- Email: [email protected]
Reciprocal expression of myelin-associated glycoprotein splice variants in the adult human peripheral and central nervous systems1
Molecular Brain Research 52 Ž1997. 299–306
Research report
Reciprocal expression of myelin-associated glycoprotein splice variants in the adult human peripheral and central nervous systems 1 2 Guido C. Miescher ) , Roland Lutzelschwab , Beat Erne, Fabrizia Ferracin, Susanne Huber, ¨ Andreas J. Steck Departments of Clinical Neurology and Research, UniÕersity Hospitals, CH-4031 Basle, Switzerland Accepted 22 July 1997
Abstract The L- and S-MAG isoforms differ only at their C-terminus and are believed to be functionally distinct. To obtain information on the relative expression of these alternatively spliced isoforms in humans, we cloned an S-MAG cDNA fragment. The deduced amino-acid sequence of the human S-MAG C-terminus shows fairly conservative substitutions of 4 out of the 10 residues compared to the rodent peptide. Using reverse transcription and a competitive polymerase chain reaction, we show that, in contrast to rodents, the L-MAG splice variant predominates in adult human brain while, like in rodents, S-MAG transcripts are most abundant in peripheral nerve. The results obtained by Western blot analysis and immunohistochemistry are in good agreement with the findings at the mRNA level. Animal experiments may thus be more representative for the role of MAG in human nerve than in brain. q 1997 Elsevier Science B.V. Keywords: Myelin-associated glycoprotein; L-MAG; S-MAG; Competitive PCR; Immunohistochemistry
1. Introduction Myelin-associated glycoprotein ŽMAG., a major glycoprotein in uncompacted myelin w24x, is the principal target in an autoimmune demyelinating peripheral neuropathy w2,21,22x. A characteristic feature of this chronic disease is the anti-MAG autoantibody dependent and selective loss of MAG in peripheral myelin w8x. The lack of MAG in myelin may be deleterious for long-term myelin stability as suggested by the observation of a demyelinating neuropathy in aged transgenic mice with deleted MAG genes w7x. However, definitive information on the role of MAG remains sparse, especially in humans. MAG belongs to the sialoadhesin family of multiple immunoglobulin domain proteins and binds to as yet unde-
Abbreviations: PCR, polymerase chain reaction; CNS, central nervous system; PNS, peripheral nervous system. ) Corresponding author. Fax: q41 Ž61. 265-2350; E-mail: [email protected] 1 The nucleotide sequence of the human S-MAG cDNA fragment has been made available in the EMBL Nucleotide Sequence Database under the accession number: X98405. 2 Contributed the majority of experimental data as part of his PhD thesis work. 0169-328Xr97r$17.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 7 . 0 0 2 5 4 - 4
fined sialylated glycans on the axolemma w12x. MAG is located in the periaxonal membranes of oligodendrocytes and Schwann cells w25x and one of its functions may be maintaining the spacing of these membranes towards the compact myelin on the cytoplasmic side and towards the axolemma on the extracellular side w15,16x. In the peripheral but not in the central nervous system ŽPNS, CNS., MAG is also found in other areas of uncompacted myelin, such as the Schmidt-Lanterman incisures and the paranodal loops, where its function is still unknown w24x. There is considerable evidence showing that MAG can be removed from the cell surface by receptor-mediated endocytosis, a process that may be a prerequisite for compaction of myelin membranes w23x. An important determinant of MAG internalization is the intracellular domain which differs in the L- and S-MAG isoforms. The preferential internalization of L-MAG from periaxonal membranes at the time of active myelination w1x may also involve tyrosine kinase signalling, as L- but not S-MAG can activate the Fyn intracellular tyrosine kinase w27x. Biochemical experiments have indicated that there are 2 MAG isoforms with a polypeptide backbone of 70 and 67 kDa w6x. The L- and S-MAG isoforms are the products of alternatively spliced mRNAs and in rodents S-, or ‘small’ MAG lacks 54 C-terminal amino acids of L, or ‘large’
300
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
MAG. S-MAG has a different C-terminus due to a alternative mRNA splice containing 10 in-frame codons followed by a stop codon w13x. L- and S-MAG have identical extracellular, transmembrane and juxtamembrane cytoplasmic regions. The latter regions spans 35 amino acids without homology to other protein domains in the data bases and it is less well conserved between rodents and human than the extracellular domain of MAG. Only human L-MAG cDNA clones have been reported w18,20x and the relative abundance in the human nervous system of the two alternatively spliced MAG transcripts is not known. Also, there are no antibodies specific for human S-MAG. We provide here this information and show that there are significant differences between the situation in rodents and in humans.
2. Materials and methods 2.1. cDNA cloning and polymerase chain reaction With the approval of the ethics committee of the Department of Pathology, sural nerve, femoral nerve, cauda equina and brain samples were obtained from autopsies without neurological disease and stored at y808C until needed. Material from CNS and PNS was obtained in 3 cases, in 3 more cases only tissue of either CNS or PNS was available. Total RNA was extracted using the acid phenol method with minor modifications w4x. Alternatively, mRNA was selected using oligo-ŽdT. Dynabeads as recommended by the manufacturer ŽDynal, NY.. Following reverse transcription ŽGibco-BRL, Gaithersburg, MD. using oligo-dT20 ŽPharmacia Biotech, Piscataway, NJ., the cDNA was amplified using the polymerase chain reaction ŽPCR. in conjunction with different sets of HPLC-purified oligonucleotide primers ŽMWG-Biotech, Ebersberg, Germany.: AF TGCCATCGTCTGCTACATTACCC and AR GCCCAGCCCCCGATACTTTTG, i.e. positions 1701– 1724 and 2081–2101 on human L-MAG Žaccession number M29273. w18x; BF TCCTGTCCACGGTCATCTACG and BR CAGGCGCCTCTCGCTCTCG, i.e. positions 1214–1235 and 1833–1852 on human L-MAG; CF TGGAATCTCACTGAGTGCCCC, positions 156–176 on our MAG cDNA fragment Žaccession number X98405, this report.; and DF CACCCACACTGTGCCCATC and DR CTAGAAGCATTTGCGGTGGAC, i.e. positions 518–536 and 1148–1169 on human b-actin w17x. Initially, the PCR using buffers and Taq DNA polymerase from Gibco-BRL with primers A5X and A3X was used to amplify MAG cDNA fragments derived from a human brain total RNA sample. The PCR products were purified by agarose gel electrophoresis and cloned into pCRII TA plasmids ŽInvitrogen, San Diego, CA. as recommended by the manufacturer. Two plasmids with inserts of 401 and two plasmids with 446-bp inserts were sequenced on both strands by the chain termination method ŽSequenase
2.0, USB, Cleveland, OH. using sequencing primers specific for the T7 and SP6 RNA polymerase promoters. Sequence analysis and alignments were done using the GCG software Package, Version 7 ŽGenetics Computer Group, Madison, WI.. Optimal amounts of cDNA were used in a competitive PCR assay as previously described w14x. Briefly, this procedure amplifies selected MAG cDNA fragments together with a synthetic DNA template called MIMIC. The MIMIC contains an indifferent sequence, in our case a human IgL chain cDNA fragment of 748 bp, which is flanked by the specific priming sites. The MIMIC templates were produced by starting with an IgL chain cDNA template and an initial 10 cycles of PCR using composite primers corresponding to the above MAG primers with 3X extensions complementary to the ends of the IgL chain fragment. This artificial template was then further amplified using the MAG primers alone, ethanol precipitated and quantified by measuring the optical density at 260 nm. For competitive PCR assays, triplicate dilutions of mRNA-derived cDNA were mixed with constant amounts of MIMIC DNA, typically 1 = 10y2 0 Mol Žs 0.001 atMol., ensuring that some of the amounts of amplified MAG cDNA fragments were below and others above the point of molar equivalence with the amplified MIMIC DNA. After 40 cycles of amplification, the PCR products were electrophoresed in agarose gels pre-stained with ethidium bromide Ž0.5 m grml., recorded using a cooled CCD video camera ŽCS1 Image Documentation System, Cybertech, Berlin, Germany. and quantified using Wincam 2.2. software ŽCybertech.. Molar concentrations of MAG-specific cDNA were calculated using double logarithmic plotting of the input cDNA volumes and the molar ratio of the amplified MAG and MIMIC PCR products. We have verified that the PCR reactions allowed for a reproducible quantification even when prolonged into the plateau phase w19x. The maximal variability of the reverse transcription and MIMIC PCR procedure was 40% from the mean. 2.2. Antipeptide L- and S-MAG antibodies, protein preparation and Western blot analysis A human C-terminal S-MAG peptide, CG GSKEVSTLESH, was maleimide coupled to edestin and HPLC-purified ŽBioTools, Denzlingen, Germany. and an L-MAG peptide close to its C-terminus, LTEELAEYAEIRV, was coupled to keyhole lympet hemocyanine ŽCalbiochem, San Diego, CA. with glutaraldehyde. New Zealand White rabbits were immunized s.c. with 500 m g protein in complete Freund’s adjuvans and boosted 3 = with 100 mg protein in incomplete Freund’s adjuvans. The hyperimmune sera were purified by affinity chromatography on Affigel 15-coupled peptide according to the manufacturer’s instructions ŽBio-Rad, Hercules, CA.. The antibodies were eluted with 0.1 M glycine pH 2.5, neutralised with Tris pH. 8.0, dialysed into PBS and concentrated
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
301
Table 1 Relative distribution of L- and S-MAG mRNA in human CNS and PNS Sex
Age
Male Female Male Male Female Male
65 69 79 80 83 95
a
CNS L r S -MAG
b
PNS S r L -MAG
b
L-MAG CNS r PNS
c
S-MAG CNS r PNS
c
41 Žw. 16 Žw. 17 Žw. 5 Žw.
