Recombinant expression, purification and antimicrobial activity of a novel antimicrobial peptide PaDef in Pichia pastoris

Protein Expression and Purification 130 (2017) 90e99

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Recombinant expression, purification and antimicrobial activity of a novel antimicrobial peptide PaDef in Pichia pastoris De-Mei Meng a, Jing-Fang Zhao a, Xiao Ling a, Hong-Xia Dai a, Ya-Jun Guo a, Xiao-Fang Gao a, Bin Dong a, Zi-Qi Zhang a, Xin Meng d, Zhen-Chuan Fan a, b, c, * a China International Science and Technology Cooperation Base of Food Nutrition/Safety and Medicinal Chemistry, Key Laboratory of Food Nutrition and Safety, Ministry of Education of China, Tianjin University of Science & Technology, Tianjin, 300457, People's Republic of China b Tianjin Food Safety & Low Carbon Manufacturing Collaborative Innovation Center, Tianjin, 300457, People's Republic of China c Obesita & Algaegen LLC, College Station, TX, 77845, USA d College of Biotechnology, Tianjin University of Science & Technology, Tianjin, 300457, People's Republic of China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 June 2016 Received in revised form 29 September 2016 Accepted 8 October 2016 Available online 11 October 2016

The antimicrobial peptide PaDef was isolated from Mexican avocado fruit and was reported to inhibit the growth of Escherichia coli and Staphylococcus aureus in 2013. In this study, an N-terminal 6
His tagged recombinant PaDef (rPaDef) with a molecular weight of 7.5 KDa, for the first time, was expressed as a secreted peptide in Pichia pastoris. The optimal culture condition for rPaDef expression was determined to be incubation with 1.5% methanol for 72 h at 28  C under pH 6.0. Under this condition, the amount of the rPaDef accumulation reached as high as 79.6 mg per 1 ml of culture medium. Once the rPaDef peptide was purified to reach a 95.7% purity using one-step nickel affinity chromatography, its strong and concentration-dependent antimicrobial activity was detected to be against a broad-spectrum of bacteria of both Gram-negative and Gram-positive. The growth of these bacterial pathogens was almost completely inhibited when the rPaDef peptide was at a concentration of as low as 90 mg/ml. In summary, our data showed that rPaDef derived from Mexican avocado fruit can be expressed and secreted efficiently when P. pastoris was used as a cell factory. This is the first report on heterologous expression of PaDef in P. pastoris and the approach described holds great promise for antibacterial drug development. © 2016 Elsevier Inc. All rights reserved.

Keywords: PaDef Antimicrobial peptide Pichia pastoris Secreted expression Antibacterial activity

1. Introduction Antimicrobial peptides (AMPs) generally are short peptides generated by the innate immune system of many different species including animal, plant and even fungus and confer specific immunity against microbial invaders [1,2]. Thus far, AMPs are known to be able to effectively prevent pathogen invasion, possess broad-spectrum antimicrobial activity against Grampositive bacteria, Gram-negative bacteria, fungi, parasites and viruses and were also shown to inhibit the growth of even tumor cells [3e6]. One of the most notable features of AMPs is that

* Corresponding author. College of Food Engineering and Biotechnology, Tianjin University of Science & Technology, No. 29 13rd Rd., Tianjin Economy-andTechnology Development Area, Tianjin, 300457, People's Republic of China. E-mail address: [email protected] (Z.-C. Fan). http://dx.doi.org/10.1016/j.pep.2016.10.003 1046-5928/© 2016 Elsevier Inc. All rights reserved.

these functional short peptides rarely induce bacterial resistance which is a serious problem with conventional antibiotics [7,8]. Therefore, AMPs have emerged as one of the most promising candidates for a new class of antibiotics to be clinically used in the future [9e11]. Preparative isolation of antimicrobial peptides from natural sources is obviously not an economically efficient way since a large quantity of antimicrobial peptides is potentially required for pharmaceutical applications [12,13]. Over the past several decades, several cell factory systems have been applied for the economical production of antimicrobial peptides [14,15]. As one of the major systems, Escherichia coli have been taken advantage to produce recombinant antimicrobial peptides of more than 80% cases globally [15]. However, the problem for this prokaryotic system is that E. coli is not a suitable host for small peptides to be expressed at high concentrations and be recovered from the

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

expression system, especially for the toxic peptides like AMPs [16]. In the past two decades, the methylotrophic yeast, Pichia pastoris, has been developed as an excellent cell factory for largescale expression of proteins including short peptides of different sources [17]. Different from E. coli, P. pastoris serves as an eukaryotic expression system and has been used successfully to produce a large variety of functional recombinant proteins of human, animal, plant, fungal, bacterial and viral origins [18]. There were also numerous reports showed that P. pastoris is a suitable cell factory to produce AMPs including shrimp paenedin, human cathelicidin CAP18LL-37, Enterocin P, Cecropin A and so on [19e22]. Of most importance, the expression of a secreted form of recombinant AMPs in P. pastoris further offers several advantages over bacterial expression systems. These include appropriate folding of AMP molecules, disulfide bond formation and correct execution of post-translational modifications which conserve protein functions [23]. In addition, secretion of recombinant AMPs circumvents intracellular accumulation in P. pastoris cells and simplifies the purification by avoiding contamination with intracellular proteins [24e27]. These advantages together make secreted recombinant AMP production in P. pastoris a popular strategy for scientific research. Persea americana var. drymifolia defensin (PaDef) is a 45 amino acid peptide originally isolated from Mexican avocado fruit in 2013 [28]. The amino acid sequence of PaDef has a sequence homology even as high as 80% to plant defensins, suggesting that PaDef is a type 1 defensin [28]. In the same study, the recombinant PaDef expressed in the bovine endothelial cell line BVE-E6E7 was shown to be able to inhibit the growth of Escherichia coli and Staphylococcus aureus, suggesting that PaDef is a functional AMP against not only Gram-positive bacteria but also Gram-negative bacteria. Regarding the effects on S. aureus viability, they observed a 52e65% inhibition of viability when 100 mg/ml total proteins from clones were used to treat bacteria [28]. In this study, an expression construct with the insertion of an N-terminal 6
His tagged PaDef coding sequence was created in a P. pastoris expression vector pPICZaA backbone and transformed into an engineered yeast strain P. pastoris GS115. By taking advantage of this eukaryotic protein expression system, we seek to investigate, for the first time, whether P. pastoris is a suitable cell factory system of high efficiency to produce functional recombinant PaDef and if so, how broad the antibacterial spectrum of the yeast-expressed recombinant PaDef briefly is by testing it on several representative bacteria of both Gram-positive and Gram-negative. 2. Materials and methods

