- Email: [email protected]
Recombinant guinea pig TNF-α enhances antigen-specific type 1 T lymphocyte activation in guinea pig splenocytes
ARTICLE IN PRESS Tuberculosis (2007) 87, 87–93
Available at www.sciencedirect.com
journal homepage: http://intl.elsevierhealth.com/journals/tube
Recombinant guinea pig TNF-a enhances antigen-specific type 1 T lymphocyte activation in guinea pig splenocytes Hyosun Cho, David N. McMurray Department of Medical Microbiology and Immunology, The Texas A&M University System Health Science Center, 407 Reynolds Medical Building, College Station, TX 77843-1114, USA Received 13 July 2005; received in revised form 23 November 2005; accepted 2 December 2005
KEYWORDS BCG; TNF-a IFN-g; Guinea pig
Summary TNF-a is a principal pro-inflammatory cytokine which contributes to the activation of innate immunity and the transition to antigen-specific adaptive immunity in tuberculosis. Using recombinant guinea pig (rgp) TNF-a, the effect of TNF-a on lymphocyte activation was examined in unvaccinated and BCG-vaccinated guinea pigs. Splenocytes were stimulated with PPD or ConA, in the presence or absence of rgp TNF-a for 96 h. Lymphocyte proliferation was measured using [3H]thymidine uptake, and IL-12 p40 and IFN-g mRNA were analyzed using real-time PCR. rgpTNF-a alone was able to stimulate a significant degree of proliferation in splenocytes. The addition of rgpTNF-a to PPDstimulated cells enhanced the proliferation of splenocytes from BCG-vaccinated guinea pigs. Furthermore, enhancement of proliferation by rgpTNF-a was found to be correlated with upregulation of the levels of Type 1 cytokine mRNA (IL-12p40 and IFN-g) in splenocyte cultures. This suggests that TNF-a plays an important role in the regulation of Type 1 T cellmediated immune responses in the guinea pig. & 2005 Elsevier Ltd. All rights reserved.
Introduction Control of infection with Mycobacterium tuberculosis requires cell mediated immunity, which results from the interaction between T cells and antigen-presenting cells Corresponding author. Tel.: +1 979 845 3679;
fax: +1 979 845 3479. E-mail address: [email protected] (H. Cho). 1472-9792/$ - see front matter & 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.tube.2005.12.001
(APC), mainly macrophages and dendritic cells.1,2 CD4+ T cells are essential because they are activated by M. tuberculosis antigens to produce the critical macrophage activating cytokines, TNF-a and IFN-g, which enhance the ability of macrophages to control intracellular mycobacteria.3,4 TNF-a, IL-12 and IFN-g are central cytokines in the successful effector phase of cell-mediated immunity to M. tuberculosis. TNF-a, produced mainly by macrophages, is essential for the formation of granulomas, which serve to
ARTICLE IN PRESS 88 focus blood-borne immune cells at the site of infection and contain the bacteria.5,6 IL-12 is a heterodimeric molecule consisting of IL-12 p35 and IL-12 p40.7 It is secreted primarily by activated macrophages and dendritic cells and acts on CD4+T cells to induce Th1 differentiation. 8Recently, IL-12 has been shown to be crucial to the development of protective immunity against TB in mouse and human studies.9,10IFN-g, the prototypical Th1-type cytokine, is a key mediator of macrophage activation and resistance to M. tuberculosis. It is known to stimulate major histocompatibility complex (MHC) II expression on APC and to enhance a variety of cellular responses, e.g. NO production and cytokine production. 11 The importance of IFN-g in TB was demonstrated by the increased susceptibility of IFN-g knockout mice to mycobacterial infection.12 Also, in humans, Levin et al. reported that a mutation in an IFN-g receptor was linked to a unique susceptibility to mycobacterial infection.13 TNF-a has been shown to activate macrophages as assessed by the upregulation of MHC Class II expression, to stimulate T cell proliferation, and to induce IL-2R expression in human and mouse studies.14,15 However, the relationship between the TNF-a and T cell polarization toward a Th1 response is not clearly understood. A few studies have reported a positive correlation between TNF-a and Th1 cytokine profiles. TNF-a has been shown to induce IL-12 production by macrophages, which favors the development of a Th1 response.16 In addition, TNF-a has been observed to induce T cell IFN-g production in human and mouse cells.17,18 Successful vaccination against M. tuberculosis is known to require activated Th1 cells and the predominance of Th1 cytokines, e.g. IL-12 and IFN-g. Previously, we reported that BCG-vaccination increased bioactive TNF-a responses in guinea pig leukocyte populations infected with mycobacteria in vitro.19 Recently, we demonstrated that recombinant guinea pig (rgp) TNF-a induced IL-12p40 mRNA expression in both guinea pig alveolar and peritoneal macrophage populations.20 Thus, our previous studies suggest that TNF-a may play an important role in the development and expression of a Th1 response in the guinea pig. Therefore, in this study, we investigated the effect of rgpTNF-a on lymphocyte proliferation and expression of IL12p40 and IFN-g in splenocytes from BCG-vaccinated and naı¨ve guinea pigs.
Materials and methods Production of rgp TNF-a The cloning of gp TNF-a cDNA was previously described21. The subcloning and expression of the guinea pig TNF-a gene followed a previously published protocol from our laboratory.22
Animals Specific pathogen-free, outbred Hartley strain guinea pigs (Charles River Breeding Laboratories, Inc., Wilmington, MA) were individually housed in polycarbonate cages on stainless-steel grid floors and provided commercial chow (Ralston
H. Cho, D.N. McMurray Purina, St. Louis, MO) in stainless-steel feeders and tap water ad libitum. All procedures were reviewed and approved by the Texas A&M University Laboratory Animal Care Committee.
BCG vaccination Guinea pigs were vaccinated intradermally with 0.1 ml (103 cfu) of viable Mycobacterium bovis BCG (Danish 1331 strain; Statens Seruminstitut Copenhagen, Denmark) vaccine and rested for 8–10 weeks postvaccination for this study.
Preparation of splenocytes Guinea pigs were euthanized by the intraperitoneal injection of 100 mg/kg of sodium pentobarbital (Sleepaway; Fort Dodge Laboratories Inc.). The spleens from naı¨ve as well as BCG-vaccinated animals were removed aseptically and placed in 3 ml of RPMI medium (Irvine Scientific, Santa Ana, CA). A single-cell suspension was prepared by gentle homogenization following our published protocol.19,23 After depletion of red blood cells, the cell pellet was resuspended in RPMI medium supplemented with 2 mM glutamine (Irvine Scientific), 0.01 mM 2-mercaptoethanol (Sigma, St. Louis, MO), 100 U of penicillin (Irvine Scientific) per ml, 100 mg of streptomycin (Irvine Scientific) per ml, and 10% heatinactivated fetal bovine serum (FBS; Atlanta Biologicals, Norcross, GA). Viable splenocytes were enumerated by trypan blue exclusion. The characterization of the resulting cell population in terms of the relative proportions of lymphocytes, macrophages, and other cell types has been published previously.19
Cell stimulation Cells from naı¨ve or BCG-vaccinated animals were seeded into 96-well tissue culture plates (2 105 cells/well) in the presence or absence of 50 ng/ml of rgpTNF-a. Another set of cells from BCG-vaccinated animals were plated in a same way and stimulated with 12.5 ug/ml of M. tuberculosis PPD (Statens Seruminstitut, Copenhagen, Denmark) in the presence or absence of 50 ng/ml of rgpTNF-a. After 6, 12, and 18 h in culture at 37 1C in a 5% CO2 in air atmosphere, cells were lysed with buffer RLT (Qiagen) and frozen at 80 1C. The 50 ng/ml dose of rgpTNF-a was chosen because it stimulated a significant increase in splenocyte proliferation alone.