6 Žs. 13 Žs.; 93 Žf. 52 Žc. 9 Žs.; 31 Žf. 18 Žs.; 45 Žf.; 15 Žc.
965 Žs.; 1027 Žf.
4.9 Žs.; 0.7 Žf.
102 Žs.; 827 Žf. 325 Žs.; 280 Žf.; 125 Žc.
0.6 Žs.; 1.5 Žf. 3.8 Žs.; 1.3 Žf.; 1.8 Žc.
a
Age at autopsy. Mean ratios of L- to S-MAG or S- to L-MAG transcripts based on triplicate competitive quantitative PCRs. c Ratios of L-MAG or S-MAG transcripts in CNS compared to PNS. The MAG mRNA levels were standardized using ß-actin mRNA levels determined by competitive quantitative PCR. s s sural nerve; f s femoral nerve; c s cauda equina; w s white matter from frontal lobe. b
before storing at y708C. Human myelin from a 75-year-old autopsy case not included in Table 1 was isolated from cauda equina and frontal lobe white matter by discontinuous sucrose gradient centrifugation as described w3x. Proteins were quantified by Bradford assay and 20 m g loaded per lane on reducing 10% SDS-polyacrylamide gels. Following electrophoresis, samples were electrotransferred onto nitrocellulose membranes ŽSchleicher and Schuell, Keene, NH. and stained with Ponceau S to verify the amount of protein loaded per lane. The blots were blocked with phosphate-buffered saliner0.15% casein overnight at 48C. They were incubated at room temperature for 2 h with the affinity-purified antibody and for 2 h with horseradish peroxidase-labelled goat anti-rabbit IgG ŽNordic, Tilburg, The Netherlands. in blocking buffer Ž1.5 mgrml casein, 0.2% Tween-20 in phosphate-buffered saline.. Detection was by chemoluminescence ŽECL system, Amersham Life Science, Arlington Heights, IL.. The ECL films were scanned at 400 dpi with a Canon CLC 10 and processed using the Adobe Photoshop Version 2.5.1 software ŽAdobe Systems, Mountain View, CA..
bated successively with affinity-purified rabbit antibodies and peroxidase-labelled goat anti-rabbit IgG ŽSigma Biosciences, St. Louis, MO.. For comparison, we used an anti-MAG extracellular domain monoclonal antibody, D3A2G5, w3x together with a goat anti-mouse IgG second layer antibody ŽSigma Biosciences.. The staining of the sections was performed using the peroxidase substrate 3-amino-9-ethylcarbazole. The cerebellum sample ŽFig. 4.
2.3. Immunohistochemistry Cryostat sections Ž8 m m thick. of human tissues were mounted on gelatin-chromalum-coated slides, fixed with 10% vrv buffered formalin for 2 h. Endogenous peroxidase activity was blocked in 80% methanol, 0.6% H 2 O 2 for 20 min at room temperature. The sections were incu-
Fig. 1. Comparison between rodent and human S-MAG-specific cDNA and protein sequences. The nucleotide sequences shown are the rodent alternative splice corresponding to MAG exon 12 and the homologous spliced cDNA sequence in human. The mouse and rat nucleotide sequences are 100% identical. The differences are indicated in bold and underlined; the stop codon is in bold. The amino-acid translations are given in single-letter code and the differing residues are in bold and doubly underlined, ) indicates the S-MAG C-terminus.
Fig. 2. Competitive PCR analysis of L- and S-MAG mRNA in the CNS and PNS. The representative agarose gels stained with ethidium bromide show PCR products obtained with mRNA from reverse-transcribed CNS white matter Žtop 2 gels. or PNS, i.e. sural nerve Žbottom 2 gels.. For each PCR, a constant amount of MIMIC heterologous internal standard DNA and appropriate oligonucleotide primers have been used. The arrows indicate the approximate cDNA dilutions where equimolar amounts of MIMIC and MAG cDNA have been amplified.
302
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
amino acids in the homologous sequence in human are different. With the exception of the arginine to leucine substitution ŽFig. 1., the general properties of the substituted residues are maintained. With the information on the S-MAG splice, we designed S- and L-MAG-specific PCR
Fig. 3. Western blot analysis of CNS and PNS myelin with anti-L- and anti-S-MAG affinity-purified antibodies. Nitrocellulose blots with 20 m g protein of either CNS or PNS myelin in each lane were used together with the following affinity-purified antibodies: ‘L-MAG’, anti-L-MAG; ‘S-MAG’, anti-S-MAG; ‘Control’, second layer antibodies alone. The antibodies were diluted 1 : 1000 except for lane 1 with CNS myelin where the anti-L-MAG antibody was diluted 1 : 10 000 to avoid massive overstaining. Molecular mass markers in kDa.
was from a 75-year-old male autopsy case not included in Table 1. The cerebellum sections were counterstained with Mayer’s haemalum. The cauda equina tissue ŽFig. 5. was from the 83-year-old female case and the sural nerve specimen ŽFig. 6. was from the 69-year-old female case listed in Table 1.
3. Results 3.1. S-MAG cDNA fragment Reverse transcriptase PCR of brain RNA, using oligonucleotide primers specific for either side of the inferred alternative mRNA splice, produced bands of 401 and 446 bp which both hybridized to MAG cDNA probes Ždata not shown.. The sequence of the two cloned 401-bp fragments was identical to human L-MAG. The 446-bp clones contained the same sequence but for a 45-bp insert homologous to the mRNA splice in rodent S-MAG ŽFig. 1.. While this nucleotide sequence is identical in mouse and rat there are 6 differences in the human sequence which appear evenly spread. The invariant MAG open reading frame is extended by 10 residues followed by a stop codon like in rodents ŽFig. 1.. However, while the amino acids encoded by mouse and rat exon 12 are identical, 4 out of the 10
Fig. 4. Immunhistochemical detection of L- and S-MAG in human brain. Cryostat sections of human cerebellum from an autopsy without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-SMAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. The cell nuclei are counterstained with haemalum to show the tissue organization with two folds of granular layers and a white matter tract in between.
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
303
primers and an oligopeptide which was used to raise S-MAG-specific antibodies Žsee below..
S-MAG is weakly detectable in the CNS while it is more abundant in the PNS.