91

peptone, 1% yeast extract, 100 mM potassium phosphate, 1.34% YNB, 4
105% biotin and 1% methanol, pH 6.0) media. All tested strains in the antimicrobial effect assay were grown at Luria-Bertani (5 g/l yeast extract, 10 g/l tryptone, and 10 g/l NaCl) media. The E. coli cells transformed with plasmids were cultured in low salt Luria-Bertani medium (5 g/l yeast extract, 10 g/l tryptone, and 5 g/l NaCl) containing 25 mg/mL of Zeocin. 2.2. Reagents and materials DNA marker, T4 DNA ligase and the restriction enzymes EcoRI, KpnI and SacI were purchased from Fermentas (Carlsbad, CA, USA). Zeocin™ was obtained from Invitrogen (Carlsbad, CA, USA). The Gel Extraction kit, Plasmid Miniprep kit and Cycle-Pure kit were purchased from Solarbio (Beijing, China). Ni Sepharose™ 6 Fast Flow were obtained from GE Healthcare (Fairfield, MA, USA). Ampicillin was purchased from Solarbio (Beijing, China). Anti-6
His antibody monoclonal antibody was purchased from Beyotime Institute of Biotechnology (Shanghai, China). Peroxidase AffiniPure Goat AntiRat IgG (H þ L) secondary antibody was purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA, USA). Soluble TMB (30 ,30 ,50 ,5'-tetramethylbenzidine) kit was purchased from Beijing ComWin Biotech Co., Ltd. (Beijing, China). 2.3. Recombinant plasmid construction The amino acid (APD ID: AP 02332) and gene (Accession KC007441) sequence of PaDef was obtained from the Antimicrobial Peptide Database (http://aps.unmc.edu/AP/) and GenBank (https:// www.ncbi.nlm.nih.gov/genbank/), respectively. The optimized codon sequence of PaDef for P. pastoris was synthesized by GENEWIZ (Suzhou, China) and inserted into pUC19 vector. To facilitate the upcoming purification of the recombinant PaDef, a 6
His tagencoding sequence was in-frame fused to the 50 -end of the PaDef coding sequence. Other than this, the nucleotide sequence for the restriction site EcoRI were sequentially incorporated at the 50 -end of the synthesized oligonucleotides and the KpnI restriction site sequence were in order added to the 30 -end of the PaDef coding sequence, thus resulting in a 186 bp DNA fragment shown as in Fig. 1A. This DNA fragment was then inserted into pUC19 backbone, resulting in pUC19-PaDef. Afterwards, the inserted fragment was digested with restriction enzymes EcoRI and KpnI and ligated into the linearized pPICZaA (Invitrogen, CA, USA), leading to the generation of the P. pastoris expression vector pPICZaA-PaDef, which was verified by both restriction endonuclease analysis and direct nucleotide sequencing. The strategy for pPICZaA- PaDef construction was shown in Fig. 1B.

2.1. Plasmids, strains and growth medium The yeast expression vector pPICZaA was bought from Invitrogen (Carlsbad, CA, USA). Pichia pastoris strain GS115 (ATCC 20864), Listeria monocytogenes (ATCC 21633), Salmonella (ATCC 10467), Escherichia coli O157 (ATCC 35150), Escherichia coli (ATCC 10305) and Staphylococcus aureus (ATCC 25923) were purchased from America Type Culture Collection (http://www.atcc.org/). Escherichia coli strain XL1-blue (Stratagene, La Jolla, CA, USA) were purchased commercially. Bacillus subtilis strain 151-1, Bacillus subtilis LZZ-133, Bacillus subtilis L300-1, Enterobacter aerogenes, Enterococcus faecalis and Enterobacter sakazakii were gifts from China Agricultural University (Beijing, China). P. pastoris transformants were selected on YPDS (2% peptone, 1% extract yeast, 2% dextrose, 1 M sorbitol and 2% agar) plus Zeocin (100 or 200 mg/ml) agar plates. Shake-flask expression of recombinant PaDef was achieved by growing P. pastoris clones in BMGY (2% tryptone, 1% yeast extract, 1.34% YNB, 4
105% biotin, 1% glycerol and 100 mM potassium phosphate, pH 6.0) and BMMY (2%

2.4. P. pastoris transformation and PCR analysis of P. pastoris transformants P. pastoris was transformed by electroporation as described previously [29]. In brief, 2 mg of SacI-linearized pPICZaA-PaDef was mixed with 80 ml of competent P. pastoris cells. The cell mixture was then transferred to an ice-cold 0.2 cm electroporation cuvette (BioRad Laboratories Inc, Philadelphia, PA, USA) and kept on ice for 5 min. The cell mixture was then pulsed at 1500 V, 25 mF of capacitance and 200 U of resistance for 5 msec by using a Gene Pulser Xcell apparatus (Bio-Rad Laboratories Inc, Philadelphia, PA, USA). One milliliter of ice-cold sorbitol (1 M) was immediately added to the cuvette following electroporation. At last, every 200 ml of aliquots were spread on separate yeast YPDS plates containing 100 mg/ml of Zeocin. Plates were incubated for 2e3 days at 28  C until colonies formed. The rPaDef-positive P. pastoris transformants were screened by

92

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

detecting the genome insertion of the PaDef coding sequence in a colony-PCR assay [30]. In brief, twenty single clonies of Zeocinresistant P. pichia transformants were selected and mixed with 30 ml of 0.2% SDS solution (w/v), respectively, followed by boiling for 10 min to release the genomic DNA of P. pastoris. After centrifugation at 12,000
g for 10 min at 4  C, 1 ml of the culture supernatant was employed for PCR amplification using the pPICZaA vector-targeting primer pair (F: 50 -GGCGAATTCATGCATCATCATCATCATCAC-30 , R: 50 CCCAAGCTTGAATTCGGTACCCTCG AG -30 ). The PCR amplification was performed for 35 cycles at a condition of 95  C for 45 s, 57  C for 30 s and 72  C for 40 s. Mock GS115 containing an empty pPICZaA and the recombinant plasmid pPICZaA-PaDef were used as a negative and positive control, respectively. The PCR products were analyzed by 0.8% agarose gel electrophoresis. Then, the positive transformants were further cultured on new yeast YPDS plates containing 200 mg/ ml of Zeocin to select high-copy expression strains.

2.5. Expression of rPaDef and optimization of culture condition A single rPaDef-positive P. pastoris colony was inoculated into 5 ml of BMGY medium (PH ¼ 6.0) and grown at 28  C in an agitating incubator at 220 rpm for 24 h. The cells were then transfered into 25 ml of BMGY medium to grow to reach an OD600 value between 8.0 and 10.0. Cells were harvested by centrifugation at 3000
g for 5 min and resuspended in 25 ml of BMMY medium (250 ml system) to induce expression of rPaDef by adding pure methanol. Methanol was added every 24 h to reach a final concentration of 1.5% (v/v) during the 144 h induction period. To determine the optimal incubation time to harvest the rPaDef peptide with highest accumulation and antimicrobial activity, the supernatants of the cell cultures were collected at 0, 24, 48, 72, 96, 120 and 144 h postinduction, respectively. Similarly, to determine the influence of the concentration of methanol on rPaDef expression, the supernatant from the cell cultures induced with 0.5, 1.0, 1.5 and 2.0% (v/v) methanol, respectively, was collected at 72 h post-induction. The secreted rPaDef peptide was then quantified by an ELISA assay and determined for its antimicrobial activity as described below.