Lymphoproliferation assay Cells were seeded into 96-well plates at the identical concentrations described above in medium alone, or in the presence of various concentrations of rgpTNF-a, M. tuberculosis PPD (Statens Seruminstitut, Copenhagen, Denmark) or Concanavalin A (ConA) (Sigma, St. Louis, MO) and cultured using our published procedure.23 The cultures were incubated for 96 h at 37 1C in 5% CO2 incubator and labeled with 1.0 mCi of [3H]thymidine per well for the final 6 h of the incubation. Cells were harvested
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes
Total-RNA isolation and real time PCR Total-RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA). Reverse transcription was performed using Taqman reverse transcription reagents (Applied Biosystems, Foster City, CA). Real time primer sequences for guinea pig TNF-a and IFN-g mRNA were published previously.24 Primers for IL-12p40 and HPRT mRNA were constructed as follows: IL-12p40 (forward primer, CCACAGTTTCATGCCACAAGA; reverse primer, CCATTCGCTCCA CGATGAG) and HPRT (forward primer, AGGTGTTTATCCCTCATGGACTA ATT; reverse primer, CCTCCCATCTCCTTCATCACAT). Quantitative real time PCR was performed using SYBR Green PCR Supermix and the ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA) according to our previously published protocols.24Fold induction levels of mRNA were obtained by analyzing cycle threshold (Ct) levels normalized to HPRT Ct values and then normalized to the values derived from unstimulated splenocyte cultures.
7 Stimulation Index (SI)
onto glass wool fiber filters using an automated cell harvester (FilterMate TM, Packard). Proliferation was quantified by determining the number of counts per minute (cpm) with a liquid scintillation counter (LS8000; Beckman Instruments, Inc., Fullerton, CA). The results were expressed as a stimulation index (SI), which was the cpm from stimulated cells divided by the cpm from unstimulated cells from the same animal.
89
6 5 4 3 2 1 0 0
10
50 100 rgpTNF-α(ng/ml)
200
Fig. 1 Effect of rgpTNF-a on spontaneous splenocyte proliferation. Splenocytes from both unvaccinated (open bars) and BCG-vaccinated (closed bars) guinea pigs were prepared as described in the text and cultured for 96 h in the presence of 10, 50, 100 or 200 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three or four animals per group. Differences based upon vaccination status were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
PPD
Statistical analysis
PPD+TNFα50ng/ml PPD+TNFα100ng/ml
Results Effect of rgp TNF-a on splenocyte proliferation Splenocytes from both unvaccinated and BCG-vaccinated guinea pigs were cultured with various concentrations of rgpTNF-a and the proliferation was measured by incorporation of [3H]thymidine after 96 h. Fig. 1 show that rgpTNF-a alone was capable of inducing proliferation in splenocytes from BCG-vaccinated guinea pigs to a significantly greater extent that splenocytes from unvaccinated guinea pigs in all concentrations of rgpTNF-a used in this study. Doses above 50 ng/ml appeared to stimulate about the same level of proliferation.
Effect of rgp TNF-a on antigen-specific splenocyte proliferation Cultures of splenocytes from BCG-vaccinated guinea pigs were stimulated with PPD (1, 5 and 12.5 ug/ml) alone or in the presence of 50, 100, and 200 ng/ml of rgpTNF-a and the proliferation was measured as described above. As illu-
PPD+TNFα200ng/ml 25 Stimulation Index (SI)
Analysis of variance (ANOVA) was used to examine main treatment effects. Differences between in vitro stimulated cultures were tested for statistical significance at the 95% confidence interval by Duncan’s post hoc analysis. The statistical tests were performed with SAS software (release 8.01; SAS Institute, Inc., Cary, NC).
20 15 10 5 0 0
5
1
12.5
PPD(ug/ml)
Fig. 2 Effect of rgpTNF-a on PPD-induced splenocyte proliferation. Splenocytes from BCG-vaccinated guinea pigs were cultured for 96 h with PPD (1, 5, 12.5 ug/ml) alone or in the presence of 50, 100, 200 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three animals. Differences between PPD doses and between rgpTNF-a-treated and untreated cultures were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
strated in Fig. 2, splenocyte proliferation was increased in a PPD dose-dependent manner. The addition of rgpTNF-a resulted in a significant (po0.05) enhancement of PPD-
ARTICLE IN PRESS 90
H. Cho, D.N. McMurray IL-12p40
ConA ConA+TNFα50ng/ml
Fold Induction
4
150 100 50
3 2 1 0 6
0 0
0.5 1 ConA(ug/ml)
5
Fig. 3 Effect of rgpTNF-a on ConA-induced splenocyte proliferation. Splenocytes from BCG-vaccinated guinea pigs were cultured for 96 h with ConA (0.5, 1, 5 ug/ml) alone or in the presence of 50 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three animals. Differences between different doses of ConA, and between rgpTNF-a-treated and untreated cultures were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
(A)
Effect of rgpTNF-a on cytokine mRNA expression in splenocytes from both unvaccinated and BCGvaccinated guinea pigs Splenocytes from both unvaccinated and BCG-vaccinated guinea pigs were stimulated with 50 ng/ml of rgpTNF-a. The expression of IL-12 p40 and IFN-g mRNA was examined by real-time quantitative RT-PCR at 6, 12, and 18 h after stimulation, and the results are shown in Fig. 4. The levels of IL-12 p40 mRNA (Fig. 4A) in splenocytes from BCG-vaccinated guinea pigs increased with time in culture and were significantly (po0.05) higher than those from unvaccinated guinea pigs at all intervals. IFN-g mRNA expression (Fig. 4B) increased dramatically (po0.05) at 18 h in rgpTNF-a-treated splenocytes from BCGvaccinated guinea pigs, while the levels remained at
18
8 6 4 2 0 6 (B)
induced proliferation at the highest dose (12.5 ug/ml) of PPD used. However, at the two lower doses of PPD, the promoting effect of rgpTNF-a on proliferation was not statistically significant. To determine whether rgpTNF-a alters mitogen-induced splenocyte proliferation, splenocytes from vaccinated guinea pigs were stimulated with ConA (0.5, 1 and 5 ug/ml) alone or in the presence of rgpTNF-a (50 ng/ml). As shown in Fig. 3, ConA-induced proliferation was clearly dose-dependent, with the SI at 5 ug/ml being statistically (po0.05) greater than the SI at 0.5 and 1.0 ug/ml. However, the addition of a dose of rgpTNF-a which resulted in significantly enhanced PPDinduced proliferation, did not affect ConA-stimulated proliferation.