3.2. Quantification of L- and S-MAG mRNA
3.4. Immunohistochemical detection of L- and S-MAG
The primers used for the cloning of the L- and S-MAG cDNA fragments allow to detect and discriminate the two splice variants simultaneously. Preliminary reverse transcriptase PCR experiments indicated strong differences in the intensities of L- and S-MAG-specific bands, typically ) 10-fold. We therefore developed separate and quantitative assays for each MAG isoform. To design the L-MAG assay, it was necessary to use a PCR primer, BR, which bridges the inferred splice junction, the rest of the L-MAG cDNA being co-linear with S-MAG. Experiments with cloned L- and S-MAG cDNA indicated no crossreactivities between the two assays and, as there is at least one intron between the different priming sites used in each assay, amplification of genomic DNA would have resulted in distinct PCR products. In practice, in both assays only the MAG cDNA and MIMIC bands were seen ŽFig. 2.. In the CNS, we found consistently a considerable preponderance of L-MAG mRNA with a molar ratio of L to S-MAG transcripts in the range of 5–41 ŽTable 1.. In the PNS, the S-MAG transcripts were most abundant and the ratios of S- to L-MAG mRNA ranged from 6 to 18 in sural nerve, from 31 to 93 in femoral nerve and from 15 to 52 in cauda equina. For comparison of different tissue samples, the results were standardized to b-actin mRNA levels. This standardization results in estimates of L-MAG mRNA levels between 102 and 965 = higher in CNS than in samples of sural nerve while S-MAG mRNA levels differ much less, with corresponding ratios ranging from 0.6 to 4.9. In the 3 autopsies where femoral nerve could be sampled, the estimates of the relative abundance of mRNAs in CNS compared to PNS ranged from 280 to 1027 for L- and from 0.7 to 1.5 for S-MAG. The comparison of MAG mRNA levels in CNS and cauda equina was performed in only one autopsy resulting in ratios of 125 for L- and 1.8 for S-MAG.
Both anti-L- and S-MAG affinity-purified antibodies stain specifically myelinated structures in the CNS and the PNS. The anti-L-MAG antibody stains the CNS white
3.3. Western blot analysis of L- and S-MAG Initially, we verified that comparable high titers of anti-MAG peptide antisera had been obtained by using an ELISA assay and plates coated with the corresponding MAG peptides; similarly, we showed that the antisera reacted only with the oligopeptide which had been used for immunization Ždata not shown.. Both the antisera and the affinitiy-purified antibodies reacted specifically with the 100-kDa MAG protein and further experiments were performed using only the affinity-purified antibodies. By Western blot analysis, the anti-L-MAG antibody gives a very strong reaction with CNS myelin while in PNS myelin the reaction is much weaker ŽFig. 3.. In contrast,
Fig. 5. Immunhistochemical detection of MAG in human peripheral and central nervous systems. Cryostat sections of conus terminalis and outgrowing cauda equina spinal roots from an autopsy without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-S-MAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. The sections a–d allow a direct comparison between the CNS on the right Žconus terminalis. and the PNS on the left Žcauda equina spinal roots..
304
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
antibody manifestly stains all the MAG-positive structures identified using a monoclonal antibody directed against the extracellular domain MAG polypeptide ŽFig. 5a, Fig. 6e.. Both ringlike and punctate patterns can be observed with both antibodies. In contrast, there is no positive staining of cauda equina spinal roots with the anti-L-MAG antibody in Fig. 5b and, in general, L-MAG-positive fibres are seen only infrequently in the PNS ŽFig. 6f..
4. Discussion
Fig. 6. Immunhistochemical detection of MAG in sural nerve. Autopsy specimens without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-S-MAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. Periaxonal structures Žarrow heads. and Schmidt-Lanterman incisures Žarrows. were similarly stained using both the monoclonal anti-MAG antibodies and anti-S-MAG antibodies. The anti-L-MAG antibodies preferentially show a periaxonal staining on certain fibers Žarrows..
matter tracts with comparable intensity to a monoclonal anti-polypeptide anti-MAG antibody ŽFig. 4.. However, the reactivity of the anti-S-MAG antibody on cerebral white matter can not be clearly distinguished from background staining. Using immunofluorescence and higherpower magnification, L-MAG-positive, and rarely SMAG-positive, apparently myelinated fibres can be observed Ždata not shown.. In the PNS, the anti-S-MAG
The information on MAG mRNA splice variants has been mostly restricted to rodents where S-MAG increases with age and predominates both in the CNS and PNS of adult animals w6,10,12,26x. We have developed a specific assay to quantify in humans mRNA levels of L- and S-MAG transcripts and we have produced antibody reagents to detect these MAG isoforms in biochemical and immunohistological experiments. Our results in the CNS indicate a considerable discrepancy between the situation in rodents and in adult humans where, in contrast to rodents, L-MAG predominates over S-MAG at both the mRNA and protein levels. The human S-MAG cDNA fragments we have sequenced show that the 3X end of the S-MAG open reading frame and the length of the 45 base alternative splice are conserved in human compared to rodents. The 6 nucleotide differences between the alternative splice of rodent and human S-MAG result in an identity of 87% at the nucleotide level, a value which is similar to the overall identities in the coding sequences of rodent and human MAG. At the protein level the shared MAG domains are ) 94% identical. However, 4 out of 10 amino acids encoded by the spliced human S-MAG mRNA are different from those in rodents, a finding which is consistent with the hypothesis that the main function of the S-MAG mRNA splice may be to delete the L-MAG-specific functional domain by introducing a stop codon. The predicted amino-acid substitutions in human S-MAG are fairly conservative and would not be expected to change the general properties of the protein. In particular, the substitution of lysine for arginine in the human S-MAG remains compatible with a proposed internalization motif w1x. L-MAG also contains a putative internalization signal in addition to the one shared with S-MAG w1x. In contrast to S-MAG, the L-MAG-specific intracellular domain is highly conserved both at the nucleotide and amino-acid levels suggesting considerable functional constraints during phylogeny. An important conserved function, possibly involving a tyrosine phosphorylation site, may be associated with the 8 C-terminal residues of L-MAG which are identical in rodent and human MAG as well as in a distinct but related protein in chicken myelin called SMP w5x. Our analysis of MAG isoform mRNA levels in different tissues showed consistently very pronounced differences
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
with a marked preponderance of L-MAG in CNS and of S-MAG in PNS ŽTable 1.. In rodents, the ratio of L- to S-MAG has been reported to decrease with age due to increasing S-MAG expression both at the mRNA and protein levels w10x. Our results would suggest that in human CNS this decrease may proceed throughout old age. To substantiate this observation, it will be necessary to study a larger sample size with a wider age distribution. The ratios of the MAG splice variant mRNA levels in a particular cDNA sample are independent of b-actin mRNA measurements. The latter were used to compare mRNA levels in different tissue samples. For example, the up to 15-fold higher S- to L-MAG ratios in femoral nerve compared to sural nerve ŽTable 1. seem to be due to higher S-MAG mRNA concentrations in femoral nerve when the b-actin standardized results are taken into account Ždata not shown.. The b-actin standardization also results in estimates of up to 1000-fold higher L-MAG mRNA levels in CNS than in PNS while S-MAG mRNA levels are fairly similar in CNS and PNS ŽTable 1.. The b-actin mRNA levels also result from contributions of non-myelinated tissues and may thus account for the variation of CNS to PNS ratios seen in different individuals. Our results at the protein level also indicate considerably higher levels of L-MAG in the CNS than in the PNS while there is distinctly more S-MAG in PNS than in CNS myelin. This finding is in good agreement with the observations at the mRNA level considering that for biochemical analysis we used purified myelin preparations which, in the case of the PNS, represent a marked enrichment of myelinated tissue when compared to the extracts used for RNA analysis. The immunohistological results obtained with the L-MAG antibody in CNS are essentially identical to the staining obtained with a monoclonal antibody which recognizes a common MAG determinant. The L-MAG staining in spinal cord corresponds largely to the pattern observed in rodents w1,11x. In the PNS, it is the staining obtained with the S-MAG antibody which closely resembles that produced by this monoclonal antibody. L- and S-MAG antibodies would therefore seem to have fairly comparable histological staining properties. In contrast, these antibodies perform very differently in Western blot assays and we have not attempted a formal comparison between the protein levels of L- and S-MAG. Nevertheless, the data obtained with the isoform-specific antibodies appear to support the pattern observed at the mRNA levels. By comparison of transverse and longitudinal nerve sections stained with the monoclonal anti-MAG antibody, we have previously presented evidence that structures with MAG-positive concentric rings which we can also observe with the anti-S-MAG antibody correspond to SchmidtLanterman incisures w8x. Such ringed S-MAG-positive patterns were more prominent in the femoral Žmixed sensory and motor. than in the sural Žpure sensory. nerves Ždata not shown.. These observations would be consistent with our finding of relatively more S-MAG mRNA in femoral
305
than in sural nerve because the former is known to contain thicker myelinated fibres with more numerous SchmidtLanterman incisures w9x. Immunofluorescence and ultrastructural studies will be required to characterize the relatively infrequent L-MAG-positive structures in the PNS and the S-MAG-positive fibres in the CNS. Conceivably, the two MAG isoforms may have specialized functions in the homeostasis of uncompacted myelin membranes. Our analysis of MAG isoforms in adult humans suggests that L-MAG-mediated signalling may be of particular importance in adult human oligodendrocytes. Our results also mean that animal experiments are not predictive for the situation in humans. Studies in humans may thus contribute to understanding the different roles of L- and S-MAG.
