Recombinant expression and reconstitution of multiprotein complexes by the USER cloning method in the insect cell-baculovirus expression system

Methods xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Methods journal homepage: www.elsevier.com/locate/ymeth

Recombinant expression and reconstitution of multiprotein complexes by the USER cloning method in the insect cell-baculovirus expression system Ziguo Zhang, Jing Yang, David Barford ⇑ MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge CB2 0QH, United Kingdom

a r t i c l e

i n f o

Article history: Received 11 September 2015 Received in revised form 3 October 2015 Accepted 5 October 2015 Available online xxxx Keywords: Baculovirus insect cell expression MultiBac Multi-protein complexes USER ligation-free cloning

a b s t r a c t The capacity to reconstitute complex biological processes in vitro is a crucial step in providing a quantitative understanding of these systems. It provides material for structural, biochemical and biophysical analyses and allows the testing of biological hypotheses and the introduction of chemical probes and tags for single molecule analysis. Reconstitution of these systems requires access to homogenous components, usually through their over-production in heterologous over-expression systems. Here we describe the application of the USER (Uracil-Specific Excision Reagent) ligation-free cloning method to assemble recombinant MultiBac transfer vectors for the generation of recombinant baculovirus suitable for the expression of multi-protein complexes in insect cells. Crown Copyright Ó 2015 Published by Elsevier Inc. All rights reserved.

1. Introduction Most cellular processes are coordinated by multiprotein complexes that function as molecular machines to perform sophisticated biological reactions. Understanding the function and mechanism of such complexes requires structural, biophysical and biochemical analysis of entire complexes and defined sub-complexes. Frequently, the low natural abundance of such complexes limits the opportunities for structural and biophysical studies, and thus methods to reconstitute recombinant complexes significantly enhances the scope of such studies. The capacity to define the subunit composition of multisubunit complexes and to engineer and mutate specific subunits offers the potential to reconstitute complex biological processes in vitro. This enables the testing of biological hypotheses and the introduction of chemical probes and tags for single molecule analysis. The insect cell-baculovirus expression system provides an effective method for the production of intracellular eukaryotic proteins [1], especially those proteins reliant on eukaryotic chaperones for folding and stability, for example Hsp90-dependent protein kinases [2], and post-translational modifications such as protein phosphorylation and N-terminal acetylation [3]. The introduction of Bac-to-Bac technology [4] allowed for efficient and reliable recombinant virus construction by utilizing site-specific transposition in bacteria based on a baculoviral genomic DNA engineered ⇑ Corresponding author. E-mail address: [email protected] (D. Barford).

into a bacterial artificial chromosome (BAC). A major breakthrough in employing the insect cell-baculovirus expression for generation of multisubunit complexes was accomplished by Berger, Richmond and colleagues through their development of the MultiBac expression system [5–8], reviewed in [9–11]. MultiBac cloning directs the co-expression of multiple genes from a single virus under the control of multiple copies of the late p10 promoter and very late polyhedron promoter. In addition, modification of the baculovirus shuttle bacmid was made disrupting the v-cath and chiA genes to eliminate V-CATH-mediated proteolysis. This together with the insertion of a Cre-LoxP fusion site, created the MultiBac bacmid suitable for accepting the first generation pFBDM and pUCDM baculovirus transfer vectors through fusions at the Tn7 and Cre-LoxP integration sites, respectively [5]. This multiprotein expression strategy allows the production of large quantities of multisubunit complexes from the baculovirus-insect cell expression system, see for example [12–18]. In the first generation of MultiBac vectors, individual genes were cloned into multiple cloning sites of either the pFBDM or pUCDM transfer vectors. Assembly of multigene expression cassettes is achieved by repeated use of a multiplication module [5]. Construction of vectors for expression of multiprotein complexes required classical restriction endonuclease-ligation cloning approaches and thus the removal of matching restriction sites in individual genes. The second generation of MultiBac vectors are based on the principle of fusing Acceptor and Donor vectors by in vitro Cre-LoxP recombinase and provide for the assembly of multigene baculovirus transfer vectors. This development,

http://dx.doi.org/10.1016/j.ymeth.2015.10.003 1046-2023/Crown Copyright Ó 2015 Published by Elsevier Inc. All rights reserved.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

2

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

combined with ligation-free homologous recombination-based cloning, for example Infusion cloning and SLIC [19,20], allows the seamless cloning of a gene of interest into any designation vector [6–8] (reviewed by [9]). EMBac is a modified MultiBac bacmid incorporating an enhanced yellow fluorescent protein under the control of the polyhedron promoter. YFP fluorescence levels serve to directly monitor viral performance [8]. Moreover, these new vectors are readily adapted for automation in robotic setups [21]. Most recently, the Berger group has developed the Omni-PBac transfer vectors that can access all commonly used baculovirus genomes by either homologous recombination (for example flashBAC from OET, the BacVector series from Novagen (MerckMillipore)) or transposition (Bac-to-Bac from Thermofisher Scientific and MultiBac) [22]. Expression of polyproteins has been used as a means to balance subunit stoichiometry in multiprotein complexes [10,23]. However a disadvantage of expressing subunits as a pre-polypeptide chain is that neither the authentic N- and C-termini, nor the presence of potential N-terminal acetylation sites are maintained, and this may disrupt correct complex assembly. Our studies on the anaphase promoting complex/cyclosome (APC/C) showed that the N-termini of three small subunits (Apc12, Apc13 and Apc15) are buried within the core of their associated tetratricopeptide repeat (TPR) subunits. Additional N-terminal residues would not be accommodated [3,24]. Neutralisation of the positive charge at the N-terminus of Apc12 through N-terminal acetylation is also likely critical to its stable association with Apc6 [3]. Therefore we recommend expressing subunits as single polypeptide chains with the minimal number of subunits modified with affinity purification tags necessary for purification to homogeneity. USER (Uracil-Specific Excision Reagent) ligation-free cloning [25–27] provides a highly efficient method for the simultaneous seamless assembly of multiple DNA fragments into any cloning vector with a USER compatible module and is particularly beneficial for multiprotein complexes that comprise proteins with large molecular weights. Here, we describe an approach based on the USER cloning method, utilizing modified pFBDM and pUCDM vectors [5] to generate multigene containing baculovirus transfer vectors for insect cell co-expression. Our transfer vectors are integrated into MultiBac BAC by fusions at the Tn7 and Cre-LoxP integration sites for generation of the recombinant baculovirus genome. We have successfully used this method for the reconstitution of