12 time(hours) IFN-γ
Fold Induction
Stimulation Index (SI)
200
12 time(hours)
18
Fig. 4 Expression of IL-12 p40 and IFN-g mRNA in guinea pig splenocytes stimulated by rgpTNF-a alone. Levels of IL-12 p40 (A) and IFN-g (B) mRNA were quantified in guinea pig splenocyte cultures from both unvaccinated (hatched bars) and BCGvaccinated (closed bars) guinea pigs at 6, 12 and 18 h after stimulation with 50 ng/ml of rgpTNF-a. Fold induction was determined from the threshold cycle values normalized for HPRT expression and then normalized to the values derived from unstimulated splenocyte cultures (open bars). Results are displayed as the mean7SEM of three animals per group. Asterisks denote a statistically significant (po0.05) effect of vaccination on fold induction.
baseline at all intervals in the cells from unvaccinated guinea pigs.
Effect of rgpTNF-a on cytokine mRNA expression in PPD-stimulated splenocytes from BCG-vaccinated guinea pigs Splenocytes from vaccinated guinea pigs were stimulated with 12.5 ug/ml of PPD alone or with rgpTNF-a (50 ng/ml) for 6, 12, and 18 h. Total RNA from splenocytes was collected, and real-time PCR was performed to detect IFN-g and IL12p40 mRNA levels. Fig. 5 demonstrates that levels of IL-12 p40 mRNA (Fig. 5A) peaked at 12 h, and there was no significant difference between rgpTNF-a-treated and untreated cultures. However, IFN-g mRNA (Fig. 5B) levels increased steadily over the 18 h culture period, and were enhanced significantly by the addition of 50 ng/ml of rgpTNF-a at both 12 and 18 h (po0.05).
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes IL-12p40 control PPD
Fold Induction
30
PPD+TNF-α 50ng/ml
20 10 0 6
(A)
12 time(hours)
18
IFN-γ control
Fold Induction
2000
PPD PPD+TNF-α 50ng/ml
1500 1000 500 0 6
(B)
12 time(hours)
18
Fig. 5 Expression of PPD-induced IL-12 p40 and IFN-g mRNA levels in guinea pig splenocytes treated with rgpTNF-a. Levels of IL-12 p40 (A) and IFN-g (B) mRNA were quantified in guinea pig splenocyte cultures from BCG-vaccinated guinea pigs at 6, 12 and 18 h after stimulation with 12.5 ug/ml of PPD alone or in the presence of 50 ng/ml of rgpTNF-a. Fold induction was determined from the threshold cycle values normalized for HPRT expression and then normalized to the values derived from unstimulated splenocyte cultures. Results are displayed as the mean7SEM of three animals per group. Significant differences between rgpTNF-a-treated and untreated cultures are denoted by an asterisk [po0.05(*)].
Discussion TNF-a is known to play a protective role in tuberculosis by its contribution to the successful organization of granulomas and bacterial killing within macrophages.25,26 Also, it has been shown to act synergistically with IFN-g for effective macrophage activation.27 Activated macrophages are not only the primary mediators of host defense against M. tuberculosis, but also are essential for antigen presentation to T cells. M. tuberculosis has evolved mechanisms to interfere with intraphagocytic events, resulting in its survival within unactivated macrophages. Therefore, the outcome of the interaction between host and pathogen is determined by cooperation between infected macrophages and T cells. A number of studies have reported a correlation between TNF-a and T cell activation. TNF-a has been shown to induce T cell proliferation through the expression of IL-2 receptors on T cells, as well as MHC on accessory cells in humans.14
91
Yokota et al. found that recombinant human (rh) TNF-a promoted T cell proliferation directly in the absence of accessory cells.15 In the present study, we report that rgp TNF-a increases both proliferative and functional capabilities of guinea pig T cells. rgp TNF-a alone was shown to induce a significant proliferation in splenocytes which were activated by prior exposure to BCG (Fig. 1). In contrast, rgp TNF-a induced little proliferation in splenocytes from unvaccinated guinea pigs (Fig. 1). This interesting effect of prior vaccination is consistent with an earlier study which demonstrated that rh TNF-a was able to promote T cell proliferation by enhancing the expression of high affinity IL2 receptors on activated T cells, but not on resting T cells.28 In the same study, rh TNF-a was shown to increase the IL-2 dependent IFN-g production. We have also observed that splenocytes stimulated to proliferate by rgp TNF-a also upregulated the mRNA expression of two Th1 cytokines, IL12p40 and IFN-g (Fig. 4). In separate experiments, the effect of rgp TNF-a on antigen-specific proliferation was investigated using PPD. The addition of exogenous rgp TNF-a increased PPD-induced proliferation in splenocytes from BCG-vaccinated guinea pigs (Fig. 2). A much higher concentration of rgpTNF-a was previously shown to suppress PPD-induced lymphoproliferation in splenocytes from BCG-vaccinated guinea pigs, which is inconsistent with the results from the present study.22 It is possible that higher concentration of rgp TNF-a induced apoptosis in PPD-stimulated T cells, resulting in cell death in the previous study. ConA-induced proliferation was not affected by additional TNF-a (Fig. 3), which suggests that enhanced proliferation in splenocytes from BCG-vaccinated guinea pigs by rgp TNF-a is antigen-specific. Interestingly, rh TNF-a has been reported to enhance both antigen- and mitogen-induced proliferation of T cells,15 which suggests that there might be species differences in the stimulation of a T cell response by TNF-a. Alternatively, different effects of TNF-a on proliferative responses between ConA and PPD might be explained by the differential regulation of costimulatory signals provided by the APC.29,30 The enhancement in PPD-induced proliferation by TNF-a was found to be positively related to significant upregulation of IFN-g mRNA levels (Fig. 5). The relationship between the TNF-a and differentiation of T cells toward a Th1 cytokine profile is still under investigation, however, several recent studies have shown them to be linked. Kichian et al. suggested that TNF-a induces IL-12 production by activating macrophages, and that IL-12 promotes the development of a Th1 response in the mouse.16 In humans, Mytar et al. observed that preincubation of APCs with TNF-a enhanced their ability to induce IFN-g production whereas TNF-a synthesis inhibitors decreased it.18 IFN-g has been shown to stimulate TNF-a production in the mouse.31 Therefore, the augmentation of IFN-g production by TNF-a might be a positive feedback circuit between macrophages and T cells to maintain a mutually activated state. Another possible explanation would be the autocrine activation by endogenous TNF-a production from macrophages. However, we cannot conclude whether TNF-a affects either APCs or T lymphocytes or both populations in our splenocyte cultures. It would not be feasible to examine the effect of TNF-a on T lymphocytes alone, since
ARTICLE IN PRESS 92 the most relevant T cell response (i.e. to mycobacterial antigens) would not occur in the absence of APC. Also, it would be difficult to obtain a highly purified T cell population without contaminating APC in the guinea pig (since no columns or magnetic bead kits exist). In addition, we were unable to measure protein levels of either IL-12 or IFN-g because reagents are not yet available, Therefore, we cannot rule out the possibility that some of the IL-12p40 mRNA would contribute to the synthesis of IL-23, which shares the p40 subunit with IL-12.8 In conclusion, our study provides the first evidence that TNF-a plays an important role in antigen-specific T cell activation in the guinea pig. TNF-a appears to contribute, alone and in combination with antigen, to the proliferation of T cells and expression of Type 1 cytokines, IL-12 or IFN-g, in splenocytes from BCG-vaccinated guinea pigs.