2.6. ELISA assay for rPaDef protein quantification The 6
His-tagged PaDef protein was quantified by an ELISA (enzyme-linked immunosorbent assay) using an anti-6
His antibody. A standard curve with 0, 50, 200, 600, 1000 ng/ml of 6
His tagged Enoyl-acyl Carrier Protein Reductase (FABI1) (>97% purity, prepared at our own lab) graphed against ELISA signal was created. From this standard curve, the concentration of the 6
Histagged PaDef in the culture supernatants could be determined. Briefly, 96-well ELISA plate was coated with the FABI1 protein or the diluted culture supernatants (100 ml/well). After the plate was washed by 10 mM phosphate buffer (pH 7.4) containing 0.05% Tween-20 for three times (200 ml/well), nonspecific binding sites on the surface were blocked by adding 200 ml of 10 mM phosphate buffer (pH 7.4) containing 5% BSA for each well. The plates were then incubated with 100 ml of the 6
His antibody monoclonal antibody (1:1000 dilution) per well for 1.5 h at 37  C, followed by incubation with 100 ml of HRP-conjugated goat anti-rat IgG (1:10,000 dilution) per well for 1.5 h at 37  C. After the plate was treated with 150 ml of the tetramethylbenzidine substrate solution per well for 30 min at room temperature, the reaction was terminated by adding 50 ml of 0.5 M H2SO4 per well. The OD450 value of each well was read on an ELISA reader (BioTek, Vermont, USA). All assays were carried out in triplicates.

2.7. Purification of rPaDef Affinity purification of rPaDef was performed using a Ni-NTA resin as previously described [31] with minor modifications. In brief, the single yeast colony expressing rPaDef was induced with 1.5% pure methanol for 72 h and then the supernatant was harvested by centrifugation at 3000
g at 4  C for 10 min. After the supernatant was dialysed with a Amicon Ultra centrifugal filter with a molecular weight cut-off of 3 kDa (Millipore, Billerica, MA, USA) in 3 volume of binding buffer (20 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 7.4) to adjust the pH value and remove the medium components, the ultrafiltrate was then incubated overnight with the Ni Sepharose™ 6 Fast Flow resin pre-equilibrated with 1
binding buffer. After the resin was successively rinsed with washing buffer (20 mM NaH2PO4, 300 mM NaCl, pH 7.4) containing 20 and 60 mM imidazole, respectively, for twice, rPaDef peptides were collected by adding 1 ml elution buffer (20 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, pH 7.4) five times. The experiment for purification was performed at a 4  C environment. The eluted fractions were analyzed by Tricine-SDS-PAGE as described below. The purity of the target protein bands was determined by BandScan 5.0 software.

2.8. Tricine-SDS-PAGE and silver staining The rPaDef peptide was detected using Tricine-SDS-PAGE followed by silver staining as described previously [32] with minor modifications. Briefly, 4.0% stacking and 16.5% separating gels were prepared by a vertical slab gel apparatus (Hoefer, Gene Company Limited, Shanghai, China) for concentrating and separating proteins, respectively. An initial voltage of 50 V was used and maintained until all the concentrated proteins have completely entered the stacking gel and resolved as a unified “line”. After that, the voltage was adjusted to 100 V for protein separation in the separating gel. Following electrophoresis, the gel was stained with silver strictly according to the described method [32] and visualized using Gel Documentation system ChampGel 5000 (Sage Creation, Beijing, China).

2.9. Antibacterial activity assay The antibacterial activity of rPaDef was initially demonstrated using an inhibition zone assay [33] performed on S. aureus (ATCC 25923) and B. subtilis151-1. Single colonies of test strains were picked from LB plates, incubated in LB medium and grown at 37  C until the bacterial count reached 2
105e107 CFU/ml. At this point, 500 ml of cell suspension was used to coat LB plates and 6 mm diameter wells were then punched in the LB plate. To perform the assay, 50 ml of the culture supernatant of the cultured rPaDefexpressing yeast colony was loaded into each well while an equal amount of the culture supernatant collected from the cultured rPaDef-negative yeast colony was loaded into another well as a negative control. Ampicillin (25 mg/ml) was loaded into the remaining well as a positive control. After the plate was incubated at 37  C for 12e24 h, the diameters of the cleared zones were measured and expressed as arbitrary units (AU) per ml as the following calculation

AU=ml ¼

Diameter of the zone of clearance ðmmÞ
1000 Volume taken in the well ðmlÞ

Here, the bacterial indicator strain involved in assessment of the antibacterial activity of rPaDef was S. aureus (ATCC 25923). All assays were carried out in triplicates.

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

93

Fig. 1. Construction of the P. pastoris expression plasmid pPICZaA-PaDef. (A) The PaDef nucleotide sequence and its corresponding amino acid sequence. The upper, middle and lower line indicates the native PaDef gene sequence, the codon-optimized PaDef gene sequence and the PaDef amino acid sequence, respectively. Codons optimized according to the P. pastoris codon usage table (http://www.kazusa.or.jp/codon/) are written in blue font. The arrows indicate the EcoRI and KpnI restriction sites. The stop codon is marked by three asterisks. (B) Schematic diagram of the P. pastoris expression plasmid, pPICZaA-PaDef. The nucleotide sequence encoding 6
His-PaDef was attached in-frame to the a-factor secretion signal, downstream of the alcohol oxidase I promoter. a-factor: native Saccharomyces cerevisiae a-mating factor secretion signal; KEX2: the host enzyme cleavage site necessary for proteolytic processing of the S. cerevisiae a-factor sequence; 50 AOX1: the methanol-inducible alcohol oxidase one promoter from P. pastoris; AOX1 TT: P. pastoris AOX1 transcription termination; PTEF1: Transcription elongation factor one gene promoter; PEM7: synthetic prokaryotic promoter; Zeocin: Zeocin resistance gene; pUC ori: replication and maintenance of the plasmid in E. coli; CYC1 TT: transcription termination region; BglII and BamHI restriction endonuclease sites. (C) rPaDef-positive transformant screening by colony-PCR. M: 100 bp DNA marker; C1: pPICZaA-containing GS115 cell as a negative control; Lane 1e20: twenty Zeocin-resistant transformants; C2-C3: pPICZaA-PaDef positive control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

2.10. Growth inhibition rate assay The antibacterial effect of the purified rPaDef was determined using a liquid growth inhibition assay [34]. Six Gram-positive strains including S. aureus (ATCC 25923), B. subtilis 151-1, B. subtilis L300-1, B. subtilis LZZ-133, L. monocytogens (ATCC 21633) and E. faecalis and five Gram-negative strains including Salmonella (ATCC 10467), E. coli O157 (ATCC 35150), E. coli (ATCC 10305), E. aerogenes and E. sakazakii were tested. In brief, 100 ml of the suspension of mid-log phase bacteria (2e7
105 CFU/ml) were incubated with 20 ml of different concentrations ranging from 20 to 120 mg/mL of purified rPaDef for 12e16 h with vigorous agitation at 37  C in a 96well flat-bottom plate. Then, bacterial growth was evaluated by measuring the absorbance (A) of the bacterial culture at 600 nm

using a Synergy H/F multi-mode microplate reader (BioTech, Winooski, VT, USA). Wells containing bacteria without peptide were used as positive controls (A0) and wells containing sterile LB medium without bacteria were used as negative controls (Ai). All assays were carried out in triplicates. Growth inhibition rate was expressed as: Inhibition rate (%) ¼ (A0-A)/(A0-Ai)
100. 2.11. Statistical analysis All the data were presented as mean ± S.D. For statistical analysis, one-way analysis of variance (ANOVA) and Duncan's multiple comparison test were used and carried out with Graphpad Prism 5 (Graphpad, San Diego, CA, USA). Differences with a P < 0.05 were considered statistically significant.