Acknowledgements We thank A. Probst, University of Basel, for autopsy samples, and C. Schaefer, J.-M. Gabriel, M. Markus and G. Olivieri for help and advice. This work was supported by the Swiss Multiple Sclerosis Society and Grants 3132306.91 and 31-043360.95 from the Swiss Nationalfonds.
References w1x L. Bo, ¨ R.H. Quarles, N. Fujita, Z. Bartoszewicz, S. Sato, B.D. Trapp, Endocytic depletion of L-MAG from CNS myelin in quaking mice, J. Cell Biol. 131 Ž1995. 1811–1820. w2x P.E. Braun, D.E. Frail, N. Latov, Myelin-associated glycoprotein is the antigen for a monoclonal IgM in polyneuropathy, J. Neurochem. 39 Ž1982. 1261–1265. w3x D. Burger, M. Simon, G. Perruisseau, A.J. Steck, The epitopeŽs. recognized by HNK-1 antibody and IgM paraprotein in neuropathy is present on several N-linked oligosaccharide structures on human P0 and myelin-associated glycoprotein, J. Neurochem. 54 Ž1990. 1569–1575. w4x P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 Ž1987. 156–159. w5x C. Dulac, M.B. Tropak, P. Cameron-Curry, J. Rossier, D.R. Marshak, J. Roder, N.M. Le Douarin, Molecular characterization of the Schwann cell myelin protein, SMP: structural similarities within the immunoglobulin superfamily, Neuron 8 Ž1992. 323–334. w6x D.E. Frail, P.E. Braun, Two developmentally regulated messenger RNAs differing in their coding region may exist for the myelin-associated glycoprotein, J. Biol. Chem. 259 Ž1984. 14857–14862. w7x M. Fruttiger, D. Montag, M. Schachner, R. Martini, Crucial role for the myelin-associated glycoprotein in the maintenance of axonmyelin integrity, Eur. J. Neurosci. 7 Ž1995. 511–515. w8x J.-M. Gabriel, B. Erne, G.C. Miescher, S.L. Miller, A. Vital, C. Vital, A.M. Steck, Selective loss of myelin-associated glycoprotein from myelin correlates with anti-MAG antibody titre in demyelinating paraproteinaemic polyneuropathy, Brain 119 Ž1996. 775–787. w9x M.N. Ghabriel, G. Allt, Incisures of Schmidt-Lanterman, Prog. Neurobiol. 17 Ž1981. 25–58. w10x T. Inuzuka, N. Fujita, S. Sato, H. Baba, R. Nakano, H. Ishiguro, T. Miyatake, Expression of the large myelin-associated glycoprotein isoform during the development in the mouse peripheral nervous system, Brain Res. 562 Ž1991. 173–175.
306
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
w11x H. Ishiguro, S. Sato, N. Fujita, T. Inuzuka, R. Nakano, T. Miyatake, Immunohistochemical localization of myelin-associated glycoprotein isoforms during the development in the mouse brain, Brain Res. 563 Ž1991. 288–292. w12x S. Kelm, A. Pelz, R. Schauer, M.T. Filbin, S. Tang, M.E. de-Bellard, R.L. Schnaar, J.A. Mahoney, A. Hartnell, P. Bradfield et al., Sialoadhesin, myelin-associated glycoprotein and CD22 define a new family of sialic acid-dependent adhesion molecules of the immunoglobulin superfamily, Curr. Biol. 4 Ž1994. 965–972. w13x C. Lai, M.A. Brow, K.A. Nave, A.B. Noronha, R.H. Quarles, F.E. Bloom, R.J. Milner, J.G. Sutcliffe, Two forms of 1B236rmyelin-associated glycoprotein, a cell adhesion molecule for postnatal neural development, are produced by alternative splicing, Proc. Natl. Acad. Sci. USA 84 Ž1987. 4337–4341. w14x W. Lesniak, C. Schaefer, S. Grueninger, M. Chiesi, Effect of a-adrenergic stimulation and carnitine palmitoyl transferase I inhibition on hypertrophying adult rat cardiomyocytes in culture, Mol. Cell. Biochem. 142 Ž1995. 25–34. w15x C. Li, Myelination in the absence of myelin-associated glycoprotein, Nature 369 Ž1994. 747–750. w16x D. Montag, Mice deficient for the myelin-associated glycoprotein show subtle abnormalities in myelin, Neuron 13 Ž1994. 229–246. w17x P. Ponte, S.Y. Ng, J. Engel, P. Gunning, L. Kedes, Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human b-actin cDNA, Nucleic Acids Res. 12 Ž1984. 1687–1696. w18x S. Sato, N. Fujita, T. Kurihara, R. Kuwano, K. Sakimura, Y. Takahashi, T. Miyatake, cDNA cloning and amino acid sequence for human myelin-associated glycoprotein, Biochem. Biophys. Res. Commun. 163 Ž1989. 1473–1480.
w19x P. Siebert, J. Larrick, PCR MIMICs: competitive DNA fragments for use as internal standards in quantitative PCR, BioTechniques 14 Ž1993. 244–249. w20x G. Spagnol, M. Williams, J. Srinivasan, J. Golier, D. Bauer, R.V. Lebo, N. Latov, Molecular cloning of human myelin-associated glycoprotein, J. Neurosci. Res. 24 Ž1989. 137–142. w21x A.J. Steck, N. Murray, C. Meier, N. Page, G. Perruisseau, Demyelinating neuropathy and monoclonal IgM antibody to myelin-associated glycoprotein, Neurology 33 Ž1983. 19–23. w22x A.H. Tatum, Experimental paraprotein neuropathy, demyelination by passive transfer of human IgM anti-myelin-associated glycoprotein, Ann. Neurol. 33 Ž1993. 502–506. w23x B.D. Trapp, S.B. Andrews, C. Cootauco, R. Quarles, The myelin-associated glycoprotein is enriched in multivesicular bodies and periaxonal membranes of actively myelinating oligodendrocytes, J. Cell. Biol. 109 Ž1989. 2417–2426. w24x B.D. Trapp, R.H. Quarles, Presence of the myelin-associated glycoprotein correlates with alterations in the periodicity of peripheral myelin, J. Cell Biol. 92 Ž1982. 877–882. w25x B.D. Trapp, R.H. Quarles, K. Suzuki, Immunocytochemical studies of quaking mice support a role for the myelin-associated glycoprotein in forming and maintaining the periaxonal space and periaxonal cytoplasmic collar of myelinating Schwann cells, J. Cell Biol. 99 Ž1984. 594–606. w26x M.B. Tropak, P.W. Johnson, R.J. Dunn, J.C. Roder, Differential splicing of MAG transcripts during CNS and PNS development, Brain Res. 464 Ž1988. 143–155. w27x H. Umemori, S. Sato, T. Yagi, S. Aizawa, T. Yamamoto, Initial events of myelination involve Fyn tyrosine kinase signalling, Nature 367 Ž1994. 572–576.