Acknowledgements This work was supported by National Institutes of Health Grant RO1 AI 15495 to DNM.
References 1. Boom WH, Canaday DH, Fulton SA, Gehring AJ, Rojas RE, Torres M. Human immunity to M. tuberculosis: T cell subsets and antigen processing. Tuberculosis (Edinburgh) 2003;83:98–106. 2. Unanue ER. Antigen-presenting function of the macrophage. Annu Rev Immunol 1984;2:395–428. 3. Boom WH, Wallis RS, Chervenak KA. Human Mycobacterium tuberculosis-reactive CD4+ T-cell clones: heterogeneity in antigen recognition, cytokine production, and cytotoxicity for mononuclear phagocytes. Infect Immun 1991;59:2737–43. 4. Tsukaguchi K, de Lange B, Boom WH. Differential regulation of IFN-gamma, TNF-alpha, and IL-10 production by CD4(+) alphabetaTCR+ T cells and vdelta2(+) gammadelta T cells in response to monocytes infected with Mycobacterium tuberculosisH37Ra. Cell Immunol 1999;194:12–20. 5. Algood HM, Lin PL, Yankura D, Jones A, Chan J, Flynn JL. TNF influences chemokine expression of macrophages in vitro and that of CD11b+ cells in vivo during Mycobacterium tuberculosis infection. J Immunol 2004;172:6846–57. 6. Bean AG, Roach DR, Briscoe H, France MP, Korner H, Sedgwick JD, Britton WJ. Structural deficiencies in granuloma formation in TNF gene-targeted mice underlie the heightened susceptibility to aerosol Mycobacterium tuberculosis infection, which is not compensated for by lymphotoxin. J Immunol 1999;162: 3504–11. 7. Abdi K. IL-12: the role of p40 versus p75. Scand J Immunol 2002;56:1–11. 8. Trinchieri G. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol 2003;3: 133–46. 9. Greinert U, Ernst M, Schlaak M, Entzian P. Interleukin-12 as successful adjuvant in tuberculosis treatment. Eur Respir J 2001;17:1049–51. 10. Nolt D, Flynn JL. Interleukin-12 therapy reduces the number of immune cells and pathology in lungs of mice infected with Mycobacterium tuberculosis. Infect Immun 2004;72: 2976–88. 11. Yamamura M, Uyemura K, Deans RJ, Weinberg K, Rea TH, Bloom BR, Modlin RL. Defining protective responses to pathogens: cytokine profiles in leprosy lesions. Science 1991;254: 277–9.
H. Cho, D.N. McMurray 12. Flynn JL, Chan J, Triebold KJ, Dalton DK, Stewart TA, Bloom BR. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178: 2249–54. 13. Levin M, Newport M. Understanding the genetic basis of susceptibility to mycobacterial infection. Proc Assoc Am Physicians 1999;111:308–12. 14. Ranges GE, Bombara MP, Aiyer RA, Rice GG, Palladino Jr MA. Tumor necrosis factor-alpha as a proliferative signal for an IL-2dependent T cell line: strict species specificity of action. J Immunol 1989;142:1203–8. 15. Yokota S, Geppert TD, Lipsky PE. Enhancement of antigen- and mitogen-induced human T lymphocyte proliferation by tumor necrosis factor-alpha. J Immunol 1988;140:531–6. 16. Kichian K, Nestel FP, Kim D, Ponka P, Lapp WS. IL-12 p40 messenger RNA expression in target organs during acute graftversus-host disease. Possible involvement of IFN-gamma. J Immunol 1996;157:2851–6. 17. Brown GR, Lee EL, Thiele DL. TNF enhances CD4+ T cell alloproliferation, IFN-gamma responses, and intestinal graftversus-host disease by IL-12-independent mechanisms. J Immunol 2003;170:5082–8. 18. Mytar B, Woloszyn M, Ruggiero I, Pryjma J, Zembala M. Monocyte-mediated regulation of antigen-driven IFN gamma production by T cells. The role of endogenously produced TNF. Immunol Invest 1995;24:897–906. 19. Lasco TM, Yamamoto T, Yoshimura T, Allen SS, Cassone L, McMurray DN. Effect of Mycobacterium bovis BCG vaccination on Mycobacterium-specific cellular proliferation and tumor necrosis factor alpha production from distinct guinea pig leukocyte populations. Infect Immun 2003;71: 7035–42. 20. Cho H, Lasco TM, Allen SS, Yoshimura T, McMurray DN. Recombinant guinea pig tumor necrosis factor alpha stimulates the expression of interleukin-12 and the inhibition of Mycobacterium tuberculosis growth in macrophages. Infect Immun 2005;73:1367–76. 21. White AM, Yoshimura T, Smith AW, Westwick J, Watson ML. Airway inflammation induced by recombinant guinea pig tumor necrosis factor-alpha. Am J Physiol 1997;273:L524–30. 22. Lasco TM, Cassone L, Kamohara H, Yoshimura T, McMurray DN. Evaluating the role of tumor necrosis factor-alpha in experimental pulmonary tuberculosis in the guinea pig. Tuberculosis 2005;85:245–58. 23. Phalen SW, McMurray DN. T-lymphocyte response in a guinea pig model of tuberculous pleuritis. Infect Immun 1993;61: 142–5. 24. Allen SS, McMurray DN. Coordinate cytokine gene expression in vivo following induction of tuberculous pleurisy in guinea pigs. Infect Immun 2003;71:4271–7. 25. Flynn JL, Goldstein MM, Chan J, Triebold KJ, Pfeffer K, Lowenstein CJ, Schreiber R, Mak TW, Bloom BR. Tumor necrosis factor-alpha is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 1995;2:561–72. 26. Kindler V, Sappino AP, Grau GE, Piguet PF, Vassalli P. The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 1989;56:731–40. 27. Liew FY, Li Y, Millott S. Tumor necrosis factor-alpha synergizes with IFN-gamma in mediating killing of Leishmania major through the induction of nitric oxide. J Immunol 1990;145: 4306–10. 28. Scheurich P, Thoma B, Ucer U, Pfizenmaier K. Immunoregulatory activity of recombinant human tumor necrosis factor (TNF)alpha: induction of TNF receptors on human T cells and TNFalpha-mediated enhancement of T cell responses. J Immunol 1987;138:1786–90.
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes 29. Perrin PJ, Davis TA, Smoot DS, Abe R, June CH, Lee KP. Mitogenic stimulation of T cells reveals differing contributions for B7-1 (CD80) and B7-2 (CD86) costimulation. Immunology 1997;90:534–42. 30. Shortt J, Hart DN, Watson JD, Baird MA. Blockade of B7-2, not B7-1, inhibits purified protein derivative-primed T-lymphocyte
93
responses but fails to influence the proportion of Th1 versus Th2 subsets. Scand J Immunol 1998;47:355–62. 31. Schook LB, Albrecht H, Gallay P, Jongeneel CV. Cytokine regulation of TNF-alpha mRNA and protein production by unprimed macrophages from C57Bl/6 and NZW mice. J Leukoc Biol 1994;56:514–20.
