- Email: [email protected]
Recombinant forms of Gerbich blood group antigens: expression and purification
Transfus Clin Biol 2002 ; 9 : 121-9 © 2002 Éditions scientifiques et médicales Elsevier SAS. Tous droits réservés S1246782002002331/FLA
ORIGINAL ARTICLE
Recombinant forms of Gerbich blood group antigens: expression and purification E. Jaskiewicz1*, M. Czerwinski1, Y. Colin2, E. Lisowska1 1 Department of Immunochemistry, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Weigla 12, 53-114 Wroclaw, Poland ; 2 Inserm U76, INTS, 75015 Paris, France
Summary – Recombinant forms of normal glycophorin C (GPC), carrying the high frequency Gerbich blood group antigens, and its natural deletion mutants of Yus and Ge type (all combined with oligohistidyl tag) were expressed in CHO and COS 7 cells. The stable expression of all recombinant forms of GPC in CHO cells was obtained, but the level of expression was low and detectable only by flow cytometry. The high level of transient expression of GPC recombinant forms in COS 7 cells allowed their purification on Ni–NTA–agarose. The purified recombinant GPC and mutants of Yus and Ge type behaved in SDS-PAGE similarly to normal GPC forms from RBC membranes. The recombinant GPC.Yus and GPC.Ge mutants appeared as diffuse bands, suggesting the similar heterogeneity of glycosylation that was observed in natural GPC.Yus and GPC.Ge glycoproteins. The flow cytometry analysis of the transfected CHO and COS 7 cells showed that binding of anti-GPC monoclonal antibodies to GPC variants was accordant with the known fine specificity of these antibodies. The obtained recombinant forms of GPC carrying common Gerbich antigens may be useful in serology, and also as model molecules for structure–function studies. © 2002 Éditions scientifiques et médicales Elsevier SAS Gerbich blood group antigens / glycophorin C / recombinant antigens / Yus and Ge deletion mutants
Résumé – Les formes recombinantes des antigènes de groupe sanguin Gerbich : expression et purification. Les formes recombinantes de la glycophorine C (GPC) portant les antigènes de groupe sanguin Gerbich de fréquence élevée et ses mutants naturels de type Yus et Ge (tous porteurs d’un tag polyhistidine) ont été exprimés dans les cellules CHO et COS 7. L’expression stable de toutes les formes recombinantes de la GPC a été obtenue dans les cellules CHO, mais le niveau d’expression est faible et détectable seulement par la cytométrie en flux. L’expression transitoire élevée des formes recombinantes de GPC dans les cellules COS 7 a permis leur purification sur gel d’agarose Ni–NTA. Les formes recombinantes purifiées de la GPC et de ses mutants de type Yus et Ge se comportent en gel de polyacrylamide–SDS (SDS-PAGE) de façon similaire aux formes natives présentes dans les membranes érythrocytaires. Les mutants GPC.Yus et GPC.Ge apparaissent sous forme de bandes diffuses, suggérant une hétérogénéité de glycosylation identique à celle observée sur les glycoprotéines GPC.Yus et GPC.Ge naturelles. L’analyse par cytométrie en flux des cellules CHO et COS 7 transfectées a montré que la liaison des variants des anticorps monoclonaux anti-GPC était conforme à la spécificité fine de ces anticorps. Les formes recombinantes de GPC transporteurs des antigènes Gerbich communs peuvent être utiles en sérologie, ainsi qu’en tant que modèles pour des études de structure–fonction. © 2002 Éditions scientifiques et médicales Elsevier SAS antigènes Gerbich / antigènes recombinants / glycophorine C / mutants Yussef et Gerbich
*Correspondence and reprints. E-mail address: [email protected] (E. Jaskiewicz).
122
E. Jaskiewicz et al.
INTRODUCTION The Gerbich blood group system comprises of three high frequency antigens: Ge2, Ge3 and Ge4 defined by human alloantibodies [rev. in 1, 2]. They are located on the external N-terminal portions of glycophorins C (GPC) and D (GPD), minor sialoglycoprotein components of human red blood cell (RBC) membranes. GPC is a single polypeptide chain composed of 128 aa residues, highly glycosylated, containing one N-linked and an average of 12 O-linked oligosaccharide chains. GPD is a shortened version of GPC, starting from Met22 and consisting of 107 aa residues. Both are encoded by a single GYPC gene organized into four exons [3, 4] and generated by the use of alternative translation initiation sites (AUG 1 and 22, respectively) [5]. The Ge2, Ge3 and Ge4 antigens are located in regions encoded by the exons 2, 3 and 1, respectively [6, 7]. The Ge2 is located on the N-terminus of GPD, Ge3 is present within aa residues 40–50 of GPC (and 15–25 of GPD) and Ge4 is located in the N-terminal portion of GPC. Rare natural deletion phenotypes of RBCs lacking the Gerbich antigens have been identified. Deletion of exon 2 coding for aa residues 17–35 of GPC gives Yus phenotype (Ge-2,3,4), while a deletion of exon 3 coding for aa residues 36–63 of GPC results in Gerbich (Ge) phenotype (Ge-2,-3,4). The Yus and Ge erythrocytes carry variant forms of GPC, type Yus and Ge (GPC.Yus and GPC.Ge, respectively), which differ from GPC not only in sequence (deletions of indicated aa residues) but also in structure of oligosaccharide chains [8]. Erythrocytes lacking all three antigens (Ge2,-3,-4, Leach phenotype) do not express GPC and GPD. The use of variant blood group antigens in serology and research is limited by their rare occurrence. However, they can be replaced by recombinant forms. This approach not only offers availability of rare blood antigens, but also allows construction of their ‘artificial’ mutants. Although recombinant blood group antigens are not yet suitable for routine use in serology, they gain an importance. Recently, Knops, Kell and Duffy blood group antigens expressed in mouse erythroleukaemic cell line (MEL) were used to detect and identify human antibodies [9]. Recombinant glycophorin A (GPA) carrying blood group M and N antigens was also applied to studies on anti-GPA antibodies [10, 11]. In this report we describe a stable and transient expression, purification and characterization of the recombinant forms of GPC and its two natural deletion mutants
