Recombinant human elafin promotes alveologenesis in newborn mice exposed to chronic hyperoxia

Accepted Manuscript Title: Recombinant Human Elafin Promotes Alveologenesis in Newborn Mice Exposed to Chronic Hyperoxia Authors: Wenli Han, Xiaomei Li, Han Zhang, Benli Yu, Chunbao Guo, Chun Deng PII: DOI: Reference:

S1357-2725(17)30191-7 http://dx.doi.org/doi:10.1016/j.biocel.2017.08.004 BC 5193

To appear in:

The International Journal of Biochemistry & Cell Biology

Received date: Revised date: Accepted date:

15-3-2017 3-8-2017 7-8-2017

Please cite this article as: Han, Wenli., Li, Xiaomei., Zhang, Han., Yu, Benli., Guo, Chunbao., & Deng, Chun., Recombinant Human Elafin Promotes Alveologenesis in Newborn Mice Exposed to Chronic Hyperoxia.International Journal of Biochemistry and Cell Biology http://dx.doi.org/10.1016/j.biocel.2017.08.004 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Recombinant Human Elafin Promotes Alveologenesis in Newborn Mice Exposed to Chronic Hyperoxia Wenli Han a,e, Xiaomei Lib,e, Han Zhang b,e, Benli Yub,e, Chunbao Guob,d,e, Chun Dengb,e a

Laboratory animal center, Chongqing Medical University, Chongqing, China

b

Department of Neonatology, Children’s Hospital of Chongqing Medical University,

Chongqing, China; cDepartment of Pharmacology, Chongqing Medical University, Chongqing, China; dDepartment of Hepatology and Liver Transplantation Center, Children’s Hospital, Chongqing Medical University, Chongqing, China; eMinistry of Education Key Laboratory of Child Development and Disorders, Children’s Hospital of Chongqing Medical University, Chongqing, China. *To whom correspondence should be addressed: Chun Deng, M.D., Ph.D., Department of Neonatology, Children’s Hospital of Chongqing Medical University, E-mail: [email protected] and Chunbao Guo, M.D., Ph.D., Department of Hepatology and Liver Transplantation Center, Chongqing Medical University, 136 Zhongshan 2nd Rd. Chongqing, 400014, P.R. China. Tel.: +86-23-63870729; Fax: +86-23-63624479; E-mail: [email protected] or [email protected] Running Title: Elafin in alveolar elastogenesis Abstract Background/Aims: Elastase inhibitors reverse elastin degradation and abnormal alveologenesis and attenuate the lung structural abnormalities induced by mechanical ventilation with O2-rich gas. The potential of these molecules to improve endothelial function and to ameliorate severe bronchopulmonary dysplasia (BPD) during lung development is not yet understood. We sought to determine whether the intratracheal treatment of newborn mice with the elastase inhibitor elafin would prevent hyperoxiainduced lung elastin degradation and the cascade of events that cause abnormal alveologenesis. Methods: Newborn mice were exposed to 85% O2 for 3, 7, 14 or 21 days. Recombinant human elafin was administered administered by intratracheal instillation from the first 1

day every two days for 20 days. We next used morphometric analyses, quantitative RTPCR, immunostaining, Western blotting, and ELISA methods to assess the key variables involved in elastogenesis disruption and the potential signaling pathways noted below in recombinant human elafin-treated mouse pups that had been exposed to 85% O2. Results: We found that impaired alveolar development and aberrant elastin production were associated with elevations in whole lung elastase levels in 85% O2-exposed lungs. Elafin attenuated the structural disintegration that developed in the hyperoxia-damaged lungs. Furthermore, elafin prevented the elastin degradation, neutrophil influx, activation of TGF-β1 and apoptosis caused by 85% O2 exposure. Conclusions: Pulmonary elastase plays an important role in disrupting elastogenesis during O2-induced damage, which is the result of a pulmonary inflammatory response. Elafin prevents these changes by inhibiting elastase and the TGF-β1 signalling cascade and may be a new therapeutic target for preventing O2-induced lung injury in neonates. abbreviations: Air, room air; O2, 85% O2; Air+C, room air with volume-matched vehicle control; O2+C, 85% O2 with volume-matched vehicle control; Air+elafin, room air with the recombinant human elafin; O2+elafin, 85% O2 with the recombinant human elafin. Values represent means ± SD (n = 5). Statistical analysis: # P < 0.01 versus the corresponding Air control; * p < 0.05, versus the corresponding O2 +C control.