Available at www.sciencedirect.com
journal homepage: http://intl.elsevierhealth.com/journals/tube
Recombinant guinea pig TNF-a enhances antigen-specific type 1 T lymphocyte activation in guinea pig splenocytes Hyosun Cho, David N. McMurray Department of Medical Microbiology and Immunology, The Texas A&M University System Health Science Center, 407 Reynolds Medical Building, College Station, TX 77843-1114, USA Received 13 July 2005; received in revised form 23 November 2005; accepted 2 December 2005
KEYWORDS BCG; TNF-a IFN-g; Guinea pig
Summary TNF-a is a principal pro-inflammatory cytokine which contributes to the activation of innate immunity and the transition to antigen-specific adaptive immunity in tuberculosis. Using recombinant guinea pig (rgp) TNF-a, the effect of TNF-a on lymphocyte activation was examined in unvaccinated and BCG-vaccinated guinea pigs. Splenocytes were stimulated with PPD or ConA, in the presence or absence of rgp TNF-a for 96 h. Lymphocyte proliferation was measured using [3H]thymidine uptake, and IL-12 p40 and IFN-g mRNA were analyzed using real-time PCR. rgpTNF-a alone was able to stimulate a significant degree of proliferation in splenocytes. The addition of rgpTNF-a to PPDstimulated cells enhanced the proliferation of splenocytes from BCG-vaccinated guinea pigs. Furthermore, enhancement of proliferation by rgpTNF-a was found to be correlated with upregulation of the levels of Type 1 cytokine mRNA (IL-12p40 and IFN-g) in splenocyte cultures. This suggests that TNF-a plays an important role in the regulation of Type 1 T cellmediated immune responses in the guinea pig. & 2005 Elsevier Ltd. All rights reserved.
Introduction Control of infection with Mycobacterium tuberculosis requires cell mediated immunity, which results from the interaction between T cells and antigen-presenting cells Corresponding author. Tel.: +1 979 845 3679;
fax: +1 979 845 3479. E-mail address: [email protected] (H. Cho). 1472-9792/$ - see front matter & 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.tube.2005.12.001
(APC), mainly macrophages and dendritic cells.1,2 CD4+ T cells are essential because they are activated by M. tuberculosis antigens to produce the critical macrophage activating cytokines, TNF-a and IFN-g, which enhance the ability of macrophages to control intracellular mycobacteria.3,4 TNF-a, IL-12 and IFN-g are central cytokines in the successful effector phase of cell-mediated immunity to M. tuberculosis. TNF-a, produced mainly by macrophages, is essential for the formation of granulomas, which serve to
ARTICLE IN PRESS 88 focus blood-borne immune cells at the site of infection and contain the bacteria.5,6 IL-12 is a heterodimeric molecule consisting of IL-12 p35 and IL-12 p40.7 It is secreted primarily by activated macrophages and dendritic cells and acts on CD4+T cells to induce Th1 differentiation. 8Recently, IL-12 has been shown to be crucial to the development of protective immunity against TB in mouse and human studies.9,10IFN-g, the prototypical Th1-type cytokine, is a key mediator of macrophage activation and resistance to M. tuberculosis. It is known to stimulate major histocompatibility complex (MHC) II expression on APC and to enhance a variety of cellular responses, e.g. NO production and cytokine production. 11 The importance of IFN-g in TB was demonstrated by the increased susceptibility of IFN-g knockout mice to mycobacterial infection.12 Also, in humans, Levin et al. reported that a mutation in an IFN-g receptor was linked to a unique susceptibility to mycobacterial infection.13 TNF-a has been shown to activate macrophages as assessed by the upregulation of MHC Class II expression, to stimulate T cell proliferation, and to induce IL-2R expression in human and mouse studies.14,15 However, the relationship between the TNF-a and T cell polarization toward a Th1 response is not clearly understood. A few studies have reported a positive correlation between TNF-a and Th1 cytokine profiles. TNF-a has been shown to induce IL-12 production by macrophages, which favors the development of a Th1 response.16 In addition, TNF-a has been observed to induce T cell IFN-g production in human and mouse cells.17,18 Successful vaccination against M. tuberculosis is known to require activated Th1 cells and the predominance of Th1 cytokines, e.g. IL-12 and IFN-g. Previously, we reported that BCG-vaccination increased bioactive TNF-a responses in guinea pig leukocyte populations infected with mycobacteria in vitro.19 Recently, we demonstrated that recombinant guinea pig (rgp) TNF-a induced IL-12p40 mRNA expression in both guinea pig alveolar and peritoneal macrophage populations.20 Thus, our previous studies suggest that TNF-a may play an important role in the development and expression of a Th1 response in the guinea pig. Therefore, in this study, we investigated the effect of rgpTNF-a on lymphocyte proliferation and expression of IL12p40 and IFN-g in splenocytes from BCG-vaccinated and naı¨ve guinea pigs.
Materials and methods Production of rgp TNF-a The cloning of gp TNF-a cDNA was previously described21. The subcloning and expression of the guinea pig TNF-a gene followed a previously published protocol from our laboratory.22
Animals Specific pathogen-free, outbred Hartley strain guinea pigs (Charles River Breeding Laboratories, Inc., Wilmington, MA) were individually housed in polycarbonate cages on stainless-steel grid floors and provided commercial chow (Ralston
H. Cho, D.N. McMurray Purina, St. Louis, MO) in stainless-steel feeders and tap water ad libitum. All procedures were reviewed and approved by the Texas A&M University Laboratory Animal Care Committee.
BCG vaccination Guinea pigs were vaccinated intradermally with 0.1 ml (103 cfu) of viable Mycobacterium bovis BCG (Danish 1331 strain; Statens Seruminstitut Copenhagen, Denmark) vaccine and rested for 8–10 weeks postvaccination for this study.
Preparation of splenocytes Guinea pigs were euthanized by the intraperitoneal injection of 100 mg/kg of sodium pentobarbital (Sleepaway; Fort Dodge Laboratories Inc.). The spleens from naı¨ve as well as BCG-vaccinated animals were removed aseptically and placed in 3 ml of RPMI medium (Irvine Scientific, Santa Ana, CA). A single-cell suspension was prepared by gentle homogenization following our published protocol.19,23 After depletion of red blood cells, the cell pellet was resuspended in RPMI medium supplemented with 2 mM glutamine (Irvine Scientific), 0.01 mM 2-mercaptoethanol (Sigma, St. Louis, MO), 100 U of penicillin (Irvine Scientific) per ml, 100 mg of streptomycin (Irvine Scientific) per ml, and 10% heatinactivated fetal bovine serum (FBS; Atlanta Biologicals, Norcross, GA). Viable splenocytes were enumerated by trypan blue exclusion. The characterization of the resulting cell population in terms of the relative proportions of lymphocytes, macrophages, and other cell types has been published previously.19
Cell stimulation Cells from naı¨ve or BCG-vaccinated animals were seeded into 96-well tissue culture plates (2 105 cells/well) in the presence or absence of 50 ng/ml of rgpTNF-a. Another set of cells from BCG-vaccinated animals were plated in a same way and stimulated with 12.5 ug/ml of M. tuberculosis PPD (Statens Seruminstitut, Copenhagen, Denmark) in the presence or absence of 50 ng/ml of rgpTNF-a. After 6, 12, and 18 h in culture at 37 1C in a 5% CO2 in air atmosphere, cells were lysed with buffer RLT (Qiagen) and frozen at 80 1C. The 50 ng/ml dose of rgpTNF-a was chosen because it stimulated a significant increase in splenocyte proliferation alone.