GPC.Yus and GPC.Ge, carrying the common Gerbich blood group antigens. MATERIALS AND METHODS Monoclonal antibodies Murine monoclonal antibodies with anti-GPC specificity NAM70-1G4, NAM57-1F6, NAM89-2G11 and NAM19-3C4 (called here 1G4, 1F6, 2G11 and 3C4) were kindly provided by Dr D. Blanchard (Etablissement de Transfusion Sanguine, Nantes, France) and used for identification of recombinant forms of GPC in flow cytometry and immunoblotting. Fine specificities of used antibodies were determined and described previously [12-16]. Preparation of cDNA constructs for GPC variant forms Two natural deletion mutants of GPC type Yus and Ge were obtained by the PCR method, using the fulllength cDNA encoding human GPC in pUC18 vector (clone pGCF23, [3]). The following primers for GPC.Yus and GPC.Ge containing the unique Xho I and Nsi I restriction sites, respectively, were used: direct, for Yus: 5’CTGACTCGAGCCTGATCCAGGGATGTCTGGATGG3’ for Ge: 5’CTAGATGCATACTACCACCATTGCAGGTGTGATTGCTGCTGTG3’ reverse, in pUC18: 5’GTCGACTCTAGAGGATCC3’ Finally, the cDNAs coding for native and both deletion mutants of GPC were excised from pUC18 and inserted into EcoR I cloning site of pSG5 eucariotic expression vector (Stratagene, La Jolla, CA). In order to purify the recombinant forms of GPC on Ni–NTA–agarose the (His)6-tag was fused to the C-terminus of GPC and GPC.Yus and GPC.Ge mutants using PCR method. The following primers and EcoR I cloning site in pSG5 vector were used: direct ( in pSG5 vector): 5’CGACTCACTATAGGGCGAATTCGG3’ reverse: 5’ACTGGAATTCCTATTAATGGTGATGGTGATGGTGAATAAAGTACTCCT-TTCTGCTGCTATCACC3’ The chimeric construct GPC/A in which the C-terminal aa residues (97–128) of GPC were replaced by the C-terminal aa residues (104–131) of glycophorin A (GPA, major RBC membrane sialoglycopro Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
tein), was obtained as follows. The cDNA coding for Fya/GPA construct [17] was first recloned from pComb3 vector into pSG5 expression vector, and then digested with EcoR I/Hind III to remove sequence coding for Fya antigen. The resulted plasmid containing the sequence coding for the C-terminus of GPA followed by the (His)6 sequence, was used to insert the amplified cDNA fragment coding for shortened form of GPC (aa residues 1–96). The primers used in PCR method were: direct (in pSG5 vector): 5’CGACTCACTATAGGGCGAATTCGG3’ reverse: 5’ATCAGAAGCTTCATTGGTGTGGTACGTGCCCTTGTGCCG3’ Cell culture and transfection Wild type Chinese hamster ovary cells (CHO) and monkey kidney cells line (COS 7) were cultured in α-MEM or RPMI medium, respectively, containing 10% (v/v) fetal calf serum (Gibco, BRL, Grand Island, NY, USA) and 2 mM glutamine (Sigma, Saint Louis, MO, USA). Stable cotransfection of CHO cells was performed by the calcium phosphate precipitation method [18] with the use of 20 µg of supercoiled plasmid containing cDNA for native or variant forms of GPC in pSG5 vector and 2 µg of pRSVneo plasmid. Transfected cells were selected in complete medium containing 0.4 mg ml–1 of active geneticin (G418, Gibco, BRL, Grand Island, NY, USA) and analysed for GPC surface expression by flow cytometry. Clonal cell lines expressing native or mutated forms of GPC were isolated by repetitive cloning by limited dilution. Transient transfection of COS 7 cells was performed by electroporation with Gene Pulser (Biorad, Hercules, CA, USA; 300 V, 960 µF)), using 10 µg of supercoiled plasmids per 0.5 × 107 cells. Forty eight hours after transfection cells were removed from a monolayer culture with 0.2% EDTA in Hank’s balanced salt solution pH 7.4 for flow cytometry analysis or with a cell scraper for further solubilization and purification of recombinant glycoproteins. Flow cytometry analysis The transfected CHO or COS 7 cells (1 × 106), detached with 0.2% EDTA, were incubated with undiluted culture supernatants of anti-GPC monoclonal antibodies (MoAbs) for 30 min at 4 °C. After washing with cold phosphate buffered saline pH 7.4 containing Transfus Clin Biol 2002 ; 9 : 121–9
123
1% bovine serum albumin (PBS/BSA), cells were incubated for 30 min at 4 °C with the fluoresceinconjugated goat anti-mouse Ig antibody (Gibco BRL, Grand Island, NY, USA). Directly after labelling, the cells were washed with PBS/BSA and analysed for fluorescence intensity using flow cytometry (Becton–Dickinson, Mountain View, CA, USA). Purification of the recombinant forms of GPC on Ni–NTA–agarose Transiently transfected COS 7 cells from 10 tissue culture plates (15 cm) harvested as a monolayer in cold PBS using cell scraper, were washed twice with cold PBS and solubilized in 1 ml of 50 mM TRIS/HCL, 150 mM NaCl lysis buffer, pH 8.0 containing 1 mM EDTA, 0.5% NP40 and 1 mM phenylmethylsulfonylfluoride (PMSF, Sigma, Saint Louis, MO, USA) for 10 min at 4 °C. The soluble fraction was separated by centrifugation at 1100 g, 12 min at 4 °C and exhaustively dialysed against water and then against 50 mM phosphate buffer (containing 300 mM NaCl), pH 8.0. A column packed with 0.5 ml Ni–NTA–agarose (Qiagen, Hilden, Germany) was first washed with the phosphate buffer pH 8.0 and then loaded with dialyzed cell lysates. The column was extensively washed with the phosphate buffer pH 6.8 and then with 10, 20, 50, and 100 mM imidazole in the same buffer. The collected 2 ml fractions were assayed by dot–blot technique with the use of the MoAb 1G4. The fractions eluted with 50 mM and 100 mM imidazole were pooled separately, concentrated by ultrafiltration and dialyzed against water. Gel electrophoresis and immunoblotting The fractions purified on Ni–NTA–agarose were separated by the SDS–polyacrylamide gel electrophoresis (SDS-PAGE) in 10% gel [19] and stained with Coomassie Brilliant Blue (Sigma, Saint Louis, MO, USA) or transferred to nitrocellulose BA 85 (Schleicher & Schuel, Dassel, Germany). The bands corresponding to GPC were detected immunoenzymatically with the MoAb 1F6 and alkaline phosphatase-conjugated rabbit antibodies against mouse Ig (Dakopatts, Copenhagen, Denmark), as described previously [20]. SDS-PAGE separated membrane proteins of normal and Gerbich negative (Ge-2,-3,4) RBCs [21] were used as standard control.