numerous multiprotein complexes including the mitotic checkpoint complex (MCC) [15] and various functional complexes of the APC/C [16,28], including human APC/C with its coactivator (Cdh1) and inhibitor Emi1 (a total of 17 subunits assembled into a complex of 22 subunits) [24]. We illustrate this approach with the reconstitution of recombinant APC/C from Sacchromyces cerevisiae. Budding yeast APC/C comprises 13 different proteins with the assembled APC/C incorporating 18 subunits with a combined molecular mass of 1.2 MDa [14]. Our approach is hierarchical and modular and is flexible, simple and fast. Generation of the multigene vectors was achieved within a few weeks, and the separate steps of the procedure affords the flexibility to generate combinations of subunits for formation of distinct sub-complexes, important for understanding multisubunit complex assembly pathways. 2. Methods In Section 2.1 we present a general outline of the USER cloning approach applied to generation of MultiBac transfer vectors, with more details described in Section 2.2. Note the USER cloning approach is applicable to a wide range of cloning tasks [25–27]. Sections 2.3 and 2.4 present detailed protocols for recombinant MultiBac bacmid and baculovirus generation. Section 2.5 describes an APC/C purification procedure and Section 2.6 discusses background information and procedural information. 2.1. General outline and overview of the USER cloning approach The method is hierarchical and divided into multiple cloning rounds according to the number of component genes, with a single round required for two to four genes and a second round required for 5–16 genes. The second and subsequent stages amplify the cloning steps of round 1. Complexes incorporating 17 and more genes are either constructed with additional rounds of cloning or rely on insect cell co-infection of two or more recombinant baculoviruses. 2.1.1. Cloning two and four genes (round 1) We describe first the procedure for cloning of up to four genes achieved in round 1 of cloning. Generic names and sequences for PCR primers are listed in Table 1. In the four-gene assembly of

Table 1 Primers for round 1 PCR amplification and USER assembly into pF1 and pU1. Round 1 step 1.1 PCR primers Bioriented dual promoter module amplification promF: ATGATTGTAAAUAAAATGTAATTTACAGTATAG promR: ATATTTATAGGUTTTTTTATTACAAAACTGTTAC Round 1 step 1.2 PCR primers Gene 1 PCR primers: (AUG is start codon) pF1-G1F: ACCTATAAATAUG-NNNNN. . . (gene 1 specific sequence) pF1-G1R: GCTGCGAU-NNNNN. . . (gene 1 specific sequence) omit stop codon to insert PreScission-His8 tag Gene 2 PCR primers: (AUG is start codon) pF1-G2F: ATTTACAATCAUG-NNNNN. . . (gene 2 specific sequence) pF1-G2R: GCTAGCGAUGA-NNNNN. . . (gene 2 specific sequence) omit stop codon to insert TEV-double StrepII tag Gene 3 PCR primers: (AUG is start codon) pU1-G3F: ACCTATAAATAUG-NNNNN. . . (gene 3 specific sequence) pU1-G3R: CTGGATTU-NNNNN. . . (gene 3 specific sequence) omit stop codon to insert TEV-CBP tag Gene 4 PCR primers: (AUG is start codon) pU1-G4F: ATTTACAATCAUG-NNNNN. . . (gene 4 specific sequence) pU1-G4R: CCGGATTU-NNNNN. . . (gene 4 specific sequence)

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

3

Fig. 1. General overview of the USER-based cloning system. The process of generating recombinant baculovirus transfer vectors is indicated in step 1 and step 2. The first round of cloning (step 1) (using pP0P, pF1 and pU1) is required for cloning up to 4 genes, a second round of cloning (step 2) (using pF2 and pU2) is required for cloning up to 16 genes. Additional rounds of cloning (using the pP1P and pP2P vectors) allows expression of >16 genes. Alternatively for expression of >16 genes co-infection of multiple viruses can be performed. Recombinant bacmid is generated in step 3 and recombinant baculovirus is generated in step 4.

round 1, we assemble a pair of dual expression cassettes (promoter-gene-terminator) individually cloned into two vectors

(pF1 and pU1, vectors modified from pFBDM and pUCDM, respectively for USER cloning) (Fig. 1, Cloning round 1 & Figs. 2 and 3).

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

4

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

Fig. 2. Schematic of the plasmids used for the USER-based cloning approach. pF1 and pU1 are used in the first round of cloning (step 1, Figs. 1 and 3). Affinity purification tags: double-StrepII and His8 tags in pF1 and calmodulin-binding peptide (CBP) tag in pU1, are indicated. pF2 and pU2 are used in the second round of cloning (step 2, Figs. 1 and 5). pP0P is used as a template to PCR-generate the bioriented promoter cassette (step 1.1, Figs. 1 and 3). pP1P and pP2P enables 8+ genes to be cloned into both pF2 and pU2 (thus allowing expression of 17 or more genes in total).

Step 1.1: Run PCR to generate a promoter module comprising the bioriented p10 and polh promoters (Figs. 1 and 3). Step 1.2: Generate PCR products for each of the four genes (G1– G4) (Figs. 1 and 3). Step 1.3: Prior to USER-mediated assembly, pF1 is linearized at Nb.BbvCI/AsiSI endonuclease sites within the MUM1 site, whereas pU1 is linearized at Nb.BsmI/SwaI endonuclease sites within the MUM2 site (Figs. 1 and 4)). Step 1.4: DNA fragments (PCR products from step 1.1 and step 1.2) for a pair of genes (e.g. G1 and G2) and the promoter module are assembled into a cloning vector (e.g. pF1) by USER cloning to create the pF1 derivative: the dual expression vector pF1-G1-G2 (Figs. 1 and 3a). Likewise, the second pair of genes (e.g. G3 and G4) and the promoter module is assembled into pU1 generating the pU1 derivative: the dual expression vector pU1-G3-G4. Note: the transcription terminators (SV40 and HSVtk) are located in the linearized plasmids (Figs. 1 and 3b). Step 1.5: The pF1 and pU1 derivatives are transformed into DH10MultiBac E. coli cells to generate a MultiBac BAC through in vivo transposition employing the Tn7 site of the pF1 vector and the Cre-LoxP site of the pU1 vector through the Bac-to-Bac method [4] and MultiBac method [5]. The resultant recombinant MultiBac BAC, here incorporating four genes, is ready for transfection into insect cells for subsequent baculovirus generation (detailed below) (Figs. 1 and 3). 2.1.2. Cloning three genes Three genes are co-expressed by combining a dual expression vector (either pF1-G1:G2 or pU1-G1:G2) with a single expression vector (either pF1:G3 or pU1:G3). A single expression vector is generated by modifying the USER reaction of step 1.4 by substituting a DNA adapter for G4 to create a pseudo dual expression cassette with only one functional gene (adaptors shown in Table 2). 2.1.3. Cloning 6–16 genes (even) (round 2) In cloning round 2 (Figs. 1 and 5), generation of larger gene assemblies (i.e. P16) utilizes the dual expression cassettes (bioriented promoter-gene-terminator) present in the recombinant pF1 and pU1 derivatives (created in cloning round 1) as PCR templates for production of new PCR products for assembly into either one or two destination vectors (pF2 and pU2, modified from pFBDM and