94

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

3. Results 3.1. Vector construction and screening of rPaDef-positive transformants Yeast expression construct pPICZaA-PaDef that contains a 186 bp DNA fragment encoding a recombinant N-terminal 6
Histagged codon-optimized PaDef was created as described in the materials and methods section (Fig. 1A and B). Restriction enzyme analysis showed that double digestion of pPICZaA-PaDef with EcoRI and KpnI resulted in the production of an expected DNA fragment and vector backbone, respectively (data not shown). The plasmid construct was further verified by direct nucleotide sequencing (data not shown). After the verification of the recombinant construct, pPICZaA-PaDef was linearized with SacI first and the SacI-linearized plasmid was afterwards transformed into the competent P. pastoris GS115 cells by electroporation. Zeocinresistant transformants were screened by PCR using pPICZaA vector specific primer and an empty pPICZaA vector transformant was used as the negative control. Finally, 9 Zeocin-resistant P. pichia transformants out of 20 transformants tested were found to contain the insertion of the rPaDef-coding sequence (Fig. 1C). 3.2. Selection of high-copy expression and high antimicrobial activity rPaDef-positive transformants After secondary screening by increasing Zeocine concentration to 200 mg/ml, 8 high-copy expression transformants including 2, 5, 10, 11, 14, 16, 17 and 19 were obtained and were further separately induced by adding 1.5% pure methanol to express the rPaDef peptide and so as to select the transgenic strain with the highest antimicrobial activity for subsequent study. As shown in Fig. 2A, inhibition zone assay showed that secreted proteins from all the rPaDef-positive transformants except for transformants 16 and 19 were able to inhibit the growth of S. aureus (ATCC 25923) and B. subtilis 151-1. Amongest these, the culture supernatant of transformant 5 exhibited the strongest antimicrobial activity with an antibacterial effect about 68.8% for S. aureus and 62.5% for B. subtilis, respectively, as compared to ampicillin (Fig. 2B). Hence, transformant 5 was chosen to be used for further studies. 3.3. Expression of recombinant PaDef and optimization of induction time Since pPICZaA-PaDef was expected to direct the generation of a secreted rPaDef, the culture supernatant of transformant 5 was collected once every 24 h for 6 continuous days to monitor the rPaDef production. As determined by Tricine SDS-PAGE and silver staining, a major band of about 7.5 KDa started to be observed as early as 24 h post-induction followed by an increased production until 120 h post-induction. After that, continuous induction did not cause significant increase in rPaDef production as indicated by testing at 144 h post-induction (Fig. 3A). In accordance with this, ELISA assay determined the secreted rPaDef in the culture supernatant to be 19.4 mg/ml at 24 h post-induction. The maximal production of the rPaDef was 87.2 mg/ml as determined at 120 h postinduction (Fig. 3B). At this time point, the rPaDef was estimated to count for 89% of the total secreted protein (BandScan software, version 5.0). This result demonstrated that the rPaDef peptide was successfully expressed and secreted out of yeast cells and the expression level of the rPaDef peptide in yeast is time-related. Secretion of the rPaDef peptide into the culture supernatant suggested that the signal peptide had been removed from the N-terminus of rPaDef, in agreement with its size of approximate 7.5 KDa as observed in Tricine-SDS-PAGE assay. By observing the expression

Fig. 2. Selection of rPaDef-positive transformants with high antimicrobial activity against S. aureus (ATCC 25923) and B. subtilis 151-1. (A) Inhibition zone assays. (þ) indicates ampicillin (25 mg/ml) as a positive control; () represents the supernatant from empty pPICZaA vector-containing P. pastoris cell culture as a negative control; 2, 5, 10, 11, 14, 16, 17 and 19 indicate the supernatants from different rPaDef-positive transformants. (B) Quantitation of the antimicrobial effect of rPaDef compared with ampicillin (25 mg/ml). The value was shown as a percentage of the diameter of the inhibition zone caused by the culture supernatant to that by the positive control. Data were shown as mean ± S.D., n ¼ 3.

and secretion of the rPaDef peptide in the culture supernatant, we next tested the antimicrobial activity of the rPaDef-containing culture supernatant against S. aureus (ATCC 25923) and B. subtilis 151-1. As reflected in Fig. 3C, the culture supernatants after 72, 96 and 120 h induction could effectively inhibit the growth of S. aureus (ATCC 25923) and B. subtilis 151-1 by forming clear inhibition zones, which showed that the yeast-deriving rPaDef obtained at the three time points, was all functionally active. As compared to the diameter of the inhibition zone caused by the positive control ampicillin (25 mg/ml), their antibacterial abilities were calculated to be about 62.5%, 65.6% and 56.2% for S. aureus (ATCC 25923) and 51.6%, 56.2% and 54.3% for B. subtilis 151-1, respectively (Fig. 3D). The antibacterial activity of the culture supernatants did not show significant difference between 72 h, 96 h and 120 h induction (P > 0.05). Taken the above results together and considering the time and energy consumption, 72 h was thus selected as the optimal induction time for rPaDef expression in P. pastoris. 3.4. Optimization of methanol concentration for rPaDef expression Methanol is a critical factor to determine the expression level of the pPICZaA-containing foreign genes in P. pastoris as the alcohol oxidase (AOX1) promoter activity replies on methanol induction (see the vector elements as shown in Fig. 1B). Again, the expression of the inserted genes at a high level depends on the usage of methanol as the sole carbon source as the AOX1 promoter is repressed by many carbon sources other than methanol [35]. On

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

the other hand, control of the methanol concentration at an appropriate level can avoid accumulation of formaldehyde, which is toxic to yeast cells. To optimize the methanol concentration to obtain a highest expression of rPaDef, four methanol concentrations including 0.5, 1.0, 1.5 and 2.0% (v/v) were chosen to induce rPaDef expression. The other culture conditions remained the same except that the cultivation time was fixed to 72 h. After the culture supernatants were collected, the secreted rPaDef accumulation was first determined and found that 1.5% methanol induction produced a rPaDef concentration of 79.6 mg/ml in the culture supernatant, which was significantly higher than that of 0.5% (31.9 mg/ml), 1.0% (51.6 mg/ml) and 2.0% (68.6 mg/ml) methanol induction (Fig. 4A), indicating that 1.5% methanol can induce the highest level of secreted rPaDef peptide. After that, antibacterial ability of the culture supernatants against S. aureus (ATCC 25923) was determined in an inhibition assay. The culture supernatant under induction by 0.5% methanol did not cause an observable inhibition zone. Instead, three other induction conditions all led to the appearance of inhibition zones with different diameters. As calculated from the diameter of the inhibition zones, 1.5% methanol induction led to a strongest antibacterial effect (70.0%), which was obviously higher than that induced by 1.0% (52.4%) and 2.0% (65.7%) methanol (Fig. 4B). Our data thus clearly showed that rPaDef accumulation in P. pastoris culture medium is strictly related to the methanol concentration change and 1.5% methanol (v/v) was the optimal concentration to induce a highest expression of the functional rPaDef peptide.