Lymphoproliferation assay Cells were seeded into 96-well plates at the identical concentrations described above in medium alone, or in the presence of various concentrations of rgpTNF-a, M. tuberculosis PPD (Statens Seruminstitut, Copenhagen, Denmark) or Concanavalin A (ConA) (Sigma, St. Louis, MO) and cultured using our published procedure.23 The cultures were incubated for 96 h at 37 1C in 5% CO2 incubator and labeled with 1.0 mCi of [3H]thymidine per well for the final 6 h of the incubation. Cells were harvested
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes
Total-RNA isolation and real time PCR Total-RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA). Reverse transcription was performed using Taqman reverse transcription reagents (Applied Biosystems, Foster City, CA). Real time primer sequences for guinea pig TNF-a and IFN-g mRNA were published previously.24 Primers for IL-12p40 and HPRT mRNA were constructed as follows: IL-12p40 (forward primer, CCACAGTTTCATGCCACAAGA; reverse primer, CCATTCGCTCCA CGATGAG) and HPRT (forward primer, AGGTGTTTATCCCTCATGGACTA ATT; reverse primer, CCTCCCATCTCCTTCATCACAT). Quantitative real time PCR was performed using SYBR Green PCR Supermix and the ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA) according to our previously published protocols.24Fold induction levels of mRNA were obtained by analyzing cycle threshold (Ct) levels normalized to HPRT Ct values and then normalized to the values derived from unstimulated splenocyte cultures.
7 Stimulation Index (SI)
onto glass wool fiber filters using an automated cell harvester (FilterMate TM, Packard). Proliferation was quantified by determining the number of counts per minute (cpm) with a liquid scintillation counter (LS8000; Beckman Instruments, Inc., Fullerton, CA). The results were expressed as a stimulation index (SI), which was the cpm from stimulated cells divided by the cpm from unstimulated cells from the same animal.
89
6 5 4 3 2 1 0 0
10
50 100 rgpTNF-α(ng/ml)
200
Fig. 1 Effect of rgpTNF-a on spontaneous splenocyte proliferation. Splenocytes from both unvaccinated (open bars) and BCG-vaccinated (closed bars) guinea pigs were prepared as described in the text and cultured for 96 h in the presence of 10, 50, 100 or 200 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three or four animals per group. Differences based upon vaccination status were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
PPD
Statistical analysis
PPD+TNFα50ng/ml PPD+TNFα100ng/ml
Results Effect of rgp TNF-a on splenocyte proliferation Splenocytes from both unvaccinated and BCG-vaccinated guinea pigs were cultured with various concentrations of rgpTNF-a and the proliferation was measured by incorporation of [3H]thymidine after 96 h. Fig. 1 show that rgpTNF-a alone was capable of inducing proliferation in splenocytes from BCG-vaccinated guinea pigs to a significantly greater extent that splenocytes from unvaccinated guinea pigs in all concentrations of rgpTNF-a used in this study. Doses above 50 ng/ml appeared to stimulate about the same level of proliferation.
Effect of rgp TNF-a on antigen-specific splenocyte proliferation Cultures of splenocytes from BCG-vaccinated guinea pigs were stimulated with PPD (1, 5 and 12.5 ug/ml) alone or in the presence of 50, 100, and 200 ng/ml of rgpTNF-a and the proliferation was measured as described above. As illu-
PPD+TNFα200ng/ml 25 Stimulation Index (SI)
Analysis of variance (ANOVA) was used to examine main treatment effects. Differences between in vitro stimulated cultures were tested for statistical significance at the 95% confidence interval by Duncan’s post hoc analysis. The statistical tests were performed with SAS software (release 8.01; SAS Institute, Inc., Cary, NC).
20 15 10 5 0 0
5
1
12.5
PPD(ug/ml)
Fig. 2 Effect of rgpTNF-a on PPD-induced splenocyte proliferation. Splenocytes from BCG-vaccinated guinea pigs were cultured for 96 h with PPD (1, 5, 12.5 ug/ml) alone or in the presence of 50, 100, 200 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three animals. Differences between PPD doses and between rgpTNF-a-treated and untreated cultures were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
strated in Fig. 2, splenocyte proliferation was increased in a PPD dose-dependent manner. The addition of rgpTNF-a resulted in a significant (po0.05) enhancement of PPD-
ARTICLE IN PRESS 90
H. Cho, D.N. McMurray IL-12p40
ConA ConA+TNFα50ng/ml
Fold Induction
4
150 100 50
3 2 1 0 6
0 0
0.5 1 ConA(ug/ml)
5
Fig. 3 Effect of rgpTNF-a on ConA-induced splenocyte proliferation. Splenocytes from BCG-vaccinated guinea pigs were cultured for 96 h with ConA (0.5, 1, 5 ug/ml) alone or in the presence of 50 ng/ml of rgpTNF-a. Proliferative responses are expressed as a stimulation index (SI), which is cpm of stimulated cells divided by cpm of unstimulated cells. Results are displayed as the mean7SEM of three animals. Differences between different doses of ConA, and between rgpTNF-a-treated and untreated cultures were tested for statistical significance by ANOVA followed by Duncan’s post hoc analysis [po0.05(*)].
(A)
Effect of rgpTNF-a on cytokine mRNA expression in splenocytes from both unvaccinated and BCGvaccinated guinea pigs Splenocytes from both unvaccinated and BCG-vaccinated guinea pigs were stimulated with 50 ng/ml of rgpTNF-a. The expression of IL-12 p40 and IFN-g mRNA was examined by real-time quantitative RT-PCR at 6, 12, and 18 h after stimulation, and the results are shown in Fig. 4. The levels of IL-12 p40 mRNA (Fig. 4A) in splenocytes from BCG-vaccinated guinea pigs increased with time in culture and were significantly (po0.05) higher than those from unvaccinated guinea pigs at all intervals. IFN-g mRNA expression (Fig. 4B) increased dramatically (po0.05) at 18 h in rgpTNF-a-treated splenocytes from BCGvaccinated guinea pigs, while the levels remained at
18
8 6 4 2 0 6 (B)
induced proliferation at the highest dose (12.5 ug/ml) of PPD used. However, at the two lower doses of PPD, the promoting effect of rgpTNF-a on proliferation was not statistically significant. To determine whether rgpTNF-a alters mitogen-induced splenocyte proliferation, splenocytes from vaccinated guinea pigs were stimulated with ConA (0.5, 1 and 5 ug/ml) alone or in the presence of rgpTNF-a (50 ng/ml). As shown in Fig. 3, ConA-induced proliferation was clearly dose-dependent, with the SI at 5 ug/ml being statistically (po0.05) greater than the SI at 0.5 and 1.0 ug/ml. However, the addition of a dose of rgpTNF-a which resulted in significantly enhanced PPDinduced proliferation, did not affect ConA-stimulated proliferation.