124
E. Jaskiewicz et al.
RESULTS Stable expression of GPC forms in CHO cells The cDNAs coding for normal and two naturally occurring mutants of GPC, Yus and Ge type which lack aa residues 17–35 and 36–63, respectively (Fig. 1), were stably transfected into wild type CHO cells. Cell surface expression of the recombinant GPC forms was confirmed by flow cytometry using the MoAb 1G4 which recognizes a sialidase resistant epitope comprising the first Met residue of GPC [15]. Three clones, C1, B3, and H9, revealing the highest expression of GPC, GPC.Yus and GPC.Ge, respectively, were selected (Fig. 2). Based on the mean fluorescence intensity obtained by flow cytometry analysis, the expression level of all recombinant forms was low, not higher (clone H9) or even lower (clones C1 and B3) than the expression of GPC in RBCs (Fig. 2). The selected stable CHO clones were further characterized with the use of two other murine MoAbs, 2G11 and 3C4, recognizing well defined internal epitopes in GPC. The MoAb 2G11 reacts with the peptidic sequence 16 LEPDP20 of GPC, and the MoAb 3C4 (anti-Ge3 specificity) recognizes the epitope located within aa residues 36–50 of the GPC polypeptide chain [12]. As expected, all recombinant forms of GPC bound the MoAb 2G11 (Fig. 3), because all of them contain the sequence LEPDP (Fig. 1). The MoAb 3C4 bound to GPC and GPC.Yus and did not bind to GPC.Ge
mutant which does not contain aa residues 36–63. The expression levels of obtained clones did not change with time when clones were maintained in the selective medium (containing 400 µg ml–1 G418) and did not decrease upon a repeated thawing and freezing (the observed period of time was about 2 years). The expression level of the recombinant forms of GPC was too low for further purification of the recombinant glycoproteins. Based on the facts that glycophorin A (GPA) is the most abundant sialoglycoprotein of human RBCs, and is also efficiently expressed in CHO cells [22, 23], we considered the possibility that the expression of glycophorins may depend on their C-terminal cytoplasmic tails. To check this, the chimeric construct GPC/A was prepared. The cytoplasmic tail of GPA (aa residues 104–131) was used for fusion to replace the C-terminus of GPC (aa residues 97–128). However, we did not obtain any improvement in the expression of GPC/A construct in CHO cells (data not shown). Transient expression of GPC forms in COS 7 cells Looking for a more efficient system for obtaining the recombinant GPC forms, we used the highly effective transient expression system in COS 7 cells. The cDNAs encoding GPC and its two deletion mutants GPC.Yus and GPC.Ge were transfected into COS 7 cells. Forty eight hours after tansfection the expressed GPC forms were assayed by flow cytometry with the previously
Fig. 1. Structure of N-terminal fragments of the polypeptide chain of GPC and its deletion mutants Yus and Ge type. Asterisks denote glycosylation sites. Numbers of aa residues apply to their positions in normal GPC. Location of the Gerbich antigens: Ge3, Ge4 and (Ge2) crypto-antigen in GPC is indicated. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
125
cells allowed further purification and characterization of the recombinant glycoproteins. Purification and immunochemical characterization of GPC recombinant forms
Fig. 2. Expression of natural and the recombinant forms of GPC in RBC and CHO cells, respectively, detected with the MoAb 1G4 that recognizes NH2-terminal epitope in GPC polypeptide chain. RBCs not incubated with the MoAb 1G4 (–) and untransfected CHO cells served as controls.
used MoAbs 1G4, 2G11 and 3C4. The patterns obtained (Fig. 4) indicated that transfected COS 7 cells were more heterogeneous than CHO cells regarding the level of expression of GPC forms. However, the difference between the negative result (lack of binding of the MoAb 3C4 to GPC.Ge) and positive ones was distinct enough to allow evaluation of the antibody binding. The high expression of GPC forms in COS 7 Transfus Clin Biol 2002 ; 9 : 121–9
All recombinant forms of GPC contained the (His)6-tag at the C-terminus of the polypeptide chain that allowed their purification on Ni–NTA–agarose. The transiently transfected COS 7 cells from a large culture (10 tissue culture plates, 15 cm) were lysed in the presence of 0.5% NP40 and the supernatant was applied on Ni–NTA-column. The results of dot–blot (with the MoAb 1G4) revealed that the fractions containing all GPC forms were eluted with 50 mM and 100 mM imidazole. The yield of glycoproteins obtained from the indicated batch of cells was in the range of 5–6 µg. SDS-PAGE of this material followed by CBB staining showed the faint bands corresponding to GPC forms and no additional protein bands (data not shown). This indicated that isolated GPC forms, even if not pure, are at least the major components of the obtained material. The recombinant forms of GPC eluted with 100 mM imidazole were stained in immunoblotting (Fig. 5) using the MoAb 1F6 which recognizes the C-terminal epitope (aa residues 110–115) in GPC polypeptide chain [16]. The apparent molecular weights of the recombinant GPC and both mutants GPC.Yus and GPC.Ge were similar to those of the GPC and GPC.Ge variant from erythrocytes. Similarly to RBC GPC forms, the recombinant GPC migrated as a narrow band, while the recombinant GPC.Yus and GPC.Ge mutants showed as broad ‘diffuse’ bands. These data show that heterogeneity of GPC mutants, which may reflect an increased intermolecular heterogeneity in glycosylation, is independent of the expression system (RBC or COS 7 cells), but is probably related to the structure of the polypeptide chain. DISCUSSION Most studies performed so far on Gerbich antigens and on specificity of anti-GPC antibodies were based on using rare RBC variants of Ge and Yus type. To overcome the low availability of these variant RBCs, we used CHO and COS 7 cells for the stable or transient surface expression, respectively, of the recombinant GPC and its variant forms. The expression of these glycoproteins in stable CHO clones was distinctly shown by flow cytometry, but the level of expression
126
E. Jaskiewicz et al.
Fig. 3. Stable expression of the recombinant GPC, GPC.Yus and GPC.Ge (clones C1, B3 and H9, respectively) in CHO cells, characterized with the MoAbs: 2G11 and 3C4 that recognize internal epitopes in GPC polypeptide chain. Untransfected CHO cells served as control.
Fig. 4. Transient expression of the recombinant forms of GPC in COS 7 cells, characterized with the MoAbs: 1G4, 2G11 and 3C4. Untransfected COS 7 cells served as control. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
127
Fig. 5. Immunostaining of natural and purified recombinant forms of GPC using the MoAb 1F6 that recognizes C-terminal epitope (aa 110-115 residues) in GPC polypeptide chain. Normal and variant Gerbich negative (Ge-2,-3,4) RBC membranes (panel A) and recombinant proteins purified on Ni–NTA–agarose (panel B), were separated in SDSPAGE and transferred to nitrocellulose as described in Materials and Methods.
was too low for detection of the recombinant antigens by immunoblotting and for their purification. It is noteworthy that the expression of GPC in RBCs is also relatively low (approx. 105 copies per cell) [24], as compared to GPA expressed as approx. 106 copies per cell. GPA was also efficiently expressed in CHO cells using the same pSG5 expression vector [22, 23] which was applied for GPC. The difference in expression of GPC and GPA does not seem to be mediated by the structure of their cytoplasmic tails, since we were not successful in obtaining an improved expression in CHO cells of the chimeric construct GPC/A, consisting of the N-terminal portion of GPC and cytoplasmic tail of GPA. The relatively low expression of recombinant antigens also suggests that GPC expression may not depend exclusively on the promoter, i.e. SV40 of pSG5 vector, or in natural conditions on a tissue specific promoter [25, 26]. The high level of expression of GPC, GPC.Yus and GPC.Ge obtained in transiently transfected COS 7 cells allowed purification of recombinant antigens. The purified recombinant GPC and its both mutants Transfus Clin Biol 2002 ; 9 : 121–9
migrated in SDS-PAGE similarly to GPC forms from RBCs membranes, i.e. the recombinant GPC.Yus and GPC.Ge mutants appeared as the broad, ‘diffuse’ bands, in contrast to the ‘sharp’ GPC band. This difference is likely to be related to altered glycosylation of GPC mutants. The structure of oligosaccharide chains of purified GPC has not been studied, but basing on the binding of lectins and anti-carbohydrate antibodies, it is generally believed that the glycans of GPC from RBCs are identical to those found in GPA: most of the O-glycans are classical tetrasaccharides NeuAcα(2–3)Galβ(1–3)[NeuAcα(2–6)]GalNAc, and the N-glycan is a disialylated bisected biantenary complex type chain with one lactosamine unit in each antenna [27]. The results of endo-glycosidase digestion indicated that both GPC mutants contain the repeated lactosamine units of different length in N-glycosidic chain [2, 8]. However, the differences in O-glycosylation cannot be ruled out either. The similar ‘diffuse’ character of purified recombinant and natural GPC.Yus and GPC.Ge mutants suggests a similar tendency in alteration of their glycosylation in different