3.5. Purification of the rPaDef peptide and determination of its antibacterial spectrum and ability To determine the antibacterial spectrum and ability of the

95

rPaDef peptide, we cultivated the rPaDef-expressing P. pastoris G115 cells for 72 h at a condition of 1.5% (v/v) methanol, 28  C, 220 rpm and pH ¼ 6.0 in a 250 ml flask and collected the culture supernatant subsequently. After dialysis in a 20 mM sodium phosphate buffer containing 300 mM NaCl and 10 mM imidazole (pH 7.4), the 6
His-tagged rPaDef was purified by affinity purification using the Ni Sepharose™ 6 Fast Flow resin. After purification, the activity of rPaDef increased to 286.2 AU/ml. The purification fold was 36.6 fold higher than that of the supernatant. The antibacterial activity, yield and purification fold of rPaDef are summarized in Table 1. As visualized by Tricine-SDS-PAGE followed by silver-staining, a single band with a molecular weight of approximate 7.5 KDa was observed as expected (Fig. 5A). Overall, approximate 16.4 mg rPaDef was obtained from 500 ml of cell culture medium and 95.7% purity was achieved (Fig. 5A). After the eluted fractions were collected and dialyzed against 50 mM sodium phosphate buffer (pH 7.0), they were first used to evaluate their antibacterial activity by an inhibition zone assay. In accordance with the culture supernatants (Figs. 2A and 3C), purified rPaDef peptide also exhibited strong inhibition ability against S. aureus (ATCC 25923) and B. subtilis 151-1 and the increased concentration of peptide caused larger diameter of clear inhibition zones (Fig. 5B). Then, a liquid growth inhibition assay was performed to investigate the antibacterial spectrum of purified rPaDef peptide using six Gram-positive bacteria and five Gram-negative bacteria. As listed in Table 2, the rPaDef peptide showed a potent activity against both the Gram-positive and Gram-negative bacteria and the growth of all tested strains was almost completely inhibited when they were challenged with 120 mg/ml of purified rPaDef peptide (>97%). Among them, E. faecalis, E. sakazakii and E. coli (ATCC 10305) were the most sensitive bacteria to rPaDef as their growth was inhibited >83% of growth at 40 mg/ml of rPaDef.

Fig. 3. Effect of induction time on rPaDef expression and antibacterial activity. (A) Tricine-SDS-PAGE of rPaDef expression in the culture supernatant from the rPaDef-expressing P. pastoris transformant 5 in shake-flask cultures. M: Low range pre-stained protein ladder; lanes 1e7: a total of 12 ml of supernatant samples taken at 0, 24, 48, 72, 96, 120, 144 h of induction by 1.5% (v/v) pure methanol, respectively; The molecular weight of each band of the protein marker was labeled on the left of the panel. (B) Quantitation of the effect of induction time on the expression level of the secreted rPaDef peptide. The same letter (a, b, c, d) indicates no statistical difference between induction time points and different letters indicate statistical difference between induction time points (P < 0.05). (C) Effect of induction time on antimicrobial activity of the rPaDef peptide against S. aureus (ATCC 25923) and B. subtilis 151-1. (þ) indicates ampicillin (25 mg/ml) as a positive control; () represents the culture supernatant from empty pPICZaA vector-containing P. pastoris cell culture as a negative control; 0, 24, 48, 72, 96, 120 and 144 indicate different induction hours by 1.5% (v/v) pure methanol. (D) Quantitation of the antimicrobial effect of the culture supernatants collected at different time points post-induction as compared to the positive control ampicillin (25 mg/ml). The value was shown as a percentage of the diameter of the inhibition zone caused by the culture supernatant to that by the positive control. Data were shown as mean ± S.D., n ¼ 3.

96

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

Fig. 4. Effect of methanol concentration on the rPaDef expression and antimicrobial activity at 72 h post-induction. (A) The secreted rPaDef level changes in the culture supernatants induced by different methanol concentrations. Different letters (a, b, c, d) indicate statistical difference between induction concentrations of methanol (p < 0.05). (B) Quantitation of the antimicrobial effect against S. aureus (ATCC 25923) of the supernatants induced by different methanol concentrations as compared to the positive control ampicillin (25 mg/ml). The value was shown as a percentage of the diameter of the inhibition zone caused by the culture supernatant to that by the positive control. For panels A and B, data were shown as mean ± S.D., n ¼ 3.

Regarding the effects on L. monocytogenes (ATCC 21633), E. coli O157 (ATCC 35150), E. aerogenes and E. coli (ATCC 10305), we observed an >91.7% inhibition of growth when bacteria were treated with 60 mg/ml of rPaDef. Salmonella (ATCC 10467) growth was only 12.5% inhibited at 60 mg/ml of rPaDef but was more evident at 90 mg/ml with 97% inhibition. Similar antibacterial effect was obtained for S. aureus (ATCC 25923), B. subtilis L300-1 and B. subtilis Lzz-133 with 95.5%, 98.8% and 99.6% inhibition rates, respectively, when treated with 90 mg/ml of rPaDef. As compared to the above strains, B. subtilis 151-1 was the least sensitive to rPaDef and only 54.9% of growth was inhibited at 90 mg/ml of purified rPaDef. These results showed that the P. pastoris-derived defensin PaDef have potential antibacterial activity against human and animal pathogens. 4. Discussions Plant defensins are small, basic and cysteine-rich antimicrobial peptides that are important components of plant defense against

various pathogens [36]. In 2013, PaDef, a type 1 defensin homologue was isolated from avocado fruit. Similar to other plant defensins, PaDef has a characteristic three-dimensional folding pattern and stabilized by four disulfide bridges, which form a cysteine-stabilized alpha-helix beta-strand motif. It was observed that the recombinant PaDef expressed as a fusion protein in the endothelial cell line BVE-E6E7 inhibited >55% and 52e65% of growth of E. coli and S. aureus, respectively, when 100 mg/ml of total proteins from clones were used to treat bacteria [28]. These results generated a great interest in building an efficient prokaryotic or eukaryotic expression system to produce massive PaDef through the use of recombinant DNA procedures. In this study, the PaDef protein was first attempted to be expressed in E. coli by constructing the E. coli expression vectors pET28a (þ)-PaDef and pGEXPaDef. After IPTG induction all the fusion protein were expressed as soluble proteins in an abundant level. However, functional analysis showed that both fusion proteins did not inhibit the growth of the bacteria used in this study (data not shown). The reason may be because the prokaryotic expression system lacks post-translational modifications such as protein glycosylation, processing, and folding that occur in a eukaryotic expression system [37]. Recently, methylotrophic yeast, P. pastoris, has been developed as a useful host for the high-level expression of heterologous peptides and an eukaryotic system favoring correct cysteine-bond formation, protein correct folding and consequently protein full activity [38]. There are several reports have corroborated that yeast expression systems are adequate to produce active defensins, such as the pea defensin Drr230a [39], the wild tobacco defensin NmDef02 [40], the corn defensin PDC1 [41], the dimeric defensin SPE10 [42] and the mungbean defensin VrD1 [43]. Therefore, our study made next attempt to efficiently produce the PaDef peptide in P. pastoris. To do so, the pPICZaA vector, which could facilitate the integration of several copies of the gene of interest into the chromosome of P. pastoris and result in high-level expression of the target proteins, was used. Besides, a total of 28 codons of the PaDef gene were first optimized without changing the original amino acid sequences based on the preferential codon usage of P. pastoris as codon preference varies with species and ineffective expression of exogenous genes in the host may be achieved [44]. It has been found that codon optimization such as the usage frequency of preferred codons in P. pastoris can enhance the expression level of exogenous genes [45]. Through codon optimization, the activity of Penicillium expansum lipase expressed in P. pastoris was increased to 2.3e2.5 times greater than that of the wild lipase [46]. As expected, the target peptide rPaDef (approx. 7.5 KDa) was successfully expressed in P. pastoris with relatively high yield and antibacterial activity (Figs. 3 and 4, Table 2), indicating that the P. pastoris system was suitable to produce active rPaDef. It has been established that the antimicrobial activity of plant defensins is mainly directed against fungi [47e49], such as Lc-def, an active defensin against fungi but not against bacteria [50]. However, the PaDef expressed in BVE-E6E7 was found with out antifungal activity against C. albicans. In this study, the antimicrobial activity of the rPaDef only occurred to bacteria and a strong and concentration-dependent antimicrobial effect against both the Gram-positive and Gram-negative bacteria was observed (Table 2).