12 time(hours) IFN-γ
Fold Induction
Stimulation Index (SI)
200
12 time(hours)
18
Fig. 4 Expression of IL-12 p40 and IFN-g mRNA in guinea pig splenocytes stimulated by rgpTNF-a alone. Levels of IL-12 p40 (A) and IFN-g (B) mRNA were quantified in guinea pig splenocyte cultures from both unvaccinated (hatched bars) and BCGvaccinated (closed bars) guinea pigs at 6, 12 and 18 h after stimulation with 50 ng/ml of rgpTNF-a. Fold induction was determined from the threshold cycle values normalized for HPRT expression and then normalized to the values derived from unstimulated splenocyte cultures (open bars). Results are displayed as the mean7SEM of three animals per group. Asterisks denote a statistically significant (po0.05) effect of vaccination on fold induction.
baseline at all intervals in the cells from unvaccinated guinea pigs.
Effect of rgpTNF-a on cytokine mRNA expression in PPD-stimulated splenocytes from BCG-vaccinated guinea pigs Splenocytes from vaccinated guinea pigs were stimulated with 12.5 ug/ml of PPD alone or with rgpTNF-a (50 ng/ml) for 6, 12, and 18 h. Total RNA from splenocytes was collected, and real-time PCR was performed to detect IFN-g and IL12p40 mRNA levels. Fig. 5 demonstrates that levels of IL-12 p40 mRNA (Fig. 5A) peaked at 12 h, and there was no significant difference between rgpTNF-a-treated and untreated cultures. However, IFN-g mRNA (Fig. 5B) levels increased steadily over the 18 h culture period, and were enhanced significantly by the addition of 50 ng/ml of rgpTNF-a at both 12 and 18 h (po0.05).
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes IL-12p40 control PPD
Fold Induction
30
PPD+TNF-α 50ng/ml
20 10 0 6
(A)
12 time(hours)
18
IFN-γ control
Fold Induction
2000
PPD PPD+TNF-α 50ng/ml
1500 1000 500 0 6
(B)
12 time(hours)
18
Fig. 5 Expression of PPD-induced IL-12 p40 and IFN-g mRNA levels in guinea pig splenocytes treated with rgpTNF-a. Levels of IL-12 p40 (A) and IFN-g (B) mRNA were quantified in guinea pig splenocyte cultures from BCG-vaccinated guinea pigs at 6, 12 and 18 h after stimulation with 12.5 ug/ml of PPD alone or in the presence of 50 ng/ml of rgpTNF-a. Fold induction was determined from the threshold cycle values normalized for HPRT expression and then normalized to the values derived from unstimulated splenocyte cultures. Results are displayed as the mean7SEM of three animals per group. Significant differences between rgpTNF-a-treated and untreated cultures are denoted by an asterisk [po0.05(*)].
Discussion TNF-a is known to play a protective role in tuberculosis by its contribution to the successful organization of granulomas and bacterial killing within macrophages.25,26 Also, it has been shown to act synergistically with IFN-g for effective macrophage activation.27 Activated macrophages are not only the primary mediators of host defense against M. tuberculosis, but also are essential for antigen presentation to T cells. M. tuberculosis has evolved mechanisms to interfere with intraphagocytic events, resulting in its survival within unactivated macrophages. Therefore, the outcome of the interaction between host and pathogen is determined by cooperation between infected macrophages and T cells. A number of studies have reported a correlation between TNF-a and T cell activation. TNF-a has been shown to induce T cell proliferation through the expression of IL-2 receptors on T cells, as well as MHC on accessory cells in humans.14
91
Yokota et al. found that recombinant human (rh) TNF-a promoted T cell proliferation directly in the absence of accessory cells.15 In the present study, we report that rgp TNF-a increases both proliferative and functional capabilities of guinea pig T cells. rgp TNF-a alone was shown to induce a significant proliferation in splenocytes which were activated by prior exposure to BCG (Fig. 1). In contrast, rgp TNF-a induced little proliferation in splenocytes from unvaccinated guinea pigs (Fig. 1). This interesting effect of prior vaccination is consistent with an earlier study which demonstrated that rh TNF-a was able to promote T cell proliferation by enhancing the expression of high affinity IL2 receptors on activated T cells, but not on resting T cells.28 In the same study, rh TNF-a was shown to increase the IL-2 dependent IFN-g production. We have also observed that splenocytes stimulated to proliferate by rgp TNF-a also upregulated the mRNA expression of two Th1 cytokines, IL12p40 and IFN-g (Fig. 4). In separate experiments, the effect of rgp TNF-a on antigen-specific proliferation was investigated using PPD. The addition of exogenous rgp TNF-a increased PPD-induced proliferation in splenocytes from BCG-vaccinated guinea pigs (Fig. 2). A much higher concentration of rgpTNF-a was previously shown to suppress PPD-induced lymphoproliferation in splenocytes from BCG-vaccinated guinea pigs, which is inconsistent with the results from the present study.22 It is possible that higher concentration of rgp TNF-a induced apoptosis in PPD-stimulated T cells, resulting in cell death in the previous study. ConA-induced proliferation was not affected by additional TNF-a (Fig. 3), which suggests that enhanced proliferation in splenocytes from BCG-vaccinated guinea pigs by rgp TNF-a is antigen-specific. Interestingly, rh TNF-a has been reported to enhance both antigen- and mitogen-induced proliferation of T cells,15 which suggests that there might be species differences in the stimulation of a T cell response by TNF-a. Alternatively, different effects of TNF-a on proliferative responses between ConA and PPD might be explained by the differential regulation of costimulatory signals provided by the APC.29,30 The enhancement in PPD-induced proliferation by TNF-a was found to be positively related to significant upregulation of IFN-g mRNA levels (Fig. 5). The relationship between the TNF-a and differentiation of T cells toward a Th1 cytokine profile is still under investigation, however, several recent studies have shown them to be linked. Kichian et al. suggested that TNF-a induces IL-12 production by activating macrophages, and that IL-12 promotes the development of a Th1 response in the mouse.16 In humans, Mytar et al. observed that preincubation of APCs with TNF-a enhanced their ability to induce IFN-g production whereas TNF-a synthesis inhibitors decreased it.18 IFN-g has been shown to stimulate TNF-a production in the mouse.31 Therefore, the augmentation of IFN-g production by TNF-a might be a positive feedback circuit between macrophages and T cells to maintain a mutually activated state. Another possible explanation would be the autocrine activation by endogenous TNF-a production from macrophages. However, we cannot conclude whether TNF-a affects either APCs or T lymphocytes or both populations in our splenocyte cultures. It would not be feasible to examine the effect of TNF-a on T lymphocytes alone, since
ARTICLE IN PRESS 92 the most relevant T cell response (i.e. to mycobacterial antigens) would not occur in the absence of APC. Also, it would be difficult to obtain a highly purified T cell population without contaminating APC in the guinea pig (since no columns or magnetic bead kits exist). In addition, we were unable to measure protein levels of either IL-12 or IFN-g because reagents are not yet available, Therefore, we cannot rule out the possibility that some of the IL-12p40 mRNA would contribute to the synthesis of IL-23, which shares the p40 subunit with IL-12.8 In conclusion, our study provides the first evidence that TNF-a plays an important role in antigen-specific T cell activation in the guinea pig. TNF-a appears to contribute, alone and in combination with antigen, to the proliferation of T cells and expression of Type 1 cytokines, IL-12 or IFN-g, in splenocytes from BCG-vaccinated guinea pigs.
