elapsed to accumulate mutations. 5. Conclusions SnJHEgR genes present a unique mixture of intron-rich and intronless variants that result in the expression of several different protein isoforms. We believe that these genes evolved from a parental JHE gene under an unknown evolutionary pressure. The derived SnJHEgR genes do not seem to be stabilized yet in the genomes of the population and undergo a continuous evolutionary process. The products of this process could lead in neo-functionalization, sub-functionalization or loss of function in the distant future although currently they seem to retain the original nucleotide composition. The nucleotide sequences for SnJHEgR, SnJHER, SnJHER2, SnJHER3 and SnJHER4 have been submitted to GenBank under accession numbers HQ588158, EU178813, HQ588155, HQ588156 and HQ588157, respectively. SnJHEgR1 and SnJHEgR3 gene sequences are provided in the additional file 1. Supplementary data associated with this article can be found in online version, at doi:http://dx.doi.org/10.1016/j.genrep. 2016.04.010. Ethics The present study does not involve humans, human data, vertebrates or regulated invertebrates. Competing interests The authors declare that they have no competing interests. Authors' contributions DK, AK and LS conceived the experiments. AK and LS provided reagents and resources. DK performed the experiments. DK, AK and LS drafted the manuscript. All authors read and approved the final manuscript. References Blattner, F.R., Plunkett, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M., et al., 1997. The complete genome sequence of Escherichia coli K-12. Science 277, 1453–1462. Brady, J.P., Richmond, R.C., 1990. Molecular analysis of evolutionary changes in the expression of Drosophila esterases. Proc. Natl. Acad. Sci. U. S. A. 87, 8217–8221.

151

Bratlie, M.S., Johansen, J., Sherman, B.T., Huang da, W., Lempicki, R.A., Drabløs, F., 2010. Gene duplications in prokaryotes can be associated with environmental adaptation. BMC Genomics 11, 588. Campbell, P.M., Harcourt, R.L., Crone, E.J., Claudianos, C., Hammock, B.D., Russell, R.J., et al., 2001. Identification of a juvenile hormone esterase gene by matching its peptide mass fingerprint with a sequence from the Drosophila genome project. Insect Biochem. Mol. Biol. 31, 513–520. Chen, Z., Nohata, J., Guo, H., Li, S., Liu, J., Guo, Y., Yamamoto, K., Kadono-Okuda, K., Liu, C., Arunkumar, K.P., Nagaraju, J., Zhang, Y., Liu, S., Labropoulou, V., Swevers, L., Tsitoura, P., Iatrou, K., Gopinathan, K.P., Goldsmith, M.R., Xia, Q., Mita, K., 2015. A comprehensive analysis of chorion locus in silkmoth. Sci. Rep. 5, 16424. Crone, E.J., Sutherland, T.D., Campbell, P.M., Coppin, C.W., Russell, R.J., Oakeshott, J.G., 2007. Only one esterase of Drosophila melanogaster is likely to degrade juvenile hormone in vivo. Insect Biochem. Mol. Biol. 37, 540–549. Doucet, D., Cusson, M., Retnakaran, A., 2008. Insect endocrinology and hormone-based pest control products in IPM. In: Radcliffe, E.B., Hutchison, W.D., Cancelado, R.E. (Eds.), Integrated Pest Management: Concepts, Tactics, Strategies and Case Studies. Cambridge University Press, pp. 286–297. Durand, N., Carot-Sans, G., Chertemps, T., Montagné, N., Jacquin-Joly, E., Debernard, S., Maïbèche-Coisne, M., 2010. A diversity of putative carboxylesterases are expressed in the antennae of the noctuid moth Spodoptera littoralis. Insect Mol. Biol. 19, 87–97. Feng, O.L., Ladd, T.R., Tomkins, B.L., Sundaram, M., Sohi, S.S., Retnakaran, A., et al., 1999. Spruce budworm (Choristoneura fumiferana) juvenile hormone esterase: hormonal regulation, developmental expression and cDNA cloning. Mol. Cell. Endocrinol. 148, 95–108. Goic, B., Vodovar, N., Mondotte, J.A., Monot, C., Frangeul, L., Blanc, H., Gausson, V., VeraOtarola, J., Cristofari, G., Saleh, M.C., 2013. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nat. Immunol. 14, 396–403. Goodman, W.G., Granger, N.A., 2005. The juvenile hormones. In: Gilbert, L.I., Iatrou, K., Gill, S.S. (Eds.), Comprehensive Molecular Insect Science. Elsevier, Amsterdam, pp. 319–406. Gullan, P.J., Cranston, P.S., 2010. The Insects: An Outline of Entomology. third ed. Blackwell Publishing Ltd. Hahn, M.W., 2009. Distinguishing among evolutionary models for the maintenance of gene duplicates. J Hered. 100, 605–617. Hammock, B.D., 1985. Regulation of juvenile hormone titer: degradation. In: Kerkut, G.A., Gilbert, L.I. (Eds.), Comprehensive Insect Physiology, Biochemistry and Pharmacology. Pergamon Press, New York, pp. 431–472. Harshman, L.G., Ward, V.K., Beetham, J.K., Grant, D.F., Grahan, L.J., Zraket, C.A., et al., 1994. Cloning characterization and genetics of the juvenile hormone esterase gene from Heliothis virescens. Insect Biochem. Mol. Biol. 24, 671–676. Hartfelder, K., 2000. Insect juvenile hormone: from “status quo” to high society. Braz. J. Med. Biol. Res. 33, 157–177. Hinton, A.C., Hammock, B.D., 2001. Purification of juvenile hormone esterase and molecular cloning of the cDNA from Manduca sexta. Insect Biochem. Mol. Biol. 32, 57–66. Hirai, M., Kamimura, M., Kikuchi, K., Yasukochi, Y., Kiuchi, M., Shinoda, T., et al., 2002. cDNA cloning and characterization of Bombyx mori juvenile hormone esterase: an inducible gene by the imidazole insect growth regulator KK-42. Insect Biochem. Mol. Biol. 32, 627–635. Jones, G., Manczak, M., Horn, M., 1993. Hormonal regulation and properties of a new group of basic hemolymph proteins expressed during insect metamorphosis. J. Biol. Chem. 268, 1284–1291. Jones, G., Venkataraman, V., Ridley, B., O'Mahony, P., Turner, H., 1994. Structure, expression and gene sequence of a juvenile hormone esterase related protein from metamorphosing larvae of Trichoplusia ni. Biochem. J. 302, 827–835. Kamita, S.G., Hammock, B.D., 2010. Juvenile hormone esterase: biochemistry and structure. J. Pestic. Sci. 35, 265–274. Kamita, S.G., Samra, A.I., Liu, J.Y., Cornel, A.J., Hammock, B.D., 2011. Juvenile hormone (JH) esterase of the mosquito Culex quinquefasciatus is not a target of the JH analog insecticide methoprene. PLoS One 6, e28392. Kontogiannatos, D., Michail, X., Kourti, A., 2011. Molecular characterization of an ecdysteroid inducible carboxylesterase with GQSCG motif in the corn borer, Sesamia nonagrioides. J. Insect Physiol. 57, 1000–1009. Kontogiannatos, D., Swevers, L., Maenaka, K., Park, E.Y., Iatrou, K., Kourti, A., 2013. Functional characterization of a juvenile hormone esterase related gene in the moth Sesamia nonagrioides through RNA interference. PLoS ONE 8, e73834. Koonin, E.V., 2005. Orthologs, paralogs, and evolutionary genomics. Annu. Rev. Genet. 39, 309–338. Kourti, A., 2006. Mitochondrial DNA restriction map and cytochrome c oxidase subunits I and II sequence divergence of corn stalk borer Sesamia nonagrioides (Lepidoptera: Noctuidae). Biochem. Genet. 44, 321–332. Langille, M.G.I., Clark, D.V., 2007. Parent genes of retrotransposition-generated gene duplicates in Drosophila melanogaster have distinct expression profiles. Genomics 90, 334–343. Mira, A., Pushker, R., Rodriguez-Valera, F., 2006. The Neolithic revolution of bacterial genomes. Trends Microbiol. 14, 200–206. Munyiri, F.N., Ishikawa, Y., 2007. Molecular cloning and developmental expression of the gene encoding juvenile hormone esterase in the yellow-spotted longicorn beetle, Psacothea hilaris. Insect Biochem. Mol. Biol. 37, 497–505. Ohno, S., 1970. Evolution by Gene Duplication. Springer-Verlag, Berlin. Pearce, D., Yamamoto, K.R., 1993. Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science 259, 1161–1165. Pérez-Hedo, M., Eizaguirre, M., Sehnal, F., 2010. Brain-independent development in the moth Sesamia nonagrioides. J. Insect Physiol. 56, 594–602.