Keywords: Bronchopulmonary dysplasia; alveologenesis; Elafin; Elastin; Transforming growth factor-β1 1.

Introduction Bronchopulmonary dysplasia (BPD) usually develops as a result of

hyperoxia toxicity, particularly in premature neonates whose lungs are incompletely developed [1, 2]. Essentially, patients with BPD exhibit alveolar and lung microvessel disruption that is characterized by disordered elastin expression [2], a lack of alveolar septation and widespread interstitial fibrosis in the terminal stage of lung development [3]. The failed formation and remodeling of matrix structures that result from an excessive inflammatory response may affect the development of the 2

immature lung, thereby contributing to this disorder [4, 5]. Although examination of the lung tissues of lambs with chronic lung disease demonstrated differential expression of the matrix proteins that regulate elastin synthesis and assembly [6], in the specific pathophysiological condition of BPD, the mechanisms by which inflammation modifies the normal elastogenesis process during lung development andcontributes to failed alveolar formation need deep investigation . Previous research has indicated that increased pulmonary elastase activity causes lung elastin degradation and remodeling of the extracellular matrix (ECM) [6, 7]. Elastin gene-deficient mice die soon after birth, due to the developmental defects involved in loss of alveolar septation and airway branching [8.9]. We previously found that abnormal elastogenesis was associated with activation of transforming growth factor (TGF)-beta, which resulted in the failure of the alveoli and pulmonary capillaries to form and the scattered deposition of lung elastin [2, 10, 11]. These findings led us to hypothesize that elastase might play a key role in the progression of BPD by promoting the persistence of inflammation and the abnormal elastogenesis that follows. Elastase might account for the excessive inflammatory response that eventually contributes to the development of BPD. Synthetic elastase inhibitors such as elafin have been shown to prevent elastin degradation, TGF-beta activation, and matrix elastin dispersion that are induced by mechanical ventilation with O2-rich gas (MV-O2) [7]. The clinical use of the elastase inhibitor elafin prevented experimentally induced pulmonary hypertension [12] and other cardiovascular pathologies [13, 14]. In the current manuscript, we have extended the investigation of the molecular mechanism

of

Elafin

to

another

chronic

hyperoxia

toxicity

condition,

bronchopulmonary dysplasia (BPD), which represents a more chronic condition with a different pathogenesis from that described in the previous report. Identifying the exact role of elastase in these dysregulated pathways will contribute to a comprehensive understanding of the pathogenesis of BPD and provide novel targets for disease therapy. We previously subjected newborn rodents to chronic 85% O2 exposure, which disrupted pulmonary development in a manner similar to that observed in infants with BPD [6, 10, 11]. Using this model, we tested the hypothesis that the administration of 3

recombinant human elafin would inhibit lung elastase activity and thereby prevent the adverse effects of chronic 85% O2 exposure on matrix elastin and lung development. This study indicated that whole lung elastase activity is elevated in hyperoxia-injured lungs, which exhibited impaired alveolar development and aberrant elastin production. Elafin improved survival and alveolar elastogenesis in chronic hyperoxiadamaged neonatal mice possibly by suppressing TGF-β1 signaling.

2.