pUCDM, respectively) (Figs. 1, step 2.1 & 2 and 5). PCR primer sets listed in Table 3. In the example illustrated, we assemble eight genes (G1–G8) into pF2 and another eight genes (G9–G16) into pU2 (Figs. 1, step 2.3 & 5). As for pF1 and pU1, the resultant pF2G1-G8 and pU2-G9-G16 expression vectors are transformed into DH10MultiBac Escherichia coli cells to generate a MultiBac bacmid (Figs. 1, step 2.4 & 5). The procedure for generating pF2-G1-G8 and pU2-G9-G16 expression vectors is identical, requiring the same sets of PCR primers (Table 3). To generate the pF2-G1-G8 expression vector for example, four dual expression gene cassettes are produced by PCR amplification of four dual expression pF1 derivatives generated in cloning round 1 (Figs. 1, step 2.1 & 5) Note four dual expression pU1 derivatives could also be used. These are then assembled into pF2 through USER cloning in step 2.3. In step 2.2 (Figs. 1 and 5), pF2 and pU2 are linearized at MUM1 or MUM2 sites, respectively (Figs. 2 and 4). Since the MUM1 and MUM2 endonuclease sites are not recreated this allows assembly of pF2 and pU2 derivatives with more than 8 genes (see Section 1.5). Normally, the four dual expression gene cassettes generated by PCR in step 2.1 are different, being derived from four different dual expression pF1 (or pU1) derivatives. However, by using the same pF1 or pU1 derivative for two or more PCRs, pF2 and pU2 derivatives with supernumerary copies of specific genes (possibly useful for balancing protein expression levels) can be created. To generate pF2 and pU2 derivatives with either four or six genes, two and three dual expression cassettes, respectively are assembled into the destination vectors. The appropriate combination of cloning round 2 primers (Tables 3 and 4) required for generating the PCR products in step 2.1 for USER assembly in step 2.3 are listed in Table 4. 2.1.4. Cloning 5–15 genes (odd) (round 2) Assembly of an odd number of genes requires the combination of dual expression cassettes using a pseudo dual expression cassette with one gene (see Section 2.2.1). 2.1.5. Cloning over 16 genes (round 3 and above) The approach described above allows co-expression of up to 16 genes from a single baculovirus. Recombinant expression of complexes comprising over 16 proteins can be achieved by coexpressing multiple viruses. Alternatively, our approach allows for the assembly of additional genes into the recombinant pF2-G1-G8 and pU2-G9-G16 vectors. Cloning round 1 is modified in step 1.1 to ensure that either a MUM1 or MUM2 module is present in the derivative pF2/pU2 vectors. One of the dual expression cassettes generated in cloning round 1 contains either a MUM1 or MUM2 module between the p10 and polh promoters. Such dual expression cassettes are generated when the bioriented p10 and polh promoter module is PCR-amplified from either the pP1P or pP2P vectors (Figs. 2 and 1, step 1.1) and used in the pF1/pU1 derivative assembly (Figs. 1, step 1.4 and 3). Subsequent PCR of the derivative pF1/pU1 vector (Fig. 1, step 2.1) generates the dual expression cassette containing the MUM1/MUM2 module that is then assembled into pF2/pU2 (Figs. 1, step 2.3 and 5). In round 3 of cloning, the derivative pF2/pU2 vector is linearized at the MUM1/MUM2 site (Fig. 1, step 2.2) for insertion of additional dual expression cassettes (i.e. one to four) by the same procedure described (Section 2.1.3 and Fig. 1, step 2.3). 2.2. Detailed cloning methods (refers to Figs. 1–5 2.2.1. Round 1: generation of pF1-G1:G2 and pU1-G3:G4 recombinant vectors 2.2.1.1. Dual promoter module generation. Step 1.1: Forward and reverse primers (promF and promR, Table 1) are used to amplify the bioriented dual promoter module (Figs. 1 and 3) using the

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

5

(a)

Fig. 3. Schematic of round 1 cloning strategies into pF1 and pU1 vectors. (a) pF1 derivative assembly and (b) pU1 derivative assembly. Steps shown relate to those in Fig. 1 and the text. PCR primer sequences used for generation of PCR products are listed in Table 1.

pP0P vector (Fig. 2) as a template. Note that the initiator codon in our primers corresponds to the authentic initiator codons of the p10 and polh genes to eliminate alternative translation start sites (discussed in ‘Notes’ below). To include either a MUM1 or MUM2 site (USER cloning sites) within the bioriented dual promoter module that enables 8+ genes to be cloned into pF2 and pU2 (thus allowing expression of 17 or more genes in total, Section 2.1.5), use either pP1P or pP2P vectors (Fig. 2). See Table 1 for primer sequences. 2.2.1.2. Generation of pF1-G1:G2 plasmid. Step 1.2: Amplify G1 using pF1-G1F and pF1-G1R primers and G2 using pF1-G2F and pF1-G2R primers (Figs. 1 and 3a). See Table 1 for primer sequences. Step 1.4: Assemble the pF1-G1:G2 transfer vector by combining the linearized pF1 vector, dual promoter module, G1 and G2 with USER (Figs. 1 and 3a). The pF1 vector incorporates a PreScission-

His8 tag and a TEV double-StrepII tag for the optional addition onto the C-termini of proteins (Fig. 2 and Table 5). 2.2.1.3. Generation of pU1-G3:G4 plasmid. Step 1.2: Amplify G3 using pU1-G3F and pF1-G3R primers and G4 using pU1-G4F and pU1-G4R primers (Figs. 1 and 3b). See Table 1 for primer sequences. Step 1.4: Assemble the pU1-G3:G4 transfer vector by combining the linearized pU1 vector, dual promoter module, G3 and G4 with USER (Figs. 1 and 3b). The pU1 vector incorporates a TEV-CBP tag for the optional addition onto the C-terminus of proteins (Fig. 2 and Table 5). 2.2.2. Round 2: generation of pF2-G1:G8 and/or pU2-G9:G16 recombinant vectors 2.2.2.1. Generation of pF2-G1:G8 and pU2-G9:G16 plasmid. To clone eight genes into either pF2 or pU2, PCR-amplify dual expression

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

6

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

(b)

Fig. 3 (continued)

cassettes using the four sets of primers indicated in Table 3 (Figs. 1, step 2.1 and 5). This process generates four dual expression cassettes (incorporating promoter and terminator from either pF1G1:G2 or pU1-G3:G4) for USER cloning into either pF2 or pU2. To clone four genes into either pF2 or pU2, the second dual expression cassette is PCR-amplified using pFU2-cas2F and pFU2m1-casR2 primers (Tables 3 and 4). To clone six genes into either pF2 or pU2, the third dual expression cassette is PCR-amplified using pFU2-cas3F and pFU2m1-casR2 primers (Tables 3 and 4). 2.3. Technical USER cloning protocols 2.3.1. Plasmid (pF1, pF2, pU1, pU2) linearization (step 1.3 and step 2.2) Efficient vector linearization is critical to minimize false colonies. MUM1 is linearized with AsiSI and Nb.BbvCI. In a 50 ll reaction, NEB Buffer 2, BSA (1 mg/ml), 15 units AsiSI, 5 lg plasmid, made up to 50 ll with dd-H2O and incubated at 37 °C over night. Subsequently, 15 units Nb.BbvCI were added and incubated at 37 °C for another 2 h. The linearized plasmid was purified by

extraction from a long 1% agarose gel using the Qiagen Gel Extraction Kit). Similarly, MUM2 is linearized by SwaI and Nb.BsmI. The reaction is prepared in NEB Buffer 3 with BSA (1 mg/ml). SwaI digestion is performed at 25 °C over night and Nb.BsmI-catalyzed nicking is performed at 65 °C for 1 h.