128
E. Jaskiewicz et al.
cell systems, regardless the possible differences in the structure of glycans produced in RBCs and COS 7 cells. The molecular basis of the change in glycosylation of GPC deletion mutants in RBCs, and in particular, the reason why a deletion of a part of the polypeptide chain can affect its glycosylation, has not been studied yet. One of possible explanations is that a shorter molecule is better available for membrane-bound glycosyltransferases [28]. The N-glycosylation sites in shorter GPC.Yus and GPC.Ge mutants are closer to a membrane that could cause the preferential synthesis of polylactosamine units. There is another possibility that the deletion mutants may have a different transit time in the Golgi and may become more heavily glycosylated. The recombinant GPC forms are good model molecules to explore this problem in further studies. In conclusion, the recombinant forms of GPC described in this report are useful for different approaches. They can replace rare RBCs carrying GPC variants in serological studies on Gerbich antigens and in elucidation of fine specificity of natural human and monoclonal anti-GPC antibodies. We have already used them for identification of glycopeptidic epitopes for a few murine monoclonal antibodies with anti-GPC specificity [12]. As discussed above, the recombinant forms of GPC can also serve for studies on other more complex issues, including the mechanisms regulating the biosynthesis of oligosaccharide chains.
5
6
7 8
9
10
11
12
ACKNOWLEDGEMENTS
13
Supported by grant No 6P04A 01512 from the Committee for Scientific Studies (KBN), Warsaw.
14
REFERENCES
15
1
2
3
4
Cartron JP, Le Van Kim C, Colin Y. Glycophorin C and related glycoprotiens: structure, function and regulation. Sem Hematol 1993;30:152–68. Reid M, Spring FA. Molecular basis of glycophorin C variants and their associated blood group antigens. Transfus Med 1994;4:139–46. Colin Y, Le Van Kim C, Tsapis A, Clerget M, d’Auriol L, London J, Galibert F, Cartron JP. Human erythrocyte glycophorin C. Gene structure and rearragement in genetic variants. J Biol Chem 1989;264:3773–80. High S, Tanner MJA, MacDonald EB, Anstee DJ. Rearrangement of the red-cell membrane glycophorin C (sialoglycoprotein ß) gene. A further study of alterations in the glycophorin C gene. Biochem J 1989;262:47–54.
16
17
18
19
Le Van Kim C, Piller V, Cartron JP, Colin Y. Glycophorins C and D are generated by the use of alternative translation initiation sites. Blood 1996;88:2364–5. Dahr W, Kiedrowski S, Blanchard D, Hermand P, Moulds JJ, Cartron JP. High frequency antigens of human erythrocyte membrane sialoglycoproteins. V. Characterization of the Gerbich blood group antigens: Ge2 and Ge3. Biol Chem HoppeSeyler 1987;368:1375–83. McShane K, Chung A. A novel human alloantibody in the Gerbich system. Vox Sang 1989;57:205–9. Reid ME, Anstee DJ, Tanner MJA, Ridgwell K, Nurse GT. Structural relationships between human erythrocyte sialoglycoproteins ß and γ and abnormal sialoglycoproteins found in certain rare human erythrocyte variants lacking the Gerbich blood-group antigens. Biochem J 1987;244:123–8. Yazdanbakhsh K, Oyen R, Yu Q, Lee S, Antoniou M, Chaudhuri A, Reid ME. High-level stable expression of blood group antigens in a heterologous system. Am J Hematol 2000;63:114–24. Blackall DP, Ugorski M, Pahlson P, Shakin-Eshleman SH, Spitalnik SL. A molecular biological approach to study the fine specificity of antibodies directed to the MN human blood group antigens. J Immunol 1994;152:2241–7. Blackall DP, Ugorski M, Smith ME, Pahlson P, Spitalnik SL. The binding of human alloantibodies to recombinant glycophorin A. Transfusion 1992;32:629–32. Jaskiewicz E, Blanchard D, Lisowska E. Recombinant forms of glycophorin C as a useful tool to study peptidic epitopes. In: ˙ eromski J, editors. EFIS 2000, Mackiewicz A, Kurpisz M, Z Monduzzi Editore – MEDIMOND Inc. 2001. p. 357–62. Loirat MJ, Gourbil A, Frioux Y, Muller JY, Blanchard D. A murine monoclonal antibody directed against the Gerbich 3 blood group antigen. Vox Sang 1992;62:45–8. Loirat MJ, Dahr W, Muller JY, Blanchard D. Characterization of new murine monoclonal antibodies directed against glycophorins C and D. Transfus Med 1994;4:147–55. Reid ME, Lisowska E, Blanchard D. Coordinator’s report: Glycophorin/Band 3 and associated antigens. Transfus Clin Biol 1997;1:57–64. Wasniowska K, Jaskiewicz E, Czerwinski M, Syper D, Lisowska E. Mapping of peptidic epitopes of glycophorins A (GPA) and C (GPC) with peptides synthesized on plastic pins (Pepscan analysis). Transfus Clin Biol 1997;1:73–5. Wasniowska K, Czerwinski M, Jachymek W, Lisowska E. Expression and binding properties of a soluble chimeric protein containing the N-terminal domain of the Duffy antigen. Biochem Biophys Res Commun 2000;273:705–11. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd Ed., Vol 1-3. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989. Laemmli UK. Ceavage of structural proteins during assembly of bacteriophage T4. Nature 1970;227:680–5. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens 20 Jaskiewicz E, Moulds JJ, Kraemer K, Goldstein AS, Lisowska E. Characterization of the epitope recognized by a monoclonal antibody highly specific for blood group M antigen. Transfusion 1990;30:230–5. 21 Kusnierz-Alejska G, Seifried H, Jaskiewicz E, Janczarski M. Alloantibody anti-Gerbich. Blood transfusion problems and family studies. Materia Medica Polona 1991;1:8–13. 22 Pahlson P, Blackall DP, Ugorski M, Czerwinski M, Spitalnik SL. Biochemical characterization of the O-glycans on recombinant glycophorin A expressed in Chinese hamster ovary cells. Glycoconjugate J 1994;11:43–50. 23 Remaley AT, Ugorski M, Wu N, Litzky L, Burger SR, Moore JS, Fukuda M, Spitalnik SL. Expression of human glycophorin A in wild type and glycosylation-deficient Chinese hamster ovary cells. J Biol Chem 1991;266:24176–83. 24 Smythe J, Gardner B, Anstee DJ. Quantitation of the number of molecules of glycophorins C and D on normal red blood
Transfus Clin Biol 2002 ; 9 : 121–9
129
cells using radioiodinated Fab fragments of monoclonal antibodies. Blood 1994;83:1668–72. 25 Le Van Kim C, Colin Y, Mitjavila MT, Clerget M, Dubart A, Nakazawa M, Vainchenkers W, Cartron JP. Structure of the promoter region and tissue specificity of the human glycophorin C gene. J Biol Chem 1989;264:20407–14. 26 Colin Y, Joulin V, Le Van Kim C, Romeo PH, Cartron JP. Characterization of a new erythroid/megakaryocyte-specific nuclear factor that binds the promoter of the housekeeping human glycophorin C gene. J Biol Chem 1990;265:16729–32. 27 Lisowska E. Antigenic properties of human glycophorins- an update. Adv Exp Med Biol 2001;491:145–59. 28 Fukuda M, Guan JL, Rose JK. A membrane anchored form but not the secretory form of human chorionic gonadotropin-α chain acquires polylactosaminoglycan. J Biol Chem 1988;263:5314–8.