Table 1 Purification summary for rPaDef. Step

Volume (ml)

Activity (AU/ml)

Total protein (mg)

Total activity (AU)

Specific activity (AU/mg)

Yield (%)

Purification (fold)

Culture supernatant Affinity purification

50 4

180.2 286.2

4.9 1.7

9010 1144.8

1838.8 673.4

100 12.7

1 36.6

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

Fig. 5. Purified rPaDef peptide and its antimicrobial activity. (A) Silver-stained TricineSDS-PAGE analysis of the purified rPaDef peptide. M: Low range pre-stained protein ladder; Lane 1: Flow through fractions; Lane 2e3: Wash fractions with 20 and 60 mM imidazole, respectively; Lane 4e8: Elution fractions with 500 mM imidazole. The molecular weight of each band of the protein marker was labeled on the left of the panel. (B) Antimicrobial activity of the purified rPaDef peptide against S. aureus (ATCC 25923) and B. subtilis 151-1. (þ) indicates ampicillin (25 mg/ml) as a positive control; () represents 50 mM sodium phosphate buffer (pH 7.0) as a negative control; 1, 2, 3 and 4 indicate 40, 60, 90 and 120 mg/ml purified rPaDef peptide, respectively, in 50 mM sodium phosphate buffer (pH 7.0).

Table 2 Antimicrobial effect of the purified rPaDef against several tested bacterial strains. Tested strains

Inhibition rate (%) Purified rPaDef (mg/ml)

Gram-positive L. monocytogenes (ATCC 21633) S. aureus (ATCC 25923) B. subtilis 151-1 B. subtilis L300-1 B. subtilis Lzz-133 E. faecalis Gram-negative E. coli O157 (ATCC 35150) Salmonella (ATCC 10467) E. aerogenes E. sakazakii E. coli (ATCC 10305)

20

40

60

90

120

36.1 0 25.8 0 14.2 9.8

40.3 0 45.6 2.6 31.7 83

91.7 64.9 46.3 12.5 45.2 94.2

97.5 95.5 54.9 98.8 99.6 99.7

99.0 99.1 97.4 99.5 99.7 99.8

0 0 8.4 5.8 10.7

8.5 0 33.5 97 98.5

97.7 12.5 97 98.6 98.7

99.3 97 99.2 99.3 99

99.9 99.5 99.7 99.4 99.2

97

yeast-expressing peptide that have been shown to inhibit the bacterial pathogens S. aureus with a minimum concentration of 50 mg/ml, such as plectasin (64 mg/ml) [51] and human epididymis protein 4 (>100 mg/ml) [52]. Besides, the rPaDef also displayed strong antibacterial activity against many other pathogens including L. monocytogenes (ATCC 21633), E. faecalis, E. aerogenes, E. sakazakii and Salmonella (ATCC 10467) with >97% inhibition rate when treated at a concentration of 90 mg/ml, indicating that the P. pastoris-derived rPaDef has a broad spectrum of antibacterial activities against common bacterial pathogens. The differential antibacterial effects may be attributing to the differences in the structure of the membrane and cell walls of these organisms. In this study, we also found that there was probably a close relationship between the yield and the biological activity of the rPaDef peptide. As shown in Figs. 3 and 4, there were no clear inhibition zones formed when treated with the cell culture supernatants at 24 (19.4 mg/ml) and 48 h (49.1 mg/ml) with 1.0% methanol induction and at 72 h (31.9 mg/ml) with 0.5% methanol induction. However, the antimicrobial activity increased to 50e70% for S. aureus (ATCC 25923) and 50e60% for B. subtilis 151-1, respectively, as compared to ampicillin (25 mg/ml) when the rPaDef in the cell culture supernatants reached up to 51.6e87.3 mg/ml. This result indicated that, only when >50 mg/ml rPaDef peptide was present in the cell culture supernatants the clear inhibition zones otherwise cannot form. Not only S. aureus (ATCC 25923) and B. subtilis 151-1, the continuous increasing in the antibacterial activity against nine other bacteria (0e99.9% of inhibition rate) was also observed along with the increased concentration of the purified rPaDef (20e120 mg/ml), implying that the antimicrobial activity of the rPaDef was correlated with the peptide concentration (Table 2). However, it should be pointed out that, although the expression level of the rPaDef was relatively higher in the cell culture supernatant (87.3 mg/ml) at 120 h post-induction than that at 96 h postinduction (79.6 mg/ml), the antimicrobial activity of the rPaDef against S. aureus (ATCC 25923) and B. subtilis 151-1 was comparatively lower in the cell culture supernatants at 120 h post-induction than that at 96 h post-induction. In particular, the rPaDefcontaining cell culture supernatants at 144 h post-induction (85.4 mg/ml) did not show any antibacterial activity, suggesting that some metabolic substances inhibitory to the rPaDef may start to exist in the late cell culture stage. Besides, high concentrations of methanol is toxic to P. pastoris cells owing to the accumulation of formaldehyde and hydrogen peroxide inside the cells [53]. The concentration of methanol higher than 1.5% (v/v) could have a negative effect on the protein expression and antibacterial activity of the rPaDef. Hence, taking full account of the antimicrobial activity and the production of the rPaDef, 72 h with 1.5% (v/v) methanol concentration was chosen as the optimal condition for rPaDef expression and the yield of rPaDef reached 79.6 mg/ml. Additionally, under the optimal condition, the rPaDef possessed 81.3% of the total secreted proteins (Fig. 3A), which largely facilitated the purification of the rPaDef. Thus, a higher level of P. pastoris-derived rPaDef with 95.7% purity was achieved using one-step nickel affinity chromatography (Fig. 5A). 5. Conclusions