Acknowledgements This work was supported by National Institutes of Health Grant RO1 AI 15495 to DNM.
References 1. Boom WH, Canaday DH, Fulton SA, Gehring AJ, Rojas RE, Torres M. Human immunity to M. tuberculosis: T cell subsets and antigen processing. Tuberculosis (Edinburgh) 2003;83:98–106. 2. Unanue ER. Antigen-presenting function of the macrophage. Annu Rev Immunol 1984;2:395–428. 3. Boom WH, Wallis RS, Chervenak KA. Human Mycobacterium tuberculosis-reactive CD4+ T-cell clones: heterogeneity in antigen recognition, cytokine production, and cytotoxicity for mononuclear phagocytes. Infect Immun 1991;59:2737–43. 4. Tsukaguchi K, de Lange B, Boom WH. Differential regulation of IFN-gamma, TNF-alpha, and IL-10 production by CD4(+) alphabetaTCR+ T cells and vdelta2(+) gammadelta T cells in response to monocytes infected with Mycobacterium tuberculosisH37Ra. Cell Immunol 1999;194:12–20. 5. Algood HM, Lin PL, Yankura D, Jones A, Chan J, Flynn JL. TNF influences chemokine expression of macrophages in vitro and that of CD11b+ cells in vivo during Mycobacterium tuberculosis infection. J Immunol 2004;172:6846–57. 6. Bean AG, Roach DR, Briscoe H, France MP, Korner H, Sedgwick JD, Britton WJ. Structural deficiencies in granuloma formation in TNF gene-targeted mice underlie the heightened susceptibility to aerosol Mycobacterium tuberculosis infection, which is not compensated for by lymphotoxin. J Immunol 1999;162: 3504–11. 7. Abdi K. IL-12: the role of p40 versus p75. Scand J Immunol 2002;56:1–11. 8. Trinchieri G. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol 2003;3: 133–46. 9. Greinert U, Ernst M, Schlaak M, Entzian P. Interleukin-12 as successful adjuvant in tuberculosis treatment. Eur Respir J 2001;17:1049–51. 10. Nolt D, Flynn JL. Interleukin-12 therapy reduces the number of immune cells and pathology in lungs of mice infected with Mycobacterium tuberculosis. Infect Immun 2004;72: 2976–88. 11. Yamamura M, Uyemura K, Deans RJ, Weinberg K, Rea TH, Bloom BR, Modlin RL. Defining protective responses to pathogens: cytokine profiles in leprosy lesions. Science 1991;254: 277–9.
H. Cho, D.N. McMurray 12. Flynn JL, Chan J, Triebold KJ, Dalton DK, Stewart TA, Bloom BR. An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178: 2249–54. 13. Levin M, Newport M. Understanding the genetic basis of susceptibility to mycobacterial infection. Proc Assoc Am Physicians 1999;111:308–12. 14. Ranges GE, Bombara MP, Aiyer RA, Rice GG, Palladino Jr MA. Tumor necrosis factor-alpha as a proliferative signal for an IL-2dependent T cell line: strict species specificity of action. J Immunol 1989;142:1203–8. 15. Yokota S, Geppert TD, Lipsky PE. Enhancement of antigen- and mitogen-induced human T lymphocyte proliferation by tumor necrosis factor-alpha. J Immunol 1988;140:531–6. 16. Kichian K, Nestel FP, Kim D, Ponka P, Lapp WS. IL-12 p40 messenger RNA expression in target organs during acute graftversus-host disease. Possible involvement of IFN-gamma. J Immunol 1996;157:2851–6. 17. Brown GR, Lee EL, Thiele DL. TNF enhances CD4+ T cell alloproliferation, IFN-gamma responses, and intestinal graftversus-host disease by IL-12-independent mechanisms. J Immunol 2003;170:5082–8. 18. Mytar B, Woloszyn M, Ruggiero I, Pryjma J, Zembala M. Monocyte-mediated regulation of antigen-driven IFN gamma production by T cells. The role of endogenously produced TNF. Immunol Invest 1995;24:897–906. 19. Lasco TM, Yamamoto T, Yoshimura T, Allen SS, Cassone L, McMurray DN. Effect of Mycobacterium bovis BCG vaccination on Mycobacterium-specific cellular proliferation and tumor necrosis factor alpha production from distinct guinea pig leukocyte populations. Infect Immun 2003;71: 7035–42. 20. Cho H, Lasco TM, Allen SS, Yoshimura T, McMurray DN. Recombinant guinea pig tumor necrosis factor alpha stimulates the expression of interleukin-12 and the inhibition of Mycobacterium tuberculosis growth in macrophages. Infect Immun 2005;73:1367–76. 21. White AM, Yoshimura T, Smith AW, Westwick J, Watson ML. Airway inflammation induced by recombinant guinea pig tumor necrosis factor-alpha. Am J Physiol 1997;273:L524–30. 22. Lasco TM, Cassone L, Kamohara H, Yoshimura T, McMurray DN. Evaluating the role of tumor necrosis factor-alpha in experimental pulmonary tuberculosis in the guinea pig. Tuberculosis 2005;85:245–58. 23. Phalen SW, McMurray DN. T-lymphocyte response in a guinea pig model of tuberculous pleuritis. Infect Immun 1993;61: 142–5. 24. Allen SS, McMurray DN. Coordinate cytokine gene expression in vivo following induction of tuberculous pleurisy in guinea pigs. Infect Immun 2003;71:4271–7. 25. Flynn JL, Goldstein MM, Chan J, Triebold KJ, Pfeffer K, Lowenstein CJ, Schreiber R, Mak TW, Bloom BR. Tumor necrosis factor-alpha is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 1995;2:561–72. 26. Kindler V, Sappino AP, Grau GE, Piguet PF, Vassalli P. The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 1989;56:731–40. 27. Liew FY, Li Y, Millott S. Tumor necrosis factor-alpha synergizes with IFN-gamma in mediating killing of Leishmania major through the induction of nitric oxide. J Immunol 1990;145: 4306–10. 28. Scheurich P, Thoma B, Ucer U, Pfizenmaier K. Immunoregulatory activity of recombinant human tumor necrosis factor (TNF)alpha: induction of TNF receptors on human T cells and TNFalpha-mediated enhancement of T cell responses. J Immunol 1987;138:1786–90.
ARTICLE IN PRESS TNF-a stimulates lymphocyte activation in guinea pig splenocytes 29. Perrin PJ, Davis TA, Smoot DS, Abe R, June CH, Lee KP. Mitogenic stimulation of T cells reveals differing contributions for B7-1 (CD80) and B7-2 (CD86) costimulation. Immunology 1997;90:534–42. 30. Shortt J, Hart DN, Watson JD, Baird MA. Blockade of B7-2, not B7-1, inhibits purified protein derivative-primed T-lymphocyte
93
responses but fails to influence the proportion of Th1 versus Th2 subsets. Scand J Immunol 1998;47:355–62. 31. Schook LB, Albrecht H, Gallay P, Jongeneel CV. Cytokine regulation of TNF-alpha mRNA and protein production by unprimed macrophages from C57Bl/6 and NZW mice. J Leukoc Biol 1994;56:514–20.