Research report
Reciprocal expression of myelin-associated glycoprotein splice variants in the adult human peripheral and central nervous systems 1 2 Guido C. Miescher ) , Roland Lutzelschwab , Beat Erne, Fabrizia Ferracin, Susanne Huber, ¨ Andreas J. Steck Departments of Clinical Neurology and Research, UniÕersity Hospitals, CH-4031 Basle, Switzerland Accepted 22 July 1997
Abstract The L- and S-MAG isoforms differ only at their C-terminus and are believed to be functionally distinct. To obtain information on the relative expression of these alternatively spliced isoforms in humans, we cloned an S-MAG cDNA fragment. The deduced amino-acid sequence of the human S-MAG C-terminus shows fairly conservative substitutions of 4 out of the 10 residues compared to the rodent peptide. Using reverse transcription and a competitive polymerase chain reaction, we show that, in contrast to rodents, the L-MAG splice variant predominates in adult human brain while, like in rodents, S-MAG transcripts are most abundant in peripheral nerve. The results obtained by Western blot analysis and immunohistochemistry are in good agreement with the findings at the mRNA level. Animal experiments may thus be more representative for the role of MAG in human nerve than in brain. q 1997 Elsevier Science B.V. Keywords: Myelin-associated glycoprotein; L-MAG; S-MAG; Competitive PCR; Immunohistochemistry
1. Introduction Myelin-associated glycoprotein ŽMAG., a major glycoprotein in uncompacted myelin w24x, is the principal target in an autoimmune demyelinating peripheral neuropathy w2,21,22x. A characteristic feature of this chronic disease is the anti-MAG autoantibody dependent and selective loss of MAG in peripheral myelin w8x. The lack of MAG in myelin may be deleterious for long-term myelin stability as suggested by the observation of a demyelinating neuropathy in aged transgenic mice with deleted MAG genes w7x. However, definitive information on the role of MAG remains sparse, especially in humans. MAG belongs to the sialoadhesin family of multiple immunoglobulin domain proteins and binds to as yet unde-
Abbreviations: PCR, polymerase chain reaction; CNS, central nervous system; PNS, peripheral nervous system. ) Corresponding author. Fax: q41 Ž61. 265-2350; E-mail: [email protected] 1 The nucleotide sequence of the human S-MAG cDNA fragment has been made available in the EMBL Nucleotide Sequence Database under the accession number: X98405. 2 Contributed the majority of experimental data as part of his PhD thesis work. 0169-328Xr97r$17.00 q 1997 Elsevier Science B.V. All rights reserved. PII S 0 1 6 9 - 3 2 8 X Ž 9 7 . 0 0 2 5 4 - 4
fined sialylated glycans on the axolemma w12x. MAG is located in the periaxonal membranes of oligodendrocytes and Schwann cells w25x and one of its functions may be maintaining the spacing of these membranes towards the compact myelin on the cytoplasmic side and towards the axolemma on the extracellular side w15,16x. In the peripheral but not in the central nervous system ŽPNS, CNS., MAG is also found in other areas of uncompacted myelin, such as the Schmidt-Lanterman incisures and the paranodal loops, where its function is still unknown w24x. There is considerable evidence showing that MAG can be removed from the cell surface by receptor-mediated endocytosis, a process that may be a prerequisite for compaction of myelin membranes w23x. An important determinant of MAG internalization is the intracellular domain which differs in the L- and S-MAG isoforms. The preferential internalization of L-MAG from periaxonal membranes at the time of active myelination w1x may also involve tyrosine kinase signalling, as L- but not S-MAG can activate the Fyn intracellular tyrosine kinase w27x. Biochemical experiments have indicated that there are 2 MAG isoforms with a polypeptide backbone of 70 and 67 kDa w6x. The L- and S-MAG isoforms are the products of alternatively spliced mRNAs and in rodents S-, or ‘small’ MAG lacks 54 C-terminal amino acids of L, or ‘large’
300
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
MAG. S-MAG has a different C-terminus due to a alternative mRNA splice containing 10 in-frame codons followed by a stop codon w13x. L- and S-MAG have identical extracellular, transmembrane and juxtamembrane cytoplasmic regions. The latter regions spans 35 amino acids without homology to other protein domains in the data bases and it is less well conserved between rodents and human than the extracellular domain of MAG. Only human L-MAG cDNA clones have been reported w18,20x and the relative abundance in the human nervous system of the two alternatively spliced MAG transcripts is not known. Also, there are no antibodies specific for human S-MAG. We provide here this information and show that there are significant differences between the situation in rodents and in humans.
2. Materials and methods 2.1. cDNA cloning and polymerase chain reaction With the approval of the ethics committee of the Department of Pathology, sural nerve, femoral nerve, cauda equina and brain samples were obtained from autopsies without neurological disease and stored at y808C until needed. Material from CNS and PNS was obtained in 3 cases, in 3 more cases only tissue of either CNS or PNS was available. Total RNA was extracted using the acid phenol method with minor modifications w4x. Alternatively, mRNA was selected using oligo-ŽdT. Dynabeads as recommended by the manufacturer ŽDynal, NY.. Following reverse transcription ŽGibco-BRL, Gaithersburg, MD. using oligo-dT20 ŽPharmacia Biotech, Piscataway, NJ., the cDNA was amplified using the polymerase chain reaction ŽPCR. in conjunction with different sets of HPLC-purified oligonucleotide primers ŽMWG-Biotech, Ebersberg, Germany.: AF TGCCATCGTCTGCTACATTACCC and AR GCCCAGCCCCCGATACTTTTG, i.e. positions 1701– 1724 and 2081–2101 on human L-MAG Žaccession number M29273. w18x; BF TCCTGTCCACGGTCATCTACG and BR CAGGCGCCTCTCGCTCTCG, i.e. positions 1214–1235 and 1833–1852 on human L-MAG; CF TGGAATCTCACTGAGTGCCCC, positions 156–176 on our MAG cDNA fragment Žaccession number X98405, this report.; and DF CACCCACACTGTGCCCATC and DR CTAGAAGCATTTGCGGTGGAC, i.e. positions 518–536 and 1148–1169 on human b-actin w17x. Initially, the PCR using buffers and Taq DNA polymerase from Gibco-BRL with primers A5X and A3X was used to amplify MAG cDNA fragments derived from a human brain total RNA sample. The PCR products were purified by agarose gel electrophoresis and cloned into pCRII TA plasmids ŽInvitrogen, San Diego, CA. as recommended by the manufacturer. Two plasmids with inserts of 401 and two plasmids with 446-bp inserts were sequenced on both strands by the chain termination method ŽSequenase
2.0, USB, Cleveland, OH. using sequencing primers specific for the T7 and SP6 RNA polymerase promoters. Sequence analysis and alignments were done using the GCG software Package, Version 7 ŽGenetics Computer Group, Madison, WI.. Optimal amounts of cDNA were used in a competitive PCR assay as previously described w14x. Briefly, this procedure amplifies selected MAG cDNA fragments together with a synthetic DNA template called MIMIC. The MIMIC contains an indifferent sequence, in our case a human IgL chain cDNA fragment of 748 bp, which is flanked by the specific priming sites. The MIMIC templates were produced by starting with an IgL chain cDNA template and an initial 10 cycles of PCR using composite primers corresponding to the above MAG primers with 3X extensions complementary to the ends of the IgL chain fragment. This artificial template was then further amplified using the MAG primers alone, ethanol precipitated and quantified by measuring the optical density at 260 nm. For competitive PCR assays, triplicate dilutions of mRNA-derived cDNA were mixed with constant amounts of MIMIC DNA, typically 1 = 10y2 0 Mol Žs 0.001 atMol., ensuring that some of the amounts of amplified MAG cDNA fragments were below and others above the point of molar equivalence with the amplified MIMIC DNA. After 40 cycles of amplification, the PCR products were electrophoresed in agarose gels pre-stained with ethidium bromide Ž0.5 m grml., recorded using a cooled CCD video camera ŽCS1 Image Documentation System, Cybertech, Berlin, Germany. and quantified using Wincam 2.2. software ŽCybertech.. Molar concentrations of MAG-specific cDNA were calculated using double logarithmic plotting of the input cDNA volumes and the molar ratio of the amplified MAG and MIMIC PCR products. We have verified that the PCR reactions allowed for a reproducible quantification even when prolonged into the plateau phase w19x. The maximal variability of the reverse transcription and MIMIC PCR procedure was 40% from the mean. 2.2. Antipeptide L- and S-MAG antibodies, protein preparation and Western blot analysis A human C-terminal S-MAG peptide, CG GSKEVSTLESH, was maleimide coupled to edestin and HPLC-purified ŽBioTools, Denzlingen, Germany. and an L-MAG peptide close to its C-terminus, LTEELAEYAEIRV, was coupled to keyhole lympet hemocyanine ŽCalbiochem, San Diego, CA. with glutaraldehyde. New Zealand White rabbits were immunized s.c. with 500 m g protein in complete Freund’s adjuvans and boosted 3 = with 100 mg protein in incomplete Freund’s adjuvans. The hyperimmune sera were purified by affinity chromatography on Affigel 15-coupled peptide according to the manufacturer’s instructions ŽBio-Rad, Hercules, CA.. The antibodies were eluted with 0.1 M glycine pH 2.5, neutralised with Tris pH. 8.0, dialysed into PBS and concentrated
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
301
Table 1 Relative distribution of L- and S-MAG mRNA in human CNS and PNS Sex
Age
Male Female Male Male Female Male
65 69 79 80 83 95
a
CNS L r S -MAG
b
PNS S r L -MAG
b
L-MAG CNS r PNS
c
S-MAG CNS r PNS
c
41 Žw. 16 Žw. 17 Žw. 5 Žw.