2.3.2. PCR reactions (step 1.1, step 1.2 and step 2.1) Stratagene PfuTurbo Cx Hotstart DNA Polymerase (Agilent Technologies, Inc.) is recommended for DNA amplifications for USER assembly. PfuTurbo Cx Hotstart DNA Polymerase is preferable for reading through uracil bases present in primers and to minimize PCR errors. PCR mixes are prepared on ice. In practise, a master mix containing all the common components is prepared for the PCR. The reaction-specific components such as primers and templates are added to the master mix in individual PCR tubes. The PCR condition is 95 °C for 1 min, followed by 30 cycles of 94 °C for 10 s, (annealing temperature dependent on primer) for 10 s, 68 °C for 1 min per kb for the elongation step.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

7

Biolabs, 1 U/ll) (linearized plasmid 100 ng, 500 ng of each fragments (up to four fragments can be assembled in one reaction). The reaction mixture is incubated for 20 min at 37 °C, followed by 20 min at 25 °C. Place on ice then directly transform into competent E. coli cells. 2.3.4. Transformation for recombinant pF1, pF2, pU1, pU2 propagation (step 1.5 and step 2.4) Thaw 50 ll of competent cells on ice. Add all 10 ll of the icechilled USER reaction to the cells, mix gently then incubate on ice for 30 min. At the same time, warm LB agar plates (with appropriate antibiotic, Table 6) at 37 °C. Heat shock the cell-DNA mix at 42 °C for 45 s. Place on ice for 3 min. Add 50 ll room temperature LB broth then directly spread out onto a pre-warmed LB agar plate. Incubate in 37 °C over night. Note, for transformation and propagation of pF1 and pF2 vectors (containing the ColE1 origin of replication), standard E. coli cloning strains such as DH5a and TOP10 are suitable. For pU1 and pU2 vectors (incorporating a conditional origin of replication derived from phage R6Kc), pir+ stains such as E. coli pir-116 should be used (available from Invitrogen (ThermoFisher Scientific)).

Fig. 4. Sequence of the MUM1 and MUM2 sites and associated restriction endonuclease cleavage sites. MUM1 and MUM2 sites present in the cloning vectors are cleaved with Nb.BbvCI/AsiSI and Nb.BsmI/SwaI, respectively. This allows insertion of dual expression cassettes as indicated in Figs. 1, 3 and 5.

2.3.3. USER reaction (step 1.4 and step 2.3) Isolate PCR fragments from agarose gel by using Qiagen Gel Extraction Kit. Ethanol-precipitate all the PCR fragments together with the appropriate linearized plasmid. Re-suspend the DNA with 8 ll double deonized H2O, 1 ll 10
TE buffer [100 mM TrisHCl, 1 mM EDTA (pH 8.0)] and 1 ll USERTM enzyme mix (New England

2.3.5. Sequence confirmation Select ten colonies for DNA amplification by miniprep. Check by restriction endonuclease digestion, and sequence colonies with the correct restriction endonuclease digestion pattern. Due to the multiple copies of promoters and terminators, gene-specific primers should be used to obtain sequence coverage, including the flanking promoter and terminator regions, of the genes of interest. 2.3.6. Cloning long genes Cloning large genes (>8 kb) presents a challenge. USER cloning allows a long gene to be readily cloned by dividing the gene into a few USER-compatible PCR-generated DNA fragments (we suggest 2 or 3 PCR products for a 8 kb gene) for assembly in a single USER reaction (Figs. 1, step 1.4 and 3). Assembly of a large DNA fragment by multiple PCR reactions occurs without sequence change. Select a region of 7–11 bases in length with a 50 A and 30 T, (e.g. ANNNN. . .NNNT) and design primers around the region as shown:

Table 2 Adaptors for generation of single expression cassettes in round 1 step 1.4. (i) Adaptors for pF1 ADP1F: CCCTCTCTCCATCGCTAGC ADP1R: GGAGAGAGGGATGATTGTAAAT Mix to generate: GGAGAGAGGGATGATTGTAAAT CGATCGCTACCTCTCTCCC (ii) Adaptors for pU1 ADP2F CCCTCTCTCCAAATCCGG ADP2R GGAGAGAGGGATGATTGTAAAT Mix to generate: GGAGAGAGGGATGATTGTAAAT GGCCTAAACCTCTCTCCC

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

8

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

Table 3 Primers for round 2 PCR amplification and USER assembly into pF2 and pU2 round 2 step 2.1 PCR primers. Dual expression cassette 1 pFU2m1-cas1F: GCTAGCGAUTGGCTATGGCAGGGCTTGC pFU2-cas1R: AGCCACGGAUCTCCTAGGCTCAAGC Dual expression cassette 2 pFU2-cas2F: ATCCGTGGCUATGGCAGGGCTTGC pFU2-cas2R: ACGGATCUCCTAGGCTCAAGC Dual expression cassette 3 pFU2-cas3F: AGATCCGUGGCTATGGCAGGGCTTGC pFU2-cas3R: ACGGATCTCCUAGGCTCAAGC Dual expression cassette 4 pFU2-cas4F: AGGAGATCCGUGGCTATGGCAGGGCTTGC pFU2m1-cas4R: GCTGCGAUCGGATCTCCTAGGCTCAAGC For cloning dual expression cassettes into MUM2 sites of pF2 and pU2, replace pFU2m1-cas1F with pFU2m2-cas1F and replace pFU2m1-cas4R with pFU2m2-cas4R pFU2m2-cas1F:CCGGATTUTGGCTATGGCAGGGCTTGC pFU2m2-cas4R:CTGGATTUCGGATCTCCTAGGCTCAAGC

Fig. 5. Schematic of round 2 cloning strategies into pF2 and pU2 vectors via the MUM1 site. Steps shown relate to those in Fig. 1 and the text. PCR primer sequences used for generation of PCR products are listed in Table 3.