ORIGINAL ARTICLE
Recombinant forms of Gerbich blood group antigens: expression and purification E. Jaskiewicz1*, M. Czerwinski1, Y. Colin2, E. Lisowska1 1 Department of Immunochemistry, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Weigla 12, 53-114 Wroclaw, Poland ; 2 Inserm U76, INTS, 75015 Paris, France
Summary – Recombinant forms of normal glycophorin C (GPC), carrying the high frequency Gerbich blood group antigens, and its natural deletion mutants of Yus and Ge type (all combined with oligohistidyl tag) were expressed in CHO and COS 7 cells. The stable expression of all recombinant forms of GPC in CHO cells was obtained, but the level of expression was low and detectable only by flow cytometry. The high level of transient expression of GPC recombinant forms in COS 7 cells allowed their purification on Ni–NTA–agarose. The purified recombinant GPC and mutants of Yus and Ge type behaved in SDS-PAGE similarly to normal GPC forms from RBC membranes. The recombinant GPC.Yus and GPC.Ge mutants appeared as diffuse bands, suggesting the similar heterogeneity of glycosylation that was observed in natural GPC.Yus and GPC.Ge glycoproteins. The flow cytometry analysis of the transfected CHO and COS 7 cells showed that binding of anti-GPC monoclonal antibodies to GPC variants was accordant with the known fine specificity of these antibodies. The obtained recombinant forms of GPC carrying common Gerbich antigens may be useful in serology, and also as model molecules for structure–function studies. © 2002 Éditions scientifiques et médicales Elsevier SAS Gerbich blood group antigens / glycophorin C / recombinant antigens / Yus and Ge deletion mutants
Résumé – Les formes recombinantes des antigènes de groupe sanguin Gerbich : expression et purification. Les formes recombinantes de la glycophorine C (GPC) portant les antigènes de groupe sanguin Gerbich de fréquence élevée et ses mutants naturels de type Yus et Ge (tous porteurs d’un tag polyhistidine) ont été exprimés dans les cellules CHO et COS 7. L’expression stable de toutes les formes recombinantes de la GPC a été obtenue dans les cellules CHO, mais le niveau d’expression est faible et détectable seulement par la cytométrie en flux. L’expression transitoire élevée des formes recombinantes de GPC dans les cellules COS 7 a permis leur purification sur gel d’agarose Ni–NTA. Les formes recombinantes purifiées de la GPC et de ses mutants de type Yus et Ge se comportent en gel de polyacrylamide–SDS (SDS-PAGE) de façon similaire aux formes natives présentes dans les membranes érythrocytaires. Les mutants GPC.Yus et GPC.Ge apparaissent sous forme de bandes diffuses, suggérant une hétérogénéité de glycosylation identique à celle observée sur les glycoprotéines GPC.Yus et GPC.Ge naturelles. L’analyse par cytométrie en flux des cellules CHO et COS 7 transfectées a montré que la liaison des variants des anticorps monoclonaux anti-GPC était conforme à la spécificité fine de ces anticorps. Les formes recombinantes de GPC transporteurs des antigènes Gerbich communs peuvent être utiles en sérologie, ainsi qu’en tant que modèles pour des études de structure–fonction. © 2002 Éditions scientifiques et médicales Elsevier SAS antigènes Gerbich / antigènes recombinants / glycophorine C / mutants Yussef et Gerbich
*Correspondence and reprints. E-mail address: [email protected] (E. Jaskiewicz).
122
E. Jaskiewicz et al.
INTRODUCTION The Gerbich blood group system comprises of three high frequency antigens: Ge2, Ge3 and Ge4 defined by human alloantibodies [rev. in 1, 2]. They are located on the external N-terminal portions of glycophorins C (GPC) and D (GPD), minor sialoglycoprotein components of human red blood cell (RBC) membranes. GPC is a single polypeptide chain composed of 128 aa residues, highly glycosylated, containing one N-linked and an average of 12 O-linked oligosaccharide chains. GPD is a shortened version of GPC, starting from Met22 and consisting of 107 aa residues. Both are encoded by a single GYPC gene organized into four exons [3, 4] and generated by the use of alternative translation initiation sites (AUG 1 and 22, respectively) [5]. The Ge2, Ge3 and Ge4 antigens are located in regions encoded by the exons 2, 3 and 1, respectively [6, 7]. The Ge2 is located on the N-terminus of GPD, Ge3 is present within aa residues 40–50 of GPC (and 15–25 of GPD) and Ge4 is located in the N-terminal portion of GPC. Rare natural deletion phenotypes of RBCs lacking the Gerbich antigens have been identified. Deletion of exon 2 coding for aa residues 17–35 of GPC gives Yus phenotype (Ge-2,3,4), while a deletion of exon 3 coding for aa residues 36–63 of GPC results in Gerbich (Ge) phenotype (Ge-2,-3,4). The Yus and Ge erythrocytes carry variant forms of GPC, type Yus and Ge (GPC.Yus and GPC.Ge, respectively), which differ from GPC not only in sequence (deletions of indicated aa residues) but also in structure of oligosaccharide chains [8]. Erythrocytes lacking all three antigens (Ge2,-3,-4, Leach phenotype) do not express GPC and GPD. The use of variant blood group antigens in serology and research is limited by their rare occurrence. However, they can be replaced by recombinant forms. This approach not only offers availability of rare blood antigens, but also allows construction of their ‘artificial’ mutants. Although recombinant blood group antigens are not yet suitable for routine use in serology, they gain an importance. Recently, Knops, Kell and Duffy blood group antigens expressed in mouse erythroleukaemic cell line (MEL) were used to detect and identify human antibodies [9]. Recombinant glycophorin A (GPA) carrying blood group M and N antigens was also applied to studies on anti-GPA antibodies [10, 11]. In this report we describe a stable and transient expression, purification and characterization of the recombinant forms of GPC and its two natural deletion mutants
GPC.Yus and GPC.Ge, carrying the common Gerbich blood group antigens. MATERIALS AND METHODS Monoclonal antibodies Murine monoclonal antibodies with anti-GPC specificity NAM70-1G4, NAM57-1F6, NAM89-2G11 and NAM19-3C4 (called here 1G4, 1F6, 2G11 and 3C4) were kindly provided by Dr D. Blanchard (Etablissement de Transfusion Sanguine, Nantes, France) and used for identification of recombinant forms of GPC in flow cytometry and immunoblotting. Fine specificities of used antibodies were determined and described previously [12-16]. Preparation of cDNA constructs for GPC variant forms Two natural deletion mutants of GPC type Yus and Ge were obtained by the PCR method, using the fulllength cDNA encoding human GPC in pUC18 vector (clone pGCF23, [3]). The following primers for GPC.Yus and GPC.Ge containing the unique Xho I and Nsi I restriction sites, respectively, were used: direct, for Yus: 5’CTGACTCGAGCCTGATCCAGGGATGTCTGGATGG3’ for Ge: 5’CTAGATGCATACTACCACCATTGCAGGTGTGATTGCTGCTGTG3’ reverse, in pUC18: 5’GTCGACTCTAGAGGATCC3’ Finally, the cDNAs coding for native and both deletion mutants of GPC were excised from pUC18 and inserted into EcoR I cloning site of pSG5 eucariotic expression vector (Stratagene, La Jolla, CA). In order to purify the recombinant forms of GPC on Ni–NTA–agarose the (His)6-tag was fused to the C-terminus of GPC and GPC.Yus and GPC.Ge mutants using PCR method. The following primers and EcoR I cloning site in pSG5 vector were used: direct ( in pSG5 vector): 5’CGACTCACTATAGGGCGAATTCGG3’ reverse: 5’ACTGGAATTCCTATTAATGGTGATGGTGATGGTGAATAAAGTACTCCT-TTCTGCTGCTATCACC3’ The chimeric construct GPC/A in which the C-terminal aa residues (97–128) of GPC were replaced by the C-terminal aa residues (104–131) of glycophorin A (GPA, major RBC membrane sialoglycopro Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