Materials and Methods

2.1. Animal experimental design and interventions All experiments were performed according to protocols approved by the institutional review board and the animal care and use committee of Chongqing Medical University. Full-term 1-day-old C57BL/6 mice weighing 1.32±0.10 g were purchased from the experimental animal center of Chongqing Medical University. Within 24 hours of delivery, the full-term littermates were randomly divided into paired chambers (containing either air or 85% O 2) for scheduled exposure periods (lasting through postnatal days (P) 3, 7, 14 or 21) as previously described. The nursing dams were rotated daily between the O2 and the air control group to avoid maternal oxygen toxicity. In the recombinant human elafin administration study, 1-day-old pups, exposed to either air or 85% O2, were pooled and randomly assigned to receive intratracheal instillations of recombinant human elafin (Proteo Biotech AG, Kiel, Germany) for a total of 40 ng/g body weight (bw) in 10 µl/g bw of lactated Ringer’s solution (L/R) or volume-matched vehicle control, which was administered every two days for 20 days. To obtain lungs for histopathology on postnatal days (P) 3, 7, and 21, selected animals from each experimental group were euthanized using CO2. The heart and lungs were excised en bloc, and the lungs were inflated through tracheotomies to 20 cm H2O pressure with 4% (mass/vol) paraformaldehyde in phosphate-buffered saline (PBS). The right lobe was fixed for hematoxylin and eosin (H&E) staining to observe the morphological structure of the lung tissue. The left lobes of selected animals were frozen in liquid nitrogen for quantitative real-time PCR (qPCR) and Western blotting 4

[1]. The total lung volumes were measured based on the cavalieri principle [15]. All of the fixed tissue samples were embedded in plastic with osmium tetroxide/uranyl acetate treatment and sectioned at 4 µm for histochemical analysis according to previously described methods [15]. To assess the amount and localization of elastin deposition in the lung tissue, the sections were stained using Gomori’s aldehydefuchsin method, as described previously [1]. 2.2. Histological morphometric analyses According to the previously described methods, hematoxylin-eosin stained sections from the right middle lobes of 10 mice in each group were examined to evaluate the mean linear intercepts, alveolar surface area per unit of lung volume, radial alveolar counts and elastic fiber density (as an index of parenchymal elastin content) [6]. The fixed lungs were serially sliced in the coronal plane at constant thickness intervals. The slices and tissue blocks were selected systematically following the Systematic uniform random sampling (SURS) method as reported previously [16]. Briefly, the treatment category was masked on the coded images. The tissue blocks and slices were marked with a lattice grid, and every fifth grid square in every fifth row was selected beginning with a random start. Images were captured randomly from 10 non-overlapping fields from each slide. This prevented any sampling bias. Forty histologic fields (×40 magnification) were then evaluated from three slides per animal and five animals per group. The mean linear intercept (MLI) was determined by overlaying the image with a predetermined grid that consisted of randomly placed lines totaling 1 mm in actual length at 20X. The actual MLI was calculated as the inverse of the number of air-tissue interfaces per mm x 1000, yielding the average distance from one air-tissue interface to the next in units of microns. We counted the number of distal air spaces that were transected by a line drawn from the center of a respiratory bronchiole to the nearest interlobular septum, to which an intercept line was drawn perpendicularly. The sections were selectively stained using Gomori’s aldehyde-fuchsin method to assess the amount and localization of elastin and analyzed using ImageJ as described previously [6]. The images stained for elastin were used to enhance the recognition of 5

secondary crests. The secondary crest volume density was measured using a 130-point contiguous counting grid superimposed on each (×200) image. The numbers of points that fell on the tissue and on the secondary crests are expressed as secondary crest/tissue ratios. The elastic fiber accumulation was assessed using automated video thresholding of stain color (Hart’s elastin stain) using the Bioquant True Color Windows Image Analysis system (R & M Biometrics, Nashville, TN) with separate color thresholds for elastic fibers (stained purple) and parenchyma (counterstained yellow) as previously described [6]. The calibrated pixel area for the elastic fibers was divided by the calibrated pixel area for the parenchyma (the reference space) to calculate the percent area occupied by elastic fibers. The severity of the edema and neutrophil infiltration were scored using the following criteria: 0 for no or very minor, 1 for modest, 2 for intermediate, 3 for widespread, and 4 for most prominent. H&E- and elastin-stained images were randomly acquired in a blinded manner from 12 nonoverlapping fields per slide, with three slides per animal and five animals per group. 2.3. Immunohistochemistry The immunohistochemical staining and analyses were performed according to our published protocols [10]. Briefly, serial 4-µm-thick formalin-fixed, paraffin-embedded sections were rehydrated by successive incubations in 100%, 90%, and 70% ethanol. Deparaffinized sections were pretreated for antigen retrieval using the citrate buffer protocol. The slides were incubated for 2 h at room temperature with the primary antibodies, including rat anti-Ly-6G (1:200; eBioscience, San Diego, CA) and anti-TGFβ1 (sc-146, Santa Cruz Biotechnology, Santa Cruz, CA). Immune complexes were detected with the appropriate peroxidase-coupled secondary antibody, and the HRP activity was visualized using the Liquid DAB Plus Substrate Kit (Life Technologies, Carlsbad, CA). The slides were counterstained with 10% hematoxylin, dehydrated, and mounted. Microscopy was performed with a Nikon 55I microscope equipped with a DS-Filc camera and NIS-Elements F software. Five equal-sized fields were randomly chosen and analyzed. 2.4. Myeloperoxidase (MPO) activity assay 6