2.3.7. Cloning hints Efficient assembly of PCR products with USER cloning requires sufficient quantities of PCR products, thus optimizing

PCR-product generation using techniques such as hot start, gradient and touch down [29] are recommended.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

9

Z. Zhang et al. / Methods xxx (2015) xxx–xxx Table 4 Selection of round 2 primers for PCR and USER assembly (step 2.1). Primer pFU2m1-cas1F (for MUM1 cloning) (or pFU2m2-cas1F [for MUM2 cloning]) pFU2-cas1R pFU2-cas2F pFU2-cas2R pFU2-cas3F pFU2-cas3R pFU2-cas4F pFU2m1-cas4R (for MUM1 cloning) (or pFU2m2-cas4R [for MUM2 cloning])

Table 6 Antibiotics for selection of recombinant DH10MultiBacCre E. coli.

4 genes p

6 genes p

8 genes p

p p

p p p p

p p p p p p p





p



p

2.4. Protocols for MultiBac bacmid and baculovirus generation Based on protocols described in [6]. 2.4.1. Generation of recombinant MultiBac Bac in DH10MultiBacCre E. coli (step 3) To generate recombinant MultiBac bacmid integrated with gene cassettes from both pF1/2 and pU1/2, we suggest to use a two-step transposition procedure. First recombinant pU1 and pU2 vectors are integrated into the MultiBac bacmid present in DH10MultiBacCre E. coli cells via insertion at the Cre-loxP locus. Transform pBADZ-His6Cre into DH10MultiBac cells to create DH10MultiBacCre E. coli by using low salt LB medium adjusted to pH 7.5 (1 L with 5 g NaCl, 5 g yeast extract, 10 g tryptone) with kanamycin (50 lg/ml), tetracyclin (10 lg/ml) and zeocin (25 lg/ ml) for proper zeocin selection. To make competent cells, inoculate a few colonies of DH10MultiBacCre E. coli in 200 ml of low salt LB broth with the appropriate antibiotics (Table 6) at 20 °C, shaking at 250 rpm overnight. After 16 h, continue the growth at to 37 °C

Vector derivative

E. coli strain

Antibiotics Cre

pU1 and pU2

DH10MultiBac

pF1 and pF2

DH10MultiBacCre cells

pF1 and pF2

DH10MultiBacCre cells with integrated pU1 or pU2 derivative

cells

Chloramphenicol (25 lg/ml) Ampicillin (100 lg/ml) Kanamycin (50 lg/ml) Gentamycin (7 lg/ml) Tetracycline (10 lg/ml) Ampicillin (100 lg/ml) Kanamycin (50 lg/ml) Gentamycin (7 lg/ml) Tetracycline (10 lg/ml) Chloramphenicol (25 lg/ml) Kanamycin (50 lg/ml)

shaking at 300 rpm until the cell density reaches an OD600 of 0.25. To induce Cre-recombinase expression, add 100 mg L-arabinose

to 100 ml of culture, continue the growth for 2 h shaking at 37 °C, 300 rpm until the OD600 reaches about 0.5 (if not at 0.5, lower the temperature to 25 °C and continue the growth to an OD600 of 0.5). Spin down the cells and prepare chemical competent cells using a general competent cell preparation method. To integrate pU1and pU2 into DH10MultiBacCre, add at least 1 lg of pU1 (or pU2) plasmid into 50 ll of competent cells. Incubate on ice for 30 min, heat shock at 42 °C for 30 s, then return to ice for 2 min. Add 3 ml of LB broth, shake at 30 °C, 220 rpm overnight. Spin down the cells and resuspend in LB broth, then spread onto an LB agar plate with appropriate antibiotics (Table 6), X-gal (100 lg/ml) and IPTG (40 lg/ml). Incubate at 37 °C for 2 days, after which all colonies should be blue. Pick a few blue colonies to make chemical competent cells for the second step of transposition with pF1 and pF2. Recombinant pF1 and pF2 vectors are integrated into MultiBac bacmid by insertion at the Tn7 locus, disrupting the lacZ gene. Plate cells onto LB agar plates containing the appropriate

Table 5 Sequence of cleavable affinity purification tags optionally fused to genes 1–3.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

10

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

antibiotics (Table 6), X-gal (100 lg/ml) and IPTG (40 lg/ml) and select white colonies.

2.4.4. Harvesting P1 virus and P2 virus amplification (step 4 continued)

2.4.2. Amplification of recombinant MultiBac bacmid DNA (step 3 continued) In 50 ml falcon tubes, 10 ml of LB broth containing appropriate antibiotics (Table 6) is inoculated with 3–6 selected colonies. Culture the inoculum at 37 °C over night by shaking at 220 rpm. The cells are pelleted and resuspended in 0.5 ml suspension buffer (50 mM Tris–HCl pH 8.0, 10 mM EDTA, 100 lg/ml RNaseA). Next add 0.5 ml of lysis buffer (200 mM NaOH, 1% SDS) to lyse the cells through gentle mixing. Thereafter, handle with care to avoid shearing the bacmid DNA. Add 0.7 ml of neutralizing buffer (4.2 M guanidinium chloride, 0.9 M potassium acetate, pH 4.8). Spin down the lysate at 13,000 rpm for 10 min in a bench top centrifuge. Carefully pipette the supernatant into a new tube containing 1 volume of isopropanol. Mix gently and precipitate the MultiBac bacmid DNA by centrifugation for 5 min at high speed. Discard the supernatant and spin down the DNA pellet briefly, the last trace of solution is aspirated by pipetting. The still wet bacmid DNA pellet is gently resuspended with 100 ll of sterile distilled water.

1. Use a sterile plastic pipette to resuspend all the cells in the well and transfer everything (2 ml) into a 50 ml culture of Sf9 cells at 1.6–2
106 cells/ml in a 250 ml (or 500 ml) flask for amplification of P2 virus. This is very important for large recombinant virus because infected cells will continue to release virus that will coontinue cell infection. For difficult viruses, the volume of P2 amplification can be reduced to 30 or 40 ml. The cells are left shaking in the dark at 140 rpm at 27 °C. 2. Monitor the virus amplification by counting the P2 cell density, cell size and cell viability after 48 h. Normally after 2 days amplification, the size of Sf9 cells will increase from 10.5 lm to greater than 12 lm. Cell density will also have increased but not doubled. This indicates good amplification. Let the amplification continue a day or more until the viability of cells decreases to 80%. If the cell density has doubled and cell size is below 12 lm after 2 days amplification, dilute the cell density to 2.5
106 cells/ml. Continue until the size increases to above 12 lm. Harvest the P2 virus when the cell viability drops to approximately 80%. 3. Harvest P2 by pouring all the amplification into a sterile 50 ml Falcon tube. Centrifuge the tube at 3000 rpm for 5 min to pellet cell debris. Pour the supernatant into another sterile 50 ml Falcon tube. Add 2% heat-inactivated FCS to the P2 virus to maintain viral stability. The pellet of P2 virus can be used to test expression of the complex. The P2 virus should be stored at 4 °C in the dark as a virus stock for P3 amplfication and protein expression. The P2 virus titer is normally above 1
108 pfu/ml.