tein), was obtained as follows. The cDNA coding for Fya/GPA construct [17] was first recloned from pComb3 vector into pSG5 expression vector, and then digested with EcoR I/Hind III to remove sequence coding for Fya antigen. The resulted plasmid containing the sequence coding for the C-terminus of GPA followed by the (His)6 sequence, was used to insert the amplified cDNA fragment coding for shortened form of GPC (aa residues 1–96). The primers used in PCR method were: direct (in pSG5 vector): 5’CGACTCACTATAGGGCGAATTCGG3’ reverse: 5’ATCAGAAGCTTCATTGGTGTGGTACGTGCCCTTGTGCCG3’ Cell culture and transfection Wild type Chinese hamster ovary cells (CHO) and monkey kidney cells line (COS 7) were cultured in α-MEM or RPMI medium, respectively, containing 10% (v/v) fetal calf serum (Gibco, BRL, Grand Island, NY, USA) and 2 mM glutamine (Sigma, Saint Louis, MO, USA). Stable cotransfection of CHO cells was performed by the calcium phosphate precipitation method [18] with the use of 20 µg of supercoiled plasmid containing cDNA for native or variant forms of GPC in pSG5 vector and 2 µg of pRSVneo plasmid. Transfected cells were selected in complete medium containing 0.4 mg ml–1 of active geneticin (G418, Gibco, BRL, Grand Island, NY, USA) and analysed for GPC surface expression by flow cytometry. Clonal cell lines expressing native or mutated forms of GPC were isolated by repetitive cloning by limited dilution. Transient transfection of COS 7 cells was performed by electroporation with Gene Pulser (Biorad, Hercules, CA, USA; 300 V, 960 µF)), using 10 µg of supercoiled plasmids per 0.5 × 107 cells. Forty eight hours after transfection cells were removed from a monolayer culture with 0.2% EDTA in Hank’s balanced salt solution pH 7.4 for flow cytometry analysis or with a cell scraper for further solubilization and purification of recombinant glycoproteins. Flow cytometry analysis The transfected CHO or COS 7 cells (1 × 106), detached with 0.2% EDTA, were incubated with undiluted culture supernatants of anti-GPC monoclonal antibodies (MoAbs) for 30 min at 4 °C. After washing with cold phosphate buffered saline pH 7.4 containing Transfus Clin Biol 2002 ; 9 : 121–9
123
1% bovine serum albumin (PBS/BSA), cells were incubated for 30 min at 4 °C with the fluoresceinconjugated goat anti-mouse Ig antibody (Gibco BRL, Grand Island, NY, USA). Directly after labelling, the cells were washed with PBS/BSA and analysed for fluorescence intensity using flow cytometry (Becton–Dickinson, Mountain View, CA, USA). Purification of the recombinant forms of GPC on Ni–NTA–agarose Transiently transfected COS 7 cells from 10 tissue culture plates (15 cm) harvested as a monolayer in cold PBS using cell scraper, were washed twice with cold PBS and solubilized in 1 ml of 50 mM TRIS/HCL, 150 mM NaCl lysis buffer, pH 8.0 containing 1 mM EDTA, 0.5% NP40 and 1 mM phenylmethylsulfonylfluoride (PMSF, Sigma, Saint Louis, MO, USA) for 10 min at 4 °C. The soluble fraction was separated by centrifugation at 1100 g, 12 min at 4 °C and exhaustively dialysed against water and then against 50 mM phosphate buffer (containing 300 mM NaCl), pH 8.0. A column packed with 0.5 ml Ni–NTA–agarose (Qiagen, Hilden, Germany) was first washed with the phosphate buffer pH 8.0 and then loaded with dialyzed cell lysates. The column was extensively washed with the phosphate buffer pH 6.8 and then with 10, 20, 50, and 100 mM imidazole in the same buffer. The collected 2 ml fractions were assayed by dot–blot technique with the use of the MoAb 1G4. The fractions eluted with 50 mM and 100 mM imidazole were pooled separately, concentrated by ultrafiltration and dialyzed against water. Gel electrophoresis and immunoblotting The fractions purified on Ni–NTA–agarose were separated by the SDS–polyacrylamide gel electrophoresis (SDS-PAGE) in 10% gel [19] and stained with Coomassie Brilliant Blue (Sigma, Saint Louis, MO, USA) or transferred to nitrocellulose BA 85 (Schleicher & Schuel, Dassel, Germany). The bands corresponding to GPC were detected immunoenzymatically with the MoAb 1F6 and alkaline phosphatase-conjugated rabbit antibodies against mouse Ig (Dakopatts, Copenhagen, Denmark), as described previously [20]. SDS-PAGE separated membrane proteins of normal and Gerbich negative (Ge-2,-3,4) RBCs [21] were used as standard control.
124
E. Jaskiewicz et al.
RESULTS Stable expression of GPC forms in CHO cells The cDNAs coding for normal and two naturally occurring mutants of GPC, Yus and Ge type which lack aa residues 17–35 and 36–63, respectively (Fig. 1), were stably transfected into wild type CHO cells. Cell surface expression of the recombinant GPC forms was confirmed by flow cytometry using the MoAb 1G4 which recognizes a sialidase resistant epitope comprising the first Met residue of GPC [15]. Three clones, C1, B3, and H9, revealing the highest expression of GPC, GPC.Yus and GPC.Ge, respectively, were selected (Fig. 2). Based on the mean fluorescence intensity obtained by flow cytometry analysis, the expression level of all recombinant forms was low, not higher (clone H9) or even lower (clones C1 and B3) than the expression of GPC in RBCs (Fig. 2). The selected stable CHO clones were further characterized with the use of two other murine MoAbs, 2G11 and 3C4, recognizing well defined internal epitopes in GPC. The MoAb 2G11 reacts with the peptidic sequence 16 LEPDP20 of GPC, and the MoAb 3C4 (anti-Ge3 specificity) recognizes the epitope located within aa residues 36–50 of the GPC polypeptide chain [12]. As expected, all recombinant forms of GPC bound the MoAb 2G11 (Fig. 3), because all of them contain the sequence LEPDP (Fig. 1). The MoAb 3C4 bound to GPC and GPC.Yus and did not bind to GPC.Ge
mutant which does not contain aa residues 36–63. The expression levels of obtained clones did not change with time when clones were maintained in the selective medium (containing 400 µg ml–1 G418) and did not decrease upon a repeated thawing and freezing (the observed period of time was about 2 years). The expression level of the recombinant forms of GPC was too low for further purification of the recombinant glycoproteins. Based on the facts that glycophorin A (GPA) is the most abundant sialoglycoprotein of human RBCs, and is also efficiently expressed in CHO cells [22, 23], we considered the possibility that the expression of glycophorins may depend on their C-terminal cytoplasmic tails. To check this, the chimeric construct GPC/A was prepared. The cytoplasmic tail of GPA (aa residues 104–131) was used for fusion to replace the C-terminus of GPC (aa residues 97–128). However, we did not obtain any improvement in the expression of GPC/A construct in CHO cells (data not shown). Transient expression of GPC forms in COS 7 cells Looking for a more efficient system for obtaining the recombinant GPC forms, we used the highly effective transient expression system in COS 7 cells. The cDNAs encoding GPC and its two deletion mutants GPC.Yus and GPC.Ge were transfected into COS 7 cells. Forty eight hours after tansfection the expressed GPC forms were assayed by flow cytometry with the previously
Fig. 1. Structure of N-terminal fragments of the polypeptide chain of GPC and its deletion mutants Yus and Ge type. Asterisks denote glycosylation sites. Numbers of aa residues apply to their positions in normal GPC. Location of the Gerbich antigens: Ge3, Ge4 and (Ge2) crypto-antigen in GPC is indicated. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
125
cells allowed further purification and characterization of the recombinant glycoproteins. Purification and immunochemical characterization of GPC recombinant forms
Fig. 2. Expression of natural and the recombinant forms of GPC in RBC and CHO cells, respectively, detected with the MoAb 1G4 that recognizes NH2-terminal epitope in GPC polypeptide chain. RBCs not incubated with the MoAb 1G4 (–) and untransfected CHO cells served as controls.