Other than this, it was also noticed that the P. pastoris-derived rPaDef exhibited a greater antibacterial activity against E. coli and S. aureus than the rPaDef expressed in BVE-E6E7 [28]. The viability of E. coli O157 (ATCC 35150) and E. coli (ATCC 10305) was thoroughly inhibited with 60 and 40 mg/ml of the purified rPaDef, respectively. S. aureus (ATCC 25923) viability was thoroughly inhibited at 90 mg/ ml of the purified rPaDef, which was consistent with other reported

In the current study, a novel antimicrobial peptide, PaDef, was designed and successfully expressed in P. pastoris. A total of 16.4 mg of the recombinant PaDef was obtained with a 95.7% purity from 500 ml of cell culture medium after affinity purification and the rPaDef showed strong antimicrobial activity against all the microorganisms tested herein including the most common Grampositive and Gram-negative bacteria. These results suggest that

98

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99

the rPaDef could be a promising antibiotic candidate against pathogenic bacteria. In addition, due to the efficient expression and desirable antimicrobial activities of the rPaDef, GS115/pPICZaAPaDef thus can be applied for a large-scale production of the rPaDef. Acknowledgements This work was supported jointly by grants from Natural Science Foundation of Tianjin City (No. 13JCYBJC41900), International Center for Genetic Engineering and Biotechnology (No. CRP/ CHN15-01), National Natural Science Foundation of China (No. 31501544) and Science and Technology Commissioner Foundation of Tianjin (15JCTPJC56200). References [1] M. Zasloff, Antimicrobial peptides of multicellular organisms, Nature 415 (2002) 389e395. [2] X. Zhao, H. Wu, H. Lu, G. Li, Q. Huang, LAMP: a database linking antimicrobial peptides, PloS One 8 (2013) e66557. [3] J.M. Conlon, Reflections on a systematic nomenclature for antimicrobial peptides from the skins of frogs of the family Ranidae, Peptides 29 (2008) 1815e1819. [4] K. Radek, R. Gallo, Antimicrobial peptides: natural effectors of the innate immune system, Semin. Immunopathol. 29 (2007) 27e43. [5] C. Li, H.M. Blencke, V. Paulsen, T. Haug, K. Stensvag, Powerful workhorses for antimicrobial peptide expression and characterization, Bioeng. Bugs 1 (2010) 217e220. [6] H.L. Chu, B.S. Yip, K.H. Chen, H.Y. Yu, Y.H. Chih, H.T. Cheng, Y.T. Chou, J.W. Cheng, Novel antimicrobial peptides with high anticancer activity and selectivity, PloS One 10 (2015) e0126390. [7] D.G. Lee, J.H. Park, S.Y. Shin, S.G. Lee, M.K. Lee, K.L. Kim, K.S. Hahm, Design of novel analogue peptides with potent fungicidal but low hemolytic activity based on the cecropin A-melittin hybrid structure, Biochem. Mol. Biol. Int. 43 (1997) 489e498. [8] Z.Y. Ong, N. Wiradharma, Y.Y. Yang, Strategies employed in the design and optimization of synthetic antimicrobial peptide amphiphiles with enhanced therapeutic potentials, Adv. Drug. Deliv. Re 78 (2014) 28e45. [9] B. Deslouches, J.D. Steckbeck, J.K. Craigo, Y. Doi, J.L. Burns, R.C. Montelaro, Engineered cationic antimicrobial peptides to overcome multidrug resistance by ESKAPE pathogens, Antimicrob. Agents. Ch 59 (2015) 1329e1333. [10] B. Becknell, A. Schwaderer, D.S. Hains, J.D. Spencer, Amplifying renal immunity: the role of antimicrobial peptides in pyelonephritis, Nat. Rev. Nephrol. 11 (2015) 642e655. [11] J.P. da Costa, M. Cova, R. Ferreira, R. Vitorino, Antimicrobial peptides: an alternative for innovative medicines? Appl. Microbiol. Biot. 99 (2015) 2023e2040. [12] R.E. Hancock, H.G. Sahl, Antimicrobial and host-defense peptides as new antiinfective therapeutic strategies, Nat. Biotechnol. 24 (2006) 1551e1557. [13] C. Li, T. Haug, O.B. Styrvold, T.O. Jorgensen, K. Stensvag, Strongylocins, novel antimicrobial peptides from the green sea urchin, Strongylocentrotus droebachiensis, Dev. Comp. Immunol. 32 (2008) 1430e1440. [14] A.B. Ingham, R.J. Moore, Recombinant production of antimicrobial peptides in heterologous microbial systems, Biotechnol. Appl. Biochem. 47 (2007) 1e9. [15] Y. Li, Z. Chen, RAPD: a database of recombinantly-produced antimicrobial peptides, FEMS Microbiol. Lett. 289 (2008) 126e129. [16] B.C. Bryksa, L.D. MacDonald, A. Patrzykat, S.E. Douglas, N.R. Mattatall, A Cterminal glycine suppresses production of pleurocidin as a fusion peptide in Escherichia coli, Protein Expr. Purif. 45 (2006) 88e98. [17] E.V. Valore, T. Ganz, Laboratory production of antimicrobial peptides in native conformation, Methods Mol. Biol. 78 (1997) 115e131. [18] J.M. Cregg, J.L. Cereghino, J. Shi, D.R. Higgins, Recombinant protein expression in Pichia pastoris, Mol. Biotechnol. 16 (2000) 23e52. [19] D. Mattanovich, P. Branduardi, L. Dato, B. Gasser, M. Sauer, D. Porro, Recombinant protein production in yeasts, Methods Mol. Biol. 824 (2012) 329e358. [20] I.P. Hong, S.J. Lee, Y.S. Kim, S.G. Choi, Recombinant expression of human cathelicidin (hCAP18/LL-37) in Pichia pastoris, Biotechnol. Lett. 29 (2007) 73e78. [21] J. Gutierrez, R. Criado, M. Martin, C. Herranz, L.M. Cintas, P.E. Hernandez, Production of enterocin P, an antilisterial pediocin-like bacteriocin from Enterococcus faecium P13, in Pichia pastoris, Antimicrob. Agents. Ch 49 (2005) 3004e3008. [22] F. Jin, X. Xu, W. Zhang, D. Gu, Expression and characterization of a housefly cecropin gene in the methylotrophic yeast, Pichia pastoris, Protein Expr. Purif. 49 (2006) 39e46. [23] J.M. Cregg, I. Tolstorukov, A. Kusari, J. Sunga, K. Madden, T. Chappell, Expression in the yeast Pichia pastoris, Method Enzymol. 463 (2009) 169e189. [24] R. Daly, M.T. Hearn, Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production. Journal of molecular recognition, JMR 18 (2005) 119e138.