2.4.3. Insect cell transfections (generation of P1 baculovirus) (step 4) 1. Dilute the stock of logarithmically growing Sf9 cells at a cell desnity between 1.2 and 2.0
106 cells/ml with antibioticfree Sf-900 II SFM medium to 0.5
106 cells/ml. Aliquot 2 ml Sf9 cells into each well of a 6 well-tissue culture plate. Close the lid and remove the plate from the hood to avoid drying out. The cells should be allowed to settle and adhere to the bottom of the well for about an hour and be in contact. This is termed ‘contact inhibited’ because cell growth is inhibited. This state is perfect for transfection with recombinant virus. 2. To prepare the transfection mixture: to a sterile eppendorf tube add 100 ll antibiotic-free Sf-900 II SFM medium. Add 5 ll recombinant MultiBac bacmid (10–20 lg) and mix gently. In a seperate eppendorf tube add 100 ll antibiotic-free Sf-900 II SFM medium and 10 ll Cellfectin II. Mix well and take 100 ll of this mixture to the MultiBac bacmid tube and mix gently. Leave the solution at room temperature for 30–45 min. 3. Add 800 ll of antibiotic-free Sf-900 II SFM medium to the transfection tube and mix gently. Return the 6-well tissue culture plate to the hood. Tilt the plate and remove 2 ml of media without disturbing the Sf9 cell monolayer. Using a 1 ml pipette add the transfection mixture to the well in a drop wise manner to ensure even distribution. Place the plate into a humidified box. Incubate the box at 27 °C for 5–6 h (without shaking). 4. The transfection mixture is removed after 5–6 h and replaced with 2 ml of Sf-900 II SFM medium supplemented with antibiotics (with antibiotics 100 U/ml of penicillin, 100 lg/ml of streptomycin) gently in a drop wise manner. Return the plate to the box and leave at 27 °C for 3–4 days (in the dark) (without shaking). 5. Inspect the plate using a microscope after 3 days to determine whether the Sf9 cells have been successfully transfected and started producing the P1 virus. If the cells are enlarged and swollen and there are gaps between cells, then the infection has been successful. P1 virus should be harvested. If the cells are dense and crowded, leave the plate for a further one or 2 day before harvesting. Transfection of large complexes is less efficient due to the size of the recombinant bacmid, and usually requires 4 days incubation. 6. A useful negative control is to transfect cells with media without recombinant MultiBac bacmid.

2.3.5. P3 virus amplification and protein expression (step 4 continued and step 5) In order to speed up production of the protein complex and achieve better yields of target complex, we simultaneously amplify P3 virus and grow High 5 cells for protein expression. Freshly prepared P3 virus provides better expression levels. Here we illustrate the procedure with a 3 L culture of High 5 cells. 1. Split stock High 5 cells to generate a total volume of 3 L of expression culture at 0.2
106 cells/ml (400 ml in 2 L roller bottles) in Sf-900 II SFM media (with antibiotics 100 U/ml of penicillin, 100 lg/ml of streptomycin). Grow at 27 °C shaking at 140 rpm High 5 cells will reach 2
106 cells/ml in 72 h. 2. At the same time amplify the virus(es) required for expression of the complex. Normally 10 ml of P3 virus is required for 400 ml of expression culture. Thus, the 3 L of High 5 expression culture requires 80 ml of P3 virus. For multi virus co-infection, amplify 80 ml of each virus. To amplify 100 ml of P3 virus we infect 100 ml of Sf9 cells (cell density at 2
106 cells/ml) (in 2 L roller bottles) in antibiotic-free Sf-900 II SFM media with 1 ml of P2 virus. 3. At 72 h monitor the High 5 expression culture cell density. High 5 cells should reach 2
106 cells/ml. If the density is >2.5
106 cells/ml, dilute culture to a cell density of 2– 2.3
106 cells/ml. 4. Also at 72 h monitor the Sf9 cell viability used for P3 virus amplification. The viability of Sf9 cells will have decreased below 90%. 5. For protein expression, infect each 400 ml of High 5 cell expression culture with 10 ml of P3 virus (MOI will be 1–2). Incubate at 27 °C, 140 rpm Monitor the cells after 2 days. Harvest High 5 cells when the viability decreases to 80%. If the cell viability is found to decrease below 80% too quickly, the virus MOI is too

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

11

Fig. 6. Organisation of pF2 and pU2 derivative vectors for expression of S. cerevisiae APC/C. A total of four vectors (two each of the pF2 and pU2 derivative vectors, modified from pFBDM and pUBDM vectors [5]) were constructed based on the USER-based cloning method for generation of two recombinant baculoviruses for co-infection of High 5 insect cells.

fractions were incubated with TEV protease at 4 °C overnight, then diluted twofold into buffer A without NaCl (buffer A: 20 mM HEPES pH 8.0, 125 mM NaCl, 5% glycerol, 2 mM DTT and 1 mM EDTA) and loaded onto a ResourceQ anion exchange column (GE Healthcare). The column was washed with buffer A and eluted with a gradient of buffer B (20 mM HEPES-NaOH pH 8.0, 1 M NaCl, 5% glycerol, 2 mM DTT and 1 mM EDTA). Resource Q peak fractions were concentrated and loaded onto a Superose 6 10/300 GL column (GE Healthcare) equilibrated in APC/C size exclusion buffer (20 mM HEPES pH 8.0, 200 mM NaCl, 2 mM DTT). 2.6. Notes and Tips on Procedures

Fig. 7. Coomassie blue-stained gel of purified recombinant S. cerevisiae APC/C. APC/ C subunits are indicated with the human name given in parenthesis.

high and should be reduced. The cells are harvested by centrifugation at 1000g for 10 min and flash frozen in liquid nitrogen in 50 ml Falcon tubes and stored at -80 °C.

2.5. APC/C Purification (step 5 continued) All purification steps were performed at 4 °C. Cell pellets were thawed on ice and resuspended in lysis buffer (50 mM TrisHCl pH 8.3, 250 mM NaCl, 5% glycerol, 2 mM DTT, 1 mM EDTA, 0.1 mM PMSF, 2 mM benzamidine, benzonase (Novagen) and complete EDTA free protease inhibitors (Roche)). After sonication the lysate was spun down for 60 min at 48,000 g, the soluble supernatant was bound to a 5 ml Strep-Tactin Superflow Cartridge (Qiagen) with a flow rate of 1 ml/min. The column was washed with APC/C wash buffer (50 mM TrisHCl pH 8.0, 250 mM NaCl, 5% glycerol, 2 mM DTT, 1 mM EDTA and 2 mM benzamidine). Recombinant APC/C was eluted with APC/C wash buffer supplemented with 2.5 mM desthiobiotin (Sigma). StrepTactin elution