used MoAbs 1G4, 2G11 and 3C4. The patterns obtained (Fig. 4) indicated that transfected COS 7 cells were more heterogeneous than CHO cells regarding the level of expression of GPC forms. However, the difference between the negative result (lack of binding of the MoAb 3C4 to GPC.Ge) and positive ones was distinct enough to allow evaluation of the antibody binding. The high expression of GPC forms in COS 7 Transfus Clin Biol 2002 ; 9 : 121–9
All recombinant forms of GPC contained the (His)6-tag at the C-terminus of the polypeptide chain that allowed their purification on Ni–NTA–agarose. The transiently transfected COS 7 cells from a large culture (10 tissue culture plates, 15 cm) were lysed in the presence of 0.5% NP40 and the supernatant was applied on Ni–NTA-column. The results of dot–blot (with the MoAb 1G4) revealed that the fractions containing all GPC forms were eluted with 50 mM and 100 mM imidazole. The yield of glycoproteins obtained from the indicated batch of cells was in the range of 5–6 µg. SDS-PAGE of this material followed by CBB staining showed the faint bands corresponding to GPC forms and no additional protein bands (data not shown). This indicated that isolated GPC forms, even if not pure, are at least the major components of the obtained material. The recombinant forms of GPC eluted with 100 mM imidazole were stained in immunoblotting (Fig. 5) using the MoAb 1F6 which recognizes the C-terminal epitope (aa residues 110–115) in GPC polypeptide chain [16]. The apparent molecular weights of the recombinant GPC and both mutants GPC.Yus and GPC.Ge were similar to those of the GPC and GPC.Ge variant from erythrocytes. Similarly to RBC GPC forms, the recombinant GPC migrated as a narrow band, while the recombinant GPC.Yus and GPC.Ge mutants showed as broad ‘diffuse’ bands. These data show that heterogeneity of GPC mutants, which may reflect an increased intermolecular heterogeneity in glycosylation, is independent of the expression system (RBC or COS 7 cells), but is probably related to the structure of the polypeptide chain. DISCUSSION Most studies performed so far on Gerbich antigens and on specificity of anti-GPC antibodies were based on using rare RBC variants of Ge and Yus type. To overcome the low availability of these variant RBCs, we used CHO and COS 7 cells for the stable or transient surface expression, respectively, of the recombinant GPC and its variant forms. The expression of these glycoproteins in stable CHO clones was distinctly shown by flow cytometry, but the level of expression
126
E. Jaskiewicz et al.
Fig. 3. Stable expression of the recombinant GPC, GPC.Yus and GPC.Ge (clones C1, B3 and H9, respectively) in CHO cells, characterized with the MoAbs: 2G11 and 3C4 that recognize internal epitopes in GPC polypeptide chain. Untransfected CHO cells served as control.
Fig. 4. Transient expression of the recombinant forms of GPC in COS 7 cells, characterized with the MoAbs: 1G4, 2G11 and 3C4. Untransfected COS 7 cells served as control. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens
127
Fig. 5. Immunostaining of natural and purified recombinant forms of GPC using the MoAb 1F6 that recognizes C-terminal epitope (aa 110-115 residues) in GPC polypeptide chain. Normal and variant Gerbich negative (Ge-2,-3,4) RBC membranes (panel A) and recombinant proteins purified on Ni–NTA–agarose (panel B), were separated in SDSPAGE and transferred to nitrocellulose as described in Materials and Methods.
was too low for detection of the recombinant antigens by immunoblotting and for their purification. It is noteworthy that the expression of GPC in RBCs is also relatively low (approx. 105 copies per cell) [24], as compared to GPA expressed as approx. 106 copies per cell. GPA was also efficiently expressed in CHO cells using the same pSG5 expression vector [22, 23] which was applied for GPC. The difference in expression of GPC and GPA does not seem to be mediated by the structure of their cytoplasmic tails, since we were not successful in obtaining an improved expression in CHO cells of the chimeric construct GPC/A, consisting of the N-terminal portion of GPC and cytoplasmic tail of GPA. The relatively low expression of recombinant antigens also suggests that GPC expression may not depend exclusively on the promoter, i.e. SV40 of pSG5 vector, or in natural conditions on a tissue specific promoter [25, 26]. The high level of expression of GPC, GPC.Yus and GPC.Ge obtained in transiently transfected COS 7 cells allowed purification of recombinant antigens. The purified recombinant GPC and its both mutants Transfus Clin Biol 2002 ; 9 : 121–9
migrated in SDS-PAGE similarly to GPC forms from RBCs membranes, i.e. the recombinant GPC.Yus and GPC.Ge mutants appeared as the broad, ‘diffuse’ bands, in contrast to the ‘sharp’ GPC band. This difference is likely to be related to altered glycosylation of GPC mutants. The structure of oligosaccharide chains of purified GPC has not been studied, but basing on the binding of lectins and anti-carbohydrate antibodies, it is generally believed that the glycans of GPC from RBCs are identical to those found in GPA: most of the O-glycans are classical tetrasaccharides NeuAcα(2–3)Galβ(1–3)[NeuAcα(2–6)]GalNAc, and the N-glycan is a disialylated bisected biantenary complex type chain with one lactosamine unit in each antenna [27]. The results of endo-glycosidase digestion indicated that both GPC mutants contain the repeated lactosamine units of different length in N-glycosidic chain [2, 8]. However, the differences in O-glycosylation cannot be ruled out either. The similar ‘diffuse’ character of purified recombinant and natural GPC.Yus and GPC.Ge mutants suggests a similar tendency in alteration of their glycosylation in different
128
E. Jaskiewicz et al.
cell systems, regardless the possible differences in the structure of glycans produced in RBCs and COS 7 cells. The molecular basis of the change in glycosylation of GPC deletion mutants in RBCs, and in particular, the reason why a deletion of a part of the polypeptide chain can affect its glycosylation, has not been studied yet. One of possible explanations is that a shorter molecule is better available for membrane-bound glycosyltransferases [28]. The N-glycosylation sites in shorter GPC.Yus and GPC.Ge mutants are closer to a membrane that could cause the preferential synthesis of polylactosamine units. There is another possibility that the deletion mutants may have a different transit time in the Golgi and may become more heavily glycosylated. The recombinant GPC forms are good model molecules to explore this problem in further studies. In conclusion, the recombinant forms of GPC described in this report are useful for different approaches. They can replace rare RBCs carrying GPC variants in serological studies on Gerbich antigens and in elucidation of fine specificity of natural human and monoclonal anti-GPC antibodies. We have already used them for identification of glycopeptidic epitopes for a few murine monoclonal antibodies with anti-GPC specificity [12]. As discussed above, the recombinant forms of GPC can also serve for studies on other more complex issues, including the mechanisms regulating the biosynthesis of oligosaccharide chains.