Myeloperoxidase (MPO) activity in the homogenized snap-frozen lung tissues was measured using bromide-dependent chemiluminescence with luminol (Sigma) according to a previously described protocol [10]. Briefly, 10 µl of the sample was combined with 30 µl of 33.3 mM H2O2 and 40 µl of 25 µM luminol, both in 0.1 M sodium acetate buffer (pH = 5.0). Chemiluminescence was then measured for 3 minutes, after which 20 µl of 20 mM potassium bromide (Br, Sigma) was added to each well, and the chemiluminescence was measured for 3 minutes. MPO activity was measured by subtraction of Br-dependent signal from the first 3 minutes of readout. The data were expressed as U/g lung tissue. 2.5. Quantitative real-time PCR Quantitative real-time PCR were performed in the core lab of Children’s Hospital of Chongqing Medical University. Total cell RNA was isolated from freshly dissected lung tissues using TRIzol® (Invitrogen, Carlsbad, CA). The RNA quality (stability and integrity) and the RNA concentration were verified by on-chip-electrophoresis using the BioAnalyzer (Agilent, Santa Clara, CA). The RNA quantity for each gene was normalized relative to the internal control (β-actin). One microgram of total RNA was reverse transcribed using a TaqMan Reverse Transcription Reagents Kit (Applied Biosystems) and amplified on a 7300 Real-Time PCR System (Applied Biosystems) with gene–specific TaqMan primers (Applied Biosystems). Quantitative real-time PCR was used to measure the expression of lysyl oxidase, fibrillin-1, fibulin-5, interleukin (IL)1β, β6 integrin, and TGF-β1 mRNA with proprietary primers and probes (TaqMan Gene Expression Assays; Applied Biosystems, Foster City, CA) as previously reported [6]. βactin was used as an internal control to normalize the gene expression. In separate experiments, we found that β-actin mRNA did not change significantly in various fetal and newborn lungs. Negative controls were performed using reactions without template and/or enzyme. The sequences of the primers (Life Technologies Corporation, Carlsbad, CA) are shown in Table 1. All standards and samples were tested in triplicate wells, and the data were analyzed using SDS software version 2.3. 2.6. TGF-β1 ELISA of lung homogenate 7