2.6.1. Initiator codons Primers were designed to initiate translation from the authentic initiator codons of the p10 and polh promoters. This ensures that all polypeptides initiate from the same codon. The ATG codon of the polh gene conforms to the optimal Kozak sequence of Drosophila. Previously we (W. Chao and Z.Z., unpublished) and others [30] have found that the mutated polh translation start codon (ATT) present upstream of the MCS of baculovirus transfer vectors serves as an alternative start site (see also [31]) that allows sporadic translation initiation. Thus when an AUG codon corresponding to the expressed gene is placed 30 of the mutated polh AUG, a small proportion of proteins contained 19 residues corresponding to the N-terminus of the polyhedron protein fused to their N-termini. It is important to note that pFastBac, pDualBac and pMultiBac vectors contain the multiple cloning site downstream of the mutated polh initiator codon. 2.6.2. Purification tags C-terminal purification tags can be inserted into the dual expression cassettes generated in round 1 (Table 5). A total of three C-terminal tagging sequences are encoded in pF1 and pU1. (i) A PreScission cleavable His8 tag in pF1 (gene 1), (ii) a TEV cleavable double StrepII tag in pF1 (gene 2) and (iii) a TEV cleavable CBP tag in pU1 (gene 1) (Fig. 1). To utilize these tags omit stop codons in the primers as shown in Table 1.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

12

Z. Zhang et al. / Methods xxx (2015) xxx–xxx

2.6.3. USER reaction USER (Uracil-Specific Excision Reagent) Enzyme generates a single nucleotide gap at the location of a uracil. USER enzyme is a mixture of Uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII. UDG catalyses the excision of a uracil base, forming an abasic site, but leaving the phosphodiester backbone unaffected. The lyase activity of Endonuclease VIII breaks the phosphodiester backbone at the 30 and 50 sides of the abasic site so that the base-free deoxyribose is released.

2.6.4. Generation of recombinant MultiBac bacmid DNA The purified recombinant transfer vectors are fused with the MultiBac bacmid using competent DH10MultiBacCre E. coli cells (i.e. DH10MultiBac expressing the Cre recombinase). pU1 and pU2 baculovirus transfer vectors are integrated with MultiBac BAC by insertion at the Cre-loxP locus. Recombinant MultiBac BAC colonies are selected due to chloramphenicol resistance. DH10MultiBacCre E. coli cells cannot support propagation of pU1 and pU2 vectors. pF1 and pF2 baculovirus transfer vectors are integrated with MultiBac BAC by insertion at the Tn7 locus that disrupts the lacZ gene. Recombinant MultiBac BAC colonies are identified by blue/white selection (white being recombinant).

3. Results We have applied this approach to the assembly of the multisubunit complex anaphase promoting complex or cyclosome (APC/C) that we describe here to illustrate our approach. The APC/C functions as an E3 ubiquitin ligase to regulate the metaphase to anaphase transition and the exit from mitosis [32–35]. The core complex consists of between 13 and 14 different proteins, depending on species, and because of the presence of two copies of certain proteins the complex is comprised of between 17 and 19 subunits [14,24,28]. Previously we reported the expression and reconstitution of recombinant S. cerevisiae using the first generation MultiBac cloning system [14]. In this instance we cloned five and six APC/C genes into two individual pFBDM vectors and two APC/C genes into pUCDM for generation of two baculoviruses which were then combined for co-infection to generate the 13-protein S. cerevisiae APC/C. Here we have generated two baculoviruses for S. cerevisiae APC/C. Fig. 6 shows the scheme for generating the S. cerevisiae APC/ C encoded-baculovirus for recombinant expression. S. cerevisiae APC/C was purified by means of streptactin, ion exchange and size exclusion chromatography. Fig. 7 shows an SDS PAGE gel of recombinant S. cerevisiae APC/C. Acknowledgements

2.6.5. Cell lines Three insect cell lines, namely Sf9, Sf21 (Spodoptera frugiperda) and High 5 Trichoplusia ni) cells are compatible with baculoviruses of the Autographa californica nuclear polyhedrosis virus (AcNPV) Baculoviridae family. We routinely test protein expression levels in Sf9 and High 5 cells. For the APC/C, High 5 cells provided higher expression levels.

2.6.6. Insect cell media In our experience Sf900-II SFM (Life Technologies) for High 5 cells. Media for Sf9 cells: Insect-XPRESS (Lonza).

2.6.7. Co-infections with two or more baculoviruses We successfully generated a single recombinant baculovirus for all 13 S. pombe APC/C genes (a total of 35 Mb of S. pombe APC/C DNA). However we found that efforts to create single baculoviruses for human APC/C (14 genes, a total of 45 Mb human APC/C DNA) and S. cerevisiae APC/C (13 genes, a total of 43 Mb) lead to low virus titres, indicative of virus instability. This suggests that a single recombinant baculovirus is limited to approximately 35 Mb of foreign DNA. To express recombinant human and S. cerevisiae APC/C we co-infect with two recombinant baculoviruses (23.9 Mb + 20.7 Mb for human and 19.4 Mb + 23.5 Mb for S. cerevisiae).

2.6.8. Gene dosage Many multiprotein complexes are comprised of suprastoichiometric subunits. For example, five of the 14 proteins of human APC/C are present as two copes in the complex [14,28]. Although our recombinant baculoviruses are constructed with one copy of each gene, the resultant complexes are assembled with the correct subunit stoichiometry. However, as discussed in Section 2.1.3 it is a simple procedure to assemble cloning vectors with supernumerary copies of specific genes.

2.6.9. Co-lysis of insect cell pellets Assembly of multi-protein complexes is often possible by simply co-lysing insect cell pellets from cultures infected by different recombinant baculoviruses.