6 Žs. 13 Žs.; 93 Žf. 52 Žc. 9 Žs.; 31 Žf. 18 Žs.; 45 Žf.; 15 Žc.
965 Žs.; 1027 Žf.
4.9 Žs.; 0.7 Žf.
102 Žs.; 827 Žf. 325 Žs.; 280 Žf.; 125 Žc.
0.6 Žs.; 1.5 Žf. 3.8 Žs.; 1.3 Žf.; 1.8 Žc.
a
Age at autopsy. Mean ratios of L- to S-MAG or S- to L-MAG transcripts based on triplicate competitive quantitative PCRs. c Ratios of L-MAG or S-MAG transcripts in CNS compared to PNS. The MAG mRNA levels were standardized using ß-actin mRNA levels determined by competitive quantitative PCR. s s sural nerve; f s femoral nerve; c s cauda equina; w s white matter from frontal lobe. b
before storing at y708C. Human myelin from a 75-year-old autopsy case not included in Table 1 was isolated from cauda equina and frontal lobe white matter by discontinuous sucrose gradient centrifugation as described w3x. Proteins were quantified by Bradford assay and 20 m g loaded per lane on reducing 10% SDS-polyacrylamide gels. Following electrophoresis, samples were electrotransferred onto nitrocellulose membranes ŽSchleicher and Schuell, Keene, NH. and stained with Ponceau S to verify the amount of protein loaded per lane. The blots were blocked with phosphate-buffered saliner0.15% casein overnight at 48C. They were incubated at room temperature for 2 h with the affinity-purified antibody and for 2 h with horseradish peroxidase-labelled goat anti-rabbit IgG ŽNordic, Tilburg, The Netherlands. in blocking buffer Ž1.5 mgrml casein, 0.2% Tween-20 in phosphate-buffered saline.. Detection was by chemoluminescence ŽECL system, Amersham Life Science, Arlington Heights, IL.. The ECL films were scanned at 400 dpi with a Canon CLC 10 and processed using the Adobe Photoshop Version 2.5.1 software ŽAdobe Systems, Mountain View, CA..
bated successively with affinity-purified rabbit antibodies and peroxidase-labelled goat anti-rabbit IgG ŽSigma Biosciences, St. Louis, MO.. For comparison, we used an anti-MAG extracellular domain monoclonal antibody, D3A2G5, w3x together with a goat anti-mouse IgG second layer antibody ŽSigma Biosciences.. The staining of the sections was performed using the peroxidase substrate 3-amino-9-ethylcarbazole. The cerebellum sample ŽFig. 4.
2.3. Immunohistochemistry Cryostat sections Ž8 m m thick. of human tissues were mounted on gelatin-chromalum-coated slides, fixed with 10% vrv buffered formalin for 2 h. Endogenous peroxidase activity was blocked in 80% methanol, 0.6% H 2 O 2 for 20 min at room temperature. The sections were incu-
Fig. 1. Comparison between rodent and human S-MAG-specific cDNA and protein sequences. The nucleotide sequences shown are the rodent alternative splice corresponding to MAG exon 12 and the homologous spliced cDNA sequence in human. The mouse and rat nucleotide sequences are 100% identical. The differences are indicated in bold and underlined; the stop codon is in bold. The amino-acid translations are given in single-letter code and the differing residues are in bold and doubly underlined, ) indicates the S-MAG C-terminus.
Fig. 2. Competitive PCR analysis of L- and S-MAG mRNA in the CNS and PNS. The representative agarose gels stained with ethidium bromide show PCR products obtained with mRNA from reverse-transcribed CNS white matter Žtop 2 gels. or PNS, i.e. sural nerve Žbottom 2 gels.. For each PCR, a constant amount of MIMIC heterologous internal standard DNA and appropriate oligonucleotide primers have been used. The arrows indicate the approximate cDNA dilutions where equimolar amounts of MIMIC and MAG cDNA have been amplified.
302
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
amino acids in the homologous sequence in human are different. With the exception of the arginine to leucine substitution ŽFig. 1., the general properties of the substituted residues are maintained. With the information on the S-MAG splice, we designed S- and L-MAG-specific PCR
Fig. 3. Western blot analysis of CNS and PNS myelin with anti-L- and anti-S-MAG affinity-purified antibodies. Nitrocellulose blots with 20 m g protein of either CNS or PNS myelin in each lane were used together with the following affinity-purified antibodies: ‘L-MAG’, anti-L-MAG; ‘S-MAG’, anti-S-MAG; ‘Control’, second layer antibodies alone. The antibodies were diluted 1 : 1000 except for lane 1 with CNS myelin where the anti-L-MAG antibody was diluted 1 : 10 000 to avoid massive overstaining. Molecular mass markers in kDa.
was from a 75-year-old male autopsy case not included in Table 1. The cerebellum sections were counterstained with Mayer’s haemalum. The cauda equina tissue ŽFig. 5. was from the 83-year-old female case and the sural nerve specimen ŽFig. 6. was from the 69-year-old female case listed in Table 1.
3. Results 3.1. S-MAG cDNA fragment Reverse transcriptase PCR of brain RNA, using oligonucleotide primers specific for either side of the inferred alternative mRNA splice, produced bands of 401 and 446 bp which both hybridized to MAG cDNA probes Ždata not shown.. The sequence of the two cloned 401-bp fragments was identical to human L-MAG. The 446-bp clones contained the same sequence but for a 45-bp insert homologous to the mRNA splice in rodent S-MAG ŽFig. 1.. While this nucleotide sequence is identical in mouse and rat there are 6 differences in the human sequence which appear evenly spread. The invariant MAG open reading frame is extended by 10 residues followed by a stop codon like in rodents ŽFig. 1.. However, while the amino acids encoded by mouse and rat exon 12 are identical, 4 out of the 10
Fig. 4. Immunhistochemical detection of L- and S-MAG in human brain. Cryostat sections of human cerebellum from an autopsy without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-SMAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. The cell nuclei are counterstained with haemalum to show the tissue organization with two folds of granular layers and a white matter tract in between.
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
303
primers and an oligopeptide which was used to raise S-MAG-specific antibodies Žsee below..
S-MAG is weakly detectable in the CNS while it is more abundant in the PNS.