[25] L.M. Damasceno, I. Pla, H.J. Chang, L. Cohen, G. Ritter, L.J. Old, C.A. Batt, An optimized fermentation process for high-level production of a single-chain Fv antibody fragment in Pichia pastoris, Protein Expr. Purif. 37 (2004) 18e26. [26] E.C. de Bruin, E.H. Duitman, A.L. de Boer, M. Veenhuis, I.G. Bos, C.E. Hack, Pharmaceutical proteins from methylotrophic yeasts, Methods Mol. Biol. 308 (2005) 65e76. [27] M.A. Romanos, C.A. Scorer, J.J. Clare, Foreign gene expression in yeast: a review, Yeast 8 (1992) 423e488. [28] J.J. Guzman-Rodriguez, R. Lopez-Gomez, L.M. Suarez-Rodriguez, R. SalgadoGarciglia, L.C. Rodriguez-Zapata, A. Ochoa-Zarzosa, J.E. Lopez-Meza, Antibacterial activity of defensin PaDef from avocado fruit (Persea americana var. drymifolia) expressed in endothelial cells against Escherichia coli and Staphylococcus aureus, Biomed. Res. Int. 2013 (2013) 986273. [29] J. Lin-Cereghino, W.W. Wong, S. Xiong, W. Giang, L.T. Luong, J. Vu, S.D. Johnson, G.P. Lin-Cereghino, Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris, Biotechniques 38 (2005) 44, 46, 48. [30] B. Pardesi, G.R. Tompkins, Colony polymerase chain reaction of hemeaccumulating bacteria, Anaerobe 32 (2015) 49e50. [31] Y. Zhang, S. Zhang, L. Xian, J. Tang, J. Zhu, L. Cui, S. Li, L. Yang, J. Huang, Expression and purification of recombinant human neuritin from Pichia pastoris and a partial analysis of its neurobiological activity in vitro, Appl. Microbiol. Biotechnol. 99 (2015) 8035e8043. [32] H. Schagger, Tricine-SDS-PAGE, Nat. Protoc. 1 (2006) 16e22. [33] F. Fan, Y. Wu, J. Liu, Expression and purification of two different antimicrobial peptides, PR-39 and Protegrin-1 in Escherichia coli, Protein Expr. Purif. 73 (2010) 147e151. [34] Z.G. Tian, T.T. Dong, D. Teng, Y.L. Yang, J.H. Wang, Design and characterization of novel hybrid peptides from LFB15(W4,10), HP(2-20), and cecropin A based on structure parameters by computer-aided method, Appl. Microbiol. Biotechnol. 82 (2009) 1097e1103. [35] J.M. Cregg, T.S. Vedvick, W.C. Raschke, Recent advances in the expression of foreign genes in Pichia pastoris, Biotechnol. N Y 11 (1993) 905e910. [36] E.D.O. Mello, I.S. dos Santos, A.D.O. Carvalho, L.S. de Souza, G.A. de Souza-Filho, V.V. do Nascimento, O.L.T. Machado, U. Zottich, V.M. Gomes, Functional expression and activity of the recombinant antifungal defensin PvD1r from Phaseolus vulgaris L. (common bean) seeds, BMC Biochem. 15 (2014), 7e7. [37] S.J. Kim, R. Quan, S.J. Lee, H.K. Lee, J.K. Choi, Antibacterial activity of recombinant hCAP18/LL37 protein secreted from Pichia pastoris, J. Microbiol. 47 (2009) 358e362. [38] A.L. Demain, P. Vaishnav, Production of recombinant proteins by microbes and higher organisms, Biotechnol. Adv. 27 (2009) 297e306. [39] A.F. Lacerda, R.P. Del Sarto, M.S. Silva, E.A. Rosas de Vasconcelos, R.R. Coelho, V.O. dos Santos, C.V. Godoy, C.D. Santos Seixas, M.C. Mattar da Silva, M.F. Grossi-de-Sa, The recombinant pea defensin Drr230a is active against impacting soybean and cotton pathogenic fungi from the genera Fusarium, Colletotrichum and Phakopsora, 3 Biotech. 6 (2016) 59. [40] R. Portieles, C. Ayra, E. Gonzalez, A. Gallo, R. Rodriguez, O. Chacon, Y. Lopez, M. Rodriguez, J. Castillo, M. Pujol, G. Enriquez, C. Borroto, L. Trujillo, B.P.H.J. Thomma, O. Borras-Hidalgo, NmDef02, a novel antimicrobial gene isolated from Nicotiana megalosiphon confers high-level pathogen resistance under greenhouse and field conditions, Plant Biotechnol. J. 8 (2010) 678e690. [41] P. Kant, W.Z. Liu, K.P. Pauls, PDC1, a corn defensin peptide expressed in Escherichia coli and Pichia pastoris inhibits growth of Fusarium graminearum, Peptides 30 (2009) 1593e1599. [42] X.M. Song, J. Wang, F. Wu, X. Li, M.K. Teng, W.M. Gong, cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds, Plant Mol. Biol. 57 (2005) 13e20. [43] J.J. Chen, G.H. Chen, H.C. Hsu, S.S. Li, C.S. Chen, Cloning and functional expression of a mungbean defensin VrD1 in Pichia pastoris, J. Agr. Food Chem. 52 (2004) 2256e2261. [44] C. Gustafsson, S. Govindarajan, J. Minshull, Codon bias and heterologous protein expression, Trends Biotechnol. 22 (2004) 346e353. [45] M. Kloster, C. Tang, SCUMBLE: a method for systematic and accurate detection of codon usage bias by maximum likelihood estimation, Nucleic Acids Res. 36 (2008) 3819e3827. [46] Z. Zhang, J. Yang, L. Xu, Y. Liu, Y. Yan, Cloning, codon optimization and expression of mature lipase gene Penicillium expansum, Wei sheng wu xue bao Acta Microbiol. Sin. 50 (2010) 228e235. [47] E.A. Rogozhin, Y.I. Oshchepkova, T.I. Odintsova, N.V. Khadeeva, O.N. Veshkurova, T.A. Egorov, E.V. Grishin, S.I. Salikhov, Novel antifungal defensins from Nigella sativa L. seeds, Plant Physiol. Biochem. 49 (2011) 131e137. [48] A. de Beer, M.A. Vivier, Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes, BMC Res. Notes 4 (2011), 459e459. [49] X. Wu, J. Sun, G. Zhang, H. Wang, T.B. Ng, An antifungal defensin from Phaseolus vulgaris cv. ‘Cloud Bean’, Phytomedicine 18 (2011) 104e109. [50] Z.O. Shenkarev, A.K. Gizatullina, E.I. Finkina, E.A. Alekseeva, S.V. Balandin, K.S. Mineev, A.S. Arseniev, T.V. Ovchinnikova, Heterologous expression and solution structure of defensin from lentil Lens culinaris, Biochem. Biophys. Res. Commun. 451 (2014) 252e257. [51] X. Chen, Y.H. Hu, W.D. Chen, W.D. Li, Z.C. Huang, Y. Li, Y.W. Luo, Y.X. Huang, Y.T. Chen, K. Wang, L. Li, Comparison of inducible versus constitutive

D.-M. Meng et al. / Protein Expression and Purification 130 (2017) 90e99 expression of plectasin on yields and antimicrobial activities in Pichia pastoris, Protein Expr. Purif. 118 (2016) 70e76. [52] L. Hua, Y. Liu, S. Zhen, D. Wan, J. Cao, X. Gao, Expression and biochemical characterization of recombinant human epididymis protein 4, Protein Expr.

99

Purif. 102 (2014) 52e62. [53] X. Mu, N. Kong, W. Chen, T. Zhang, M. Shen, W. Yan, High-level expression, purification, and characterization of recombinant human basic fibroblast growth factor in Pichia pastoris, Protein Expr. Purif. 59 (2008) 282e288.