The work was funded by a CR-UK Programme grant to D.B. We thank Andreas Boland for critical reading of the manuscript. References [1] G.E. Smith, M.D. Summers, M.J. Fraser, Production of human beta interferon in insect cells infected with a baculovirus expression vector, Mol. Cell. Biol. 3 (1983) 2156–2165. [2] P.T. Wan, M.J. Garnett, S.M. Roe, S. Lee, D. Niculescu-Duvaz, V.M. Good, C.M. Jones, C.J. Marshall, C.J. Springer, D. Barford, R. Marais, Mechanism of activation of the RAF–ERK signaling pathway by oncogenic mutations of B-RAF, Cell 116 (2004) 855–867. [3] Z. Zhang, K. Kulkarni, S.J. Hanrahan, A.J. Thompson, D. Barford, The APC/C subunit Cdc16/Cut9 is a contiguous tetratricopeptide repeat superhelix with a homo-dimer interface similar to Cdc27, EMBO J. 29 (2010) 3733–3744. [4] V.A. Luckow, S.C. Lee, G.F. Barry, P.O. Olins, Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli, J. Virol. 67 (1993) 4566–4579. [5] I. Berger, D.J. Fitzgerald, T.J. Richmond, Baculovirus expression system for heterologous multiprotein complexes, Nat. Biotechnol. 22 (2004) 1583–1587. [6] D.J. Fitzgerald, P. Berger, C. Schaffitzel, K. Yamada, T.J. Richmond, I. Berger, Protein complex expression by using multigene baculoviral vectors, Nat. Methods 3 (2006) 1021–1032. [7] D.J. Fitzgerald, C. Schaffitzel, P. Berger, R. Wellinger, C. Bieniossek, T.J. Richmond, I. Berger, Multiprotein expression strategy for structural biology of eukaryotic complexes, Structure 15 (2007) 275–279. [8] C. Bieniossek, T.J. Richmond, I. Berger, MultiBac: multigene baculovirus-based eukaryotic protein complex production, in: Curr Protoc Protein Sci, Wiley Online Library, John Wiley and Sons, Inc, 2008 (Chapter 5, Unit 5 20). [9] S. Trowitzsch, C. Bieniossek, Y. Nie, F. Garzoni, I. Berger, New baculovirus expression tools for recombinant protein complex production, J. Struct. Biol. 172 (2010) 45–54. [10] C. Bieniossek, T. Imasaki, Y. Takagi, I. Berger, MultiBac: expanding the research toolbox for multiprotein complexes, Trends Biochem. Sci. 37 (2012) 49–57. [11] D. Barford, Y. Takagi, P. Schultz, I. Berger, Baculovirus expression: tackling the complexity challenge, Curr. Opin. Struct. Biol. 23 (2013) 357–364. [12] R.I. Enchev, A. Schreiber, F. Beuron, E.P. Morris, Structural insights into the COP9 signalosome and its common architecture with the 26S proteasome lid and eIF3, Structure 18 (2010) 518–527. [13] T. Imasaki, G. Calero, G. Cai, K.L. Tsai, K. Yamada, F. Cardelli, H. ErdjumentBromage, P. Tempst, I. Berger, G.L. Kornberg, F.J. Asturias, R.D. Kornberg, Y. Takagi, Architecture of the mediator head module, Nature 475 (2011) 240– 243. [14] A. Schreiber, F. Stengel, Z. Zhang, R.I. Enchev, E.H. Kong, E.P. Morris, C.V. Robinson, P.C. da Fonseca, D. Barford, Structural basis for the subunit assembly of the anaphase-promoting complex, Nature 470 (2011) 227–232. [15] W.C. Chao, K. Kulkarni, Z. Zhang, E.H. Kong, D. Barford, Structure of the mitotic checkpoint complex, Nature 484 (2012) 208–213. [16] Z. Zhang, J. Yang, E.H. Kong, W.C. Chao, E.P. Morris, P.C. da Fonseca, D. Barford, Recombinant expression, reconstitution and structure of human anaphasepromoting complex (APC/C), Biochem. J. 449 (2013) 365–371.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003

Z. Zhang et al. / Methods xxx (2015) xxx–xxx [17] C. Bieniossek, G. Papai, C. Schaffitzel, F. Garzoni, M. Chaillet, E. Scheer, P. Papadopoulos, L. Tora, P. Schultz, I. Berger, The architecture of human general transcription factor TFIID core complex, Nature 493 (2013) 699–702. [18] M.A. Schlager, H.T. Hoang, L. Urnavicius, S.L. Bullock, A.P. Carter, In vitro reconstitution of a highly processive recombinant human dynein complex, EMBO J. 33 (2014) 1855–1868. [19] R.M. Benoit, R.N. Wilhelm, D. Scherer-Becker, C. Ostermeier, An improved method for fast, robust, and seamless integration of DNA fragments into multiple plasmids, Protein Expr. Purif. 45 (2006) 66–71. [20] M.Z. Li, S.J. Elledge, Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC, Nat. Methods 4 (2007) 251–256. [21] C. Bieniossek, I. Berger, Towards eukaryotic structural complexomics, J. Struct. Funct. Genomics 10 (2009) 37–46. [22] L.S. Vijayachandran, D.B. Thimiri Govinda Raj, E. Edelweiss, K. Gupta, J. Maier, V. Gordeliy, D.J. Fitzgerald, I. Berger, Gene gymnastics: synthetic biology for baculovirus expression vector system engineering, Bioengineered 4 (2013) 279–287. [23] L.S. Vijayachandran, C. Viola, F. Garzoni, S. Trowitzsch, C. Bieniossek, M. Chaillet, C. Schaffitzel, D. Busso, C. Romier, A. Poterszman, T.J. Richmond, I. Berger, Robots, pipelines, polyproteins: enabling multiprotein expression in prokaryotic and eukaryotic cells, J. Struct. Biol. 175 (2011) 198–208. [24] L. Chang, Z. Zhang, J. Yang, S.H. McLaughlin, D. Barford, Atomic structure of the APC/C and its mechanism of protein ubiquitination, Nature 522 (2015) 450– 454. [25] J. Bitinaite, M. Rubino, K.H. Varma, I. Schildkraut, R. Vaisvila, R. Vaiskunaite, USER friendly DNA engineering and cloning method by uracil excision, Nucleic Acids Res. 35 (2007) 1992–2002.

13

[26] F. Geu-Flores, H.H. Nour-Eldin, M.T. Nielsen, B.A. Halkier, USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products, Nucleic Acids Res. 35 (2007) e55. [27] H.H. Nour-Eldin, B.G. Hansen, M.H. Norholm, J.K. Jensen, B.A. Halkier, Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments, Nucleic Acids Res. 34 (2006) e122. [28] L. Chang, Z. Zhang, J. Yang, S.H. McLaughlin, D. Barford, Molecular architecture and mechanism of the anaphase-promoting complex, Nature 513 (2014) 388– 393. [29] Z. Zhang, S.J. Gurr, A ‘‘step down” PCR-based technique for walking into and the subsequent direct-sequence analysis of flanking genomic DNA, Methods Mol. Biol. 192 (2002) 343–350. [30] R. Feil, S. Muller, F. Hofmann, High-level expression of functional cGMPdependent protein kinase using the baculovirus system, FEBS Lett. 336 (1993) 163–167. [31] D.S. Peabody, Translation initiation at non-AUG triplets in mammalian cells, J. Biol. Chem. 264 (1989) 5031–5035. [32] B.R. Thornton, D.P. Toczyski, Precise destruction: an emerging picture of the APC, Genes Dev. 20 (2006) 3069–3078. [33] D. Barford, Structure, function and mechanism of the anaphase promoting complex (APC/C), Q. Rev. Biophys. 44 (2011) 153–190. [34] J.M. Peters, The anaphase promoting complex/cyclosome: a machine designed to destroy, Nat. Rev. Mol. Cell Biol. 7 (2006) 644–656. [35] M. Sullivan, D.O. Morgan, Finishing mitosis, one step at a time, Nat. Rev. Mol. Cell Biol. 8 (2007) 894–903.

Please cite this article in press as: Z. Zhang et al., Methods (2015), http://dx.doi.org/10.1016/j.ymeth.2015.10.003