3.2. Quantification of L- and S-MAG mRNA
3.4. Immunohistochemical detection of L- and S-MAG
The primers used for the cloning of the L- and S-MAG cDNA fragments allow to detect and discriminate the two splice variants simultaneously. Preliminary reverse transcriptase PCR experiments indicated strong differences in the intensities of L- and S-MAG-specific bands, typically ) 10-fold. We therefore developed separate and quantitative assays for each MAG isoform. To design the L-MAG assay, it was necessary to use a PCR primer, BR, which bridges the inferred splice junction, the rest of the L-MAG cDNA being co-linear with S-MAG. Experiments with cloned L- and S-MAG cDNA indicated no crossreactivities between the two assays and, as there is at least one intron between the different priming sites used in each assay, amplification of genomic DNA would have resulted in distinct PCR products. In practice, in both assays only the MAG cDNA and MIMIC bands were seen ŽFig. 2.. In the CNS, we found consistently a considerable preponderance of L-MAG mRNA with a molar ratio of L to S-MAG transcripts in the range of 5–41 ŽTable 1.. In the PNS, the S-MAG transcripts were most abundant and the ratios of S- to L-MAG mRNA ranged from 6 to 18 in sural nerve, from 31 to 93 in femoral nerve and from 15 to 52 in cauda equina. For comparison of different tissue samples, the results were standardized to b-actin mRNA levels. This standardization results in estimates of L-MAG mRNA levels between 102 and 965 = higher in CNS than in samples of sural nerve while S-MAG mRNA levels differ much less, with corresponding ratios ranging from 0.6 to 4.9. In the 3 autopsies where femoral nerve could be sampled, the estimates of the relative abundance of mRNAs in CNS compared to PNS ranged from 280 to 1027 for L- and from 0.7 to 1.5 for S-MAG. The comparison of MAG mRNA levels in CNS and cauda equina was performed in only one autopsy resulting in ratios of 125 for L- and 1.8 for S-MAG.
Both anti-L- and S-MAG affinity-purified antibodies stain specifically myelinated structures in the CNS and the PNS. The anti-L-MAG antibody stains the CNS white
3.3. Western blot analysis of L- and S-MAG Initially, we verified that comparable high titers of anti-MAG peptide antisera had been obtained by using an ELISA assay and plates coated with the corresponding MAG peptides; similarly, we showed that the antisera reacted only with the oligopeptide which had been used for immunization Ždata not shown.. Both the antisera and the affinitiy-purified antibodies reacted specifically with the 100-kDa MAG protein and further experiments were performed using only the affinity-purified antibodies. By Western blot analysis, the anti-L-MAG antibody gives a very strong reaction with CNS myelin while in PNS myelin the reaction is much weaker ŽFig. 3.. In contrast,
Fig. 5. Immunhistochemical detection of MAG in human peripheral and central nervous systems. Cryostat sections of conus terminalis and outgrowing cauda equina spinal roots from an autopsy without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-S-MAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. The sections a–d allow a direct comparison between the CNS on the right Žconus terminalis. and the PNS on the left Žcauda equina spinal roots..
304
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
antibody manifestly stains all the MAG-positive structures identified using a monoclonal antibody directed against the extracellular domain MAG polypeptide ŽFig. 5a, Fig. 6e.. Both ringlike and punctate patterns can be observed with both antibodies. In contrast, there is no positive staining of cauda equina spinal roots with the anti-L-MAG antibody in Fig. 5b and, in general, L-MAG-positive fibres are seen only infrequently in the PNS ŽFig. 6f..
4. Discussion
Fig. 6. Immunhistochemical detection of MAG in sural nerve. Autopsy specimens without neurological diseases were stained with: Ža. monoclonal anti-MAG antibody ŽD 3 A 2 G5 . to the extracellular part of the molecule; Žb. affinity-purified anti-L-MAG antibody to the C-terminal part of the molecule; Žc. anti-S-MAG antibody; and Žd. 2nd layer anti-rabbit peroxidase-labelled antibodies alone as negative control. Periaxonal structures Žarrow heads. and Schmidt-Lanterman incisures Žarrows. were similarly stained using both the monoclonal anti-MAG antibodies and anti-S-MAG antibodies. The anti-L-MAG antibodies preferentially show a periaxonal staining on certain fibers Žarrows..
matter tracts with comparable intensity to a monoclonal anti-polypeptide anti-MAG antibody ŽFig. 4.. However, the reactivity of the anti-S-MAG antibody on cerebral white matter can not be clearly distinguished from background staining. Using immunofluorescence and higherpower magnification, L-MAG-positive, and rarely SMAG-positive, apparently myelinated fibres can be observed Ždata not shown.. In the PNS, the anti-S-MAG
The information on MAG mRNA splice variants has been mostly restricted to rodents where S-MAG increases with age and predominates both in the CNS and PNS of adult animals w6,10,12,26x. We have developed a specific assay to quantify in humans mRNA levels of L- and S-MAG transcripts and we have produced antibody reagents to detect these MAG isoforms in biochemical and immunohistological experiments. Our results in the CNS indicate a considerable discrepancy between the situation in rodents and in adult humans where, in contrast to rodents, L-MAG predominates over S-MAG at both the mRNA and protein levels. The human S-MAG cDNA fragments we have sequenced show that the 3X end of the S-MAG open reading frame and the length of the 45 base alternative splice are conserved in human compared to rodents. The 6 nucleotide differences between the alternative splice of rodent and human S-MAG result in an identity of 87% at the nucleotide level, a value which is similar to the overall identities in the coding sequences of rodent and human MAG. At the protein level the shared MAG domains are ) 94% identical. However, 4 out of 10 amino acids encoded by the spliced human S-MAG mRNA are different from those in rodents, a finding which is consistent with the hypothesis that the main function of the S-MAG mRNA splice may be to delete the L-MAG-specific functional domain by introducing a stop codon. The predicted amino-acid substitutions in human S-MAG are fairly conservative and would not be expected to change the general properties of the protein. In particular, the substitution of lysine for arginine in the human S-MAG remains compatible with a proposed internalization motif w1x. L-MAG also contains a putative internalization signal in addition to the one shared with S-MAG w1x. In contrast to S-MAG, the L-MAG-specific intracellular domain is highly conserved both at the nucleotide and amino-acid levels suggesting considerable functional constraints during phylogeny. An important conserved function, possibly involving a tyrosine phosphorylation site, may be associated with the 8 C-terminal residues of L-MAG which are identical in rodent and human MAG as well as in a distinct but related protein in chicken myelin called SMP w5x. Our analysis of MAG isoform mRNA levels in different tissues showed consistently very pronounced differences
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
with a marked preponderance of L-MAG in CNS and of S-MAG in PNS ŽTable 1.. In rodents, the ratio of L- to S-MAG has been reported to decrease with age due to increasing S-MAG expression both at the mRNA and protein levels w10x. Our results would suggest that in human CNS this decrease may proceed throughout old age. To substantiate this observation, it will be necessary to study a larger sample size with a wider age distribution. The ratios of the MAG splice variant mRNA levels in a particular cDNA sample are independent of b-actin mRNA measurements. The latter were used to compare mRNA levels in different tissue samples. For example, the up to 15-fold higher S- to L-MAG ratios in femoral nerve compared to sural nerve ŽTable 1. seem to be due to higher S-MAG mRNA concentrations in femoral nerve when the b-actin standardized results are taken into account Ždata not shown.. The b-actin standardization also results in estimates of up to 1000-fold higher L-MAG mRNA levels in CNS than in PNS while S-MAG mRNA levels are fairly similar in CNS and PNS ŽTable 1.. The b-actin mRNA levels also result from contributions of non-myelinated tissues and may thus account for the variation of CNS to PNS ratios seen in different individuals. Our results at the protein level also indicate considerably higher levels of L-MAG in the CNS than in the PNS while there is distinctly more S-MAG in PNS than in CNS myelin. This finding is in good agreement with the observations at the mRNA level considering that for biochemical analysis we used purified myelin preparations which, in the case of the PNS, represent a marked enrichment of myelinated tissue when compared to the extracts used for RNA analysis. The immunohistological results obtained with the L-MAG antibody in CNS are essentially identical to the staining obtained with a monoclonal antibody which recognizes a common MAG determinant. The L-MAG staining in spinal cord corresponds largely to the pattern observed in rodents w1,11x. In the PNS, it is the staining obtained with the S-MAG antibody which closely resembles that produced by this monoclonal antibody. L- and S-MAG antibodies would therefore seem to have fairly comparable histological staining properties. In contrast, these antibodies perform very differently in Western blot assays and we have not attempted a formal comparison between the protein levels of L- and S-MAG. Nevertheless, the data obtained with the isoform-specific antibodies appear to support the pattern observed at the mRNA levels. By comparison of transverse and longitudinal nerve sections stained with the monoclonal anti-MAG antibody, we have previously presented evidence that structures with MAG-positive concentric rings which we can also observe with the anti-S-MAG antibody correspond to SchmidtLanterman incisures w8x. Such ringed S-MAG-positive patterns were more prominent in the femoral Žmixed sensory and motor. than in the sural Žpure sensory. nerves Ždata not shown.. These observations would be consistent with our finding of relatively more S-MAG mRNA in femoral
305
than in sural nerve because the former is known to contain thicker myelinated fibres with more numerous SchmidtLanterman incisures w9x. Immunofluorescence and ultrastructural studies will be required to characterize the relatively infrequent L-MAG-positive structures in the PNS and the S-MAG-positive fibres in the CNS. Conceivably, the two MAG isoforms may have specialized functions in the homeostasis of uncompacted myelin membranes. Our analysis of MAG isoforms in adult humans suggests that L-MAG-mediated signalling may be of particular importance in adult human oligodendrocytes. Our results also mean that animal experiments are not predictive for the situation in humans. Studies in humans may thus contribute to understanding the different roles of L- and S-MAG.