152

D. Kontogiannatos et al. / Gene Reports 4 (2016) 139–152

Riddiford, L.M., Himura, K., Zhou, X., Nelson, C.A., 2003. Insights into the molecular basis of the hormonal control of molting and the metamorphosis from Manduca sexta and Drosophila melanogaster. Insect Biochem. Mol. Biol. 33, 1327–1338. Roe, R.M., Benkatesh, K., 1990. Metabolism of juvenile hormones: degradation and titer regulation. In: Gupta, A.P. (Ed.), Morphogenetic Hormones of Arthropods. Rutgers University Press, New Brunswick, NJ, pp. 126–179. Schafellner, C., Eizaguirre, M., López, C., Sehnal, F., 2008. Juvenile hormone esterase activity in the pupating and diapausing larvae of Sesamia nonagrioides. J. Insect Physiol. 54, 916–921. Sutherland, T.D., Unnithan, G.C., Andersen, J.F., Evans, P.H., Murataliev, M.B., Szabo, L.Z., Mash, E.A., Bowers, W.S., Feyereisen, R., 1998. A cytochrome P450 terpenoid hydroxylase linked to the suppression of insect juvenile hormone synthesis. Proc. Natl. Acad. Sci. U. S. A. 95, 12884–12889.

Tsubota, T., Shimimura, M., Ogura, T., Seino, A., Nakakura, T., Mita, K., et al., 2010. Molecular characterization and functional analysis of novel carboxyl/cholinesterases with GQSAG motif in the silkworm Bombyx mori. Insect Biochem. Mol. Biol. 40, 100–112. Ward, V.K., Bonning, B.C., Huang, T., Shiotsuki, T., Griffeth, V.N., Hammock, B.D., 1992. Analysis of the catalytic mechanism of juvenile hormone esterase by site-directed mutagenesis. Int. J. Biochem. 24, 1933–1941. Wogulis, M., Wheelock, C.E., Kamita, S.G., Hinton, A.C., Whetstone, P.A., Hammock, B.D., et al., 2006. Structural studies of a potent insect maturation inhibitor bound to the juvenile hormone esterase of Manduca sexta. Biochemistry 45, 4045–4057. Zhang, J., 2003. Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298.