5
6
7 8
9
10
11
12
ACKNOWLEDGEMENTS
13
Supported by grant No 6P04A 01512 from the Committee for Scientific Studies (KBN), Warsaw.
14
REFERENCES
15
1
2
3
4
Cartron JP, Le Van Kim C, Colin Y. Glycophorin C and related glycoprotiens: structure, function and regulation. Sem Hematol 1993;30:152–68. Reid M, Spring FA. Molecular basis of glycophorin C variants and their associated blood group antigens. Transfus Med 1994;4:139–46. Colin Y, Le Van Kim C, Tsapis A, Clerget M, d’Auriol L, London J, Galibert F, Cartron JP. Human erythrocyte glycophorin C. Gene structure and rearragement in genetic variants. J Biol Chem 1989;264:3773–80. High S, Tanner MJA, MacDonald EB, Anstee DJ. Rearrangement of the red-cell membrane glycophorin C (sialoglycoprotein ß) gene. A further study of alterations in the glycophorin C gene. Biochem J 1989;262:47–54.
16
17
18
19
Le Van Kim C, Piller V, Cartron JP, Colin Y. Glycophorins C and D are generated by the use of alternative translation initiation sites. Blood 1996;88:2364–5. Dahr W, Kiedrowski S, Blanchard D, Hermand P, Moulds JJ, Cartron JP. High frequency antigens of human erythrocyte membrane sialoglycoproteins. V. Characterization of the Gerbich blood group antigens: Ge2 and Ge3. Biol Chem HoppeSeyler 1987;368:1375–83. McShane K, Chung A. A novel human alloantibody in the Gerbich system. Vox Sang 1989;57:205–9. Reid ME, Anstee DJ, Tanner MJA, Ridgwell K, Nurse GT. Structural relationships between human erythrocyte sialoglycoproteins ß and γ and abnormal sialoglycoproteins found in certain rare human erythrocyte variants lacking the Gerbich blood-group antigens. Biochem J 1987;244:123–8. Yazdanbakhsh K, Oyen R, Yu Q, Lee S, Antoniou M, Chaudhuri A, Reid ME. High-level stable expression of blood group antigens in a heterologous system. Am J Hematol 2000;63:114–24. Blackall DP, Ugorski M, Pahlson P, Shakin-Eshleman SH, Spitalnik SL. A molecular biological approach to study the fine specificity of antibodies directed to the MN human blood group antigens. J Immunol 1994;152:2241–7. Blackall DP, Ugorski M, Smith ME, Pahlson P, Spitalnik SL. The binding of human alloantibodies to recombinant glycophorin A. Transfusion 1992;32:629–32. Jaskiewicz E, Blanchard D, Lisowska E. Recombinant forms of glycophorin C as a useful tool to study peptidic epitopes. In: ˙ eromski J, editors. EFIS 2000, Mackiewicz A, Kurpisz M, Z Monduzzi Editore – MEDIMOND Inc. 2001. p. 357–62. Loirat MJ, Gourbil A, Frioux Y, Muller JY, Blanchard D. A murine monoclonal antibody directed against the Gerbich 3 blood group antigen. Vox Sang 1992;62:45–8. Loirat MJ, Dahr W, Muller JY, Blanchard D. Characterization of new murine monoclonal antibodies directed against glycophorins C and D. Transfus Med 1994;4:147–55. Reid ME, Lisowska E, Blanchard D. Coordinator’s report: Glycophorin/Band 3 and associated antigens. Transfus Clin Biol 1997;1:57–64. Wasniowska K, Jaskiewicz E, Czerwinski M, Syper D, Lisowska E. Mapping of peptidic epitopes of glycophorins A (GPA) and C (GPC) with peptides synthesized on plastic pins (Pepscan analysis). Transfus Clin Biol 1997;1:73–5. Wasniowska K, Czerwinski M, Jachymek W, Lisowska E. Expression and binding properties of a soluble chimeric protein containing the N-terminal domain of the Duffy antigen. Biochem Biophys Res Commun 2000;273:705–11. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd Ed., Vol 1-3. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989. Laemmli UK. Ceavage of structural proteins during assembly of bacteriophage T4. Nature 1970;227:680–5. Transfus Clin Biol 2002 ; 9 : 121–9
Recombinant forms of Gerbich blood group antigens 20 Jaskiewicz E, Moulds JJ, Kraemer K, Goldstein AS, Lisowska E. Characterization of the epitope recognized by a monoclonal antibody highly specific for blood group M antigen. Transfusion 1990;30:230–5. 21 Kusnierz-Alejska G, Seifried H, Jaskiewicz E, Janczarski M. Alloantibody anti-Gerbich. Blood transfusion problems and family studies. Materia Medica Polona 1991;1:8–13. 22 Pahlson P, Blackall DP, Ugorski M, Czerwinski M, Spitalnik SL. Biochemical characterization of the O-glycans on recombinant glycophorin A expressed in Chinese hamster ovary cells. Glycoconjugate J 1994;11:43–50. 23 Remaley AT, Ugorski M, Wu N, Litzky L, Burger SR, Moore JS, Fukuda M, Spitalnik SL. Expression of human glycophorin A in wild type and glycosylation-deficient Chinese hamster ovary cells. J Biol Chem 1991;266:24176–83. 24 Smythe J, Gardner B, Anstee DJ. Quantitation of the number of molecules of glycophorins C and D on normal red blood
Transfus Clin Biol 2002 ; 9 : 121–9
129
cells using radioiodinated Fab fragments of monoclonal antibodies. Blood 1994;83:1668–72. 25 Le Van Kim C, Colin Y, Mitjavila MT, Clerget M, Dubart A, Nakazawa M, Vainchenkers W, Cartron JP. Structure of the promoter region and tissue specificity of the human glycophorin C gene. J Biol Chem 1989;264:20407–14. 26 Colin Y, Joulin V, Le Van Kim C, Romeo PH, Cartron JP. Characterization of a new erythroid/megakaryocyte-specific nuclear factor that binds the promoter of the housekeeping human glycophorin C gene. J Biol Chem 1990;265:16729–32. 27 Lisowska E. Antigenic properties of human glycophorins- an update. Adv Exp Med Biol 2001;491:145–59. 28 Fukuda M, Guan JL, Rose JK. A membrane anchored form but not the secretory form of human chorionic gonadotropin-α chain acquires polylactosaminoglycan. J Biol Chem 1988;263:5314–8.