Acknowledgements We thank A. Probst, University of Basel, for autopsy samples, and C. Schaefer, J.-M. Gabriel, M. Markus and G. Olivieri for help and advice. This work was supported by the Swiss Multiple Sclerosis Society and Grants 3132306.91 and 31-043360.95 from the Swiss Nationalfonds.
References w1x L. Bo, ¨ R.H. Quarles, N. Fujita, Z. Bartoszewicz, S. Sato, B.D. Trapp, Endocytic depletion of L-MAG from CNS myelin in quaking mice, J. Cell Biol. 131 Ž1995. 1811–1820. w2x P.E. Braun, D.E. Frail, N. Latov, Myelin-associated glycoprotein is the antigen for a monoclonal IgM in polyneuropathy, J. Neurochem. 39 Ž1982. 1261–1265. w3x D. Burger, M. Simon, G. Perruisseau, A.J. Steck, The epitopeŽs. recognized by HNK-1 antibody and IgM paraprotein in neuropathy is present on several N-linked oligosaccharide structures on human P0 and myelin-associated glycoprotein, J. Neurochem. 54 Ž1990. 1569–1575. w4x P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 Ž1987. 156–159. w5x C. Dulac, M.B. Tropak, P. Cameron-Curry, J. Rossier, D.R. Marshak, J. Roder, N.M. Le Douarin, Molecular characterization of the Schwann cell myelin protein, SMP: structural similarities within the immunoglobulin superfamily, Neuron 8 Ž1992. 323–334. w6x D.E. Frail, P.E. Braun, Two developmentally regulated messenger RNAs differing in their coding region may exist for the myelin-associated glycoprotein, J. Biol. Chem. 259 Ž1984. 14857–14862. w7x M. Fruttiger, D. Montag, M. Schachner, R. Martini, Crucial role for the myelin-associated glycoprotein in the maintenance of axonmyelin integrity, Eur. J. Neurosci. 7 Ž1995. 511–515. w8x J.-M. Gabriel, B. Erne, G.C. Miescher, S.L. Miller, A. Vital, C. Vital, A.M. Steck, Selective loss of myelin-associated glycoprotein from myelin correlates with anti-MAG antibody titre in demyelinating paraproteinaemic polyneuropathy, Brain 119 Ž1996. 775–787. w9x M.N. Ghabriel, G. Allt, Incisures of Schmidt-Lanterman, Prog. Neurobiol. 17 Ž1981. 25–58. w10x T. Inuzuka, N. Fujita, S. Sato, H. Baba, R. Nakano, H. Ishiguro, T. Miyatake, Expression of the large myelin-associated glycoprotein isoform during the development in the mouse peripheral nervous system, Brain Res. 562 Ž1991. 173–175.
306
G.C. Miescher et al.r Molecular Brain Research 52 (1997) 299–306
w11x H. Ishiguro, S. Sato, N. Fujita, T. Inuzuka, R. Nakano, T. Miyatake, Immunohistochemical localization of myelin-associated glycoprotein isoforms during the development in the mouse brain, Brain Res. 563 Ž1991. 288–292. w12x S. Kelm, A. Pelz, R. Schauer, M.T. Filbin, S. Tang, M.E. de-Bellard, R.L. Schnaar, J.A. Mahoney, A. Hartnell, P. Bradfield et al., Sialoadhesin, myelin-associated glycoprotein and CD22 define a new family of sialic acid-dependent adhesion molecules of the immunoglobulin superfamily, Curr. Biol. 4 Ž1994. 965–972. w13x C. Lai, M.A. Brow, K.A. Nave, A.B. Noronha, R.H. Quarles, F.E. Bloom, R.J. Milner, J.G. Sutcliffe, Two forms of 1B236rmyelin-associated glycoprotein, a cell adhesion molecule for postnatal neural development, are produced by alternative splicing, Proc. Natl. Acad. Sci. USA 84 Ž1987. 4337–4341. w14x W. Lesniak, C. Schaefer, S. Grueninger, M. Chiesi, Effect of a-adrenergic stimulation and carnitine palmitoyl transferase I inhibition on hypertrophying adult rat cardiomyocytes in culture, Mol. Cell. Biochem. 142 Ž1995. 25–34. w15x C. Li, Myelination in the absence of myelin-associated glycoprotein, Nature 369 Ž1994. 747–750. w16x D. Montag, Mice deficient for the myelin-associated glycoprotein show subtle abnormalities in myelin, Neuron 13 Ž1994. 229–246. w17x P. Ponte, S.Y. Ng, J. Engel, P. Gunning, L. Kedes, Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human b-actin cDNA, Nucleic Acids Res. 12 Ž1984. 1687–1696. w18x S. Sato, N. Fujita, T. Kurihara, R. Kuwano, K. Sakimura, Y. Takahashi, T. Miyatake, cDNA cloning and amino acid sequence for human myelin-associated glycoprotein, Biochem. Biophys. Res. Commun. 163 Ž1989. 1473–1480.
w19x P. Siebert, J. Larrick, PCR MIMICs: competitive DNA fragments for use as internal standards in quantitative PCR, BioTechniques 14 Ž1993. 244–249. w20x G. Spagnol, M. Williams, J. Srinivasan, J. Golier, D. Bauer, R.V. Lebo, N. Latov, Molecular cloning of human myelin-associated glycoprotein, J. Neurosci. Res. 24 Ž1989. 137–142. w21x A.J. Steck, N. Murray, C. Meier, N. Page, G. Perruisseau, Demyelinating neuropathy and monoclonal IgM antibody to myelin-associated glycoprotein, Neurology 33 Ž1983. 19–23. w22x A.H. Tatum, Experimental paraprotein neuropathy, demyelination by passive transfer of human IgM anti-myelin-associated glycoprotein, Ann. Neurol. 33 Ž1993. 502–506. w23x B.D. Trapp, S.B. Andrews, C. Cootauco, R. Quarles, The myelin-associated glycoprotein is enriched in multivesicular bodies and periaxonal membranes of actively myelinating oligodendrocytes, J. Cell. Biol. 109 Ž1989. 2417–2426. w24x B.D. Trapp, R.H. Quarles, Presence of the myelin-associated glycoprotein correlates with alterations in the periodicity of peripheral myelin, J. Cell Biol. 92 Ž1982. 877–882. w25x B.D. Trapp, R.H. Quarles, K. Suzuki, Immunocytochemical studies of quaking mice support a role for the myelin-associated glycoprotein in forming and maintaining the periaxonal space and periaxonal cytoplasmic collar of myelinating Schwann cells, J. Cell Biol. 99 Ž1984. 594–606. w26x M.B. Tropak, P.W. Johnson, R.J. Dunn, J.C. Roder, Differential splicing of MAG transcripts during CNS and PNS development, Brain Res. 464 Ž1988. 143–155. w27x H. Umemori, S. Sato, T. Yagi, S. Aizawa, T. Yamamoto, Initial events of myelination involve Fyn tyrosine kinase signalling, Nature 367 Ž1994. 572–576.