After 14 or 21 days of oxygen exposure, the lung tissue samples (30-50 mg) were homogenized with a protease inhibitor (Roche) using a previously described method [11]. The protein concentrations in the supernatants were determined using a Pierce BCA kit (Thermo Scientific, Rockford, IL). Equivalent amounts of protein (60 μg) were analyzed for active TGF-β1 levels using a commercially available Mouse/Rat/Porcine TGF-beta 1 Quantikine ELISA Kit (MB100B, R&D Systems, Minneapolis, MN). All samples were analyzed in duplicate as a single batch and run with control standards. TGF-β1 levels were determined without any knowledge of the survival or other clinical data. 2.7. Measurement of neutrophil elastase (NE) levels We applied a previously described method [3] that uses the EnzChek elastase assay kit (Invitrogen) as described by the supplier to measure serine neutrophil elastase activity. Briefly, the snap-frozen lung tissues were minced, lysed and centrifuged at 3300 × g for 30 minutes at 4°C to collect the pellet, which was concentrated to 1 mg/ml total protein concentration, as the source of elastase. The level of free NE was determined using the fluorogenic substrate bovine DQ elastin in the absence or presence of the synthetic serine protease inhibitor Pefabloc SC (Sigma). To measure the serine elastase activity, the samples were treated with elafin at a final concentration of 2 μg/mL before incubation with DQ elastin, and the difference in fluorescence when compared to the non-elafin–treated samples was recorded as (elafin-inhibitable) serine elastase activity. 2.8. Urinary Desmosine The 24-hour urine specimens collected from the experimental animals were either assayed immediately or stored frozen at -20°C until they were assayed. The urine creatinine was determined with a colorimetric kit from Sigma (Sigma Chemical, St. Louis, MO). The urine desmosine was measured using a commercially available Mouse Desmosine ELISA Kit from Cusabio Co., Ltd. (#CSB-E14196m, CUSABIO, Wuhan, China) as described previously [17]. Briefly, 100 µl of undiluted urine was combined with 100 µl of biotin-conjugated antibody (1X) in each well, and the mixture was incubated for 1 hour at 37°C. The HRP-avidin (1X) was then added and incubated for 8

1 h. The optical density of samples was measured using a microtiter plate reader (Multiscan RC Circulating Fibrocytes in BPD Type 351; Labsystems, Helsinki, Finland) at 450 nm. All of the analyses and calibrations were carried out at least in duplicate. The mean values were used for the statistical analyses. 2.9. Western blot The snap-frozen tissues were minced and lysed using a protein extraction buffer and homogenized in 250 µl of lysis buffer, as previously described [18]. The protein concentrations in the supernatants were determined using the Pierce BCA kit (Thermo Scientific,

Rockford,

IL).

Subcellular

fractions

(nuclear,

cytosolic

and

mitochondrial/membrane fractions) were harvested using the subcellular proteome extraction kit (Qiagen, Toronto, ON, Canada). Samples (30 μg protein for each condition) from the whole-cell pellets or subcellular fractions were transferred onto PVDF membranes and then incubated with antibodies to tropoelastin (1:600, ab21600, Abcam, Cambridge, MA), cytochrome c (H-104, sc-7159, Santa Cruz), lysyl oxidase (F-8, sc-373995, Santa Cruz), fibrillin-1(C-19, sc-7540, Santa Cruz), pSmad3 (9520, Cell Signaling), Smad2/3 (#3102, Cell Signaling Technology, Boston, MA) following the procedures previously described. The immunoreactive bands were revealed using a 1:5,000 dilution of secondary antibody conjugated to horseradish peroxidase (goat antirabbit IgG; sc-2301, Santa Cruz, CA). The blots were reprobed with antibodies against β-actin (Sigma) to ensure equal loading and transfer of proteins. The relative intensities of the bands were evaluated using the Kodak 1D 3.5.4 software (Kodak Scientific Imaging System, Rockville, MD). All critical blots and immunoprecipitation experiments were repeated at least three times. Selected blots were quantified using ImageJ software. 2.10. TUNEL Assay Cell apoptosis was assessed with the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay using the TUNEL staining assay kit (Roche Diagnostics, Penzberg, Germany) according to the manufacturer's instructions. Briefly, serial sections were deparaffinized and rehydrated as above. The slides were then 9

incubated with a proteinase K working solution (20 μg/mL, 1:500). Endogenous peroxidase was blocked with hydrogen peroxide block (3%) for 15 minutes, and then 50-μL TUNEL reaction mixtures were applied and incubated for 60 minutes at 37°C. After being rinsed with PBS, the slices were incubated with the converter-peroxidase and diaminobenzidine substrates continuously. The sections were counterstained with Gill's hematoxylin, and analyzed under a light microscope. Cells with shrunken brown‐stained nuclei were considered positive. Pictures were numbered and random fields were obtained by random number method generated by computer. The cells were counted and compared to all the visible cells in the fields at a 400× magnification.

3.

Statistical analyses Statistical analyses were conducted using the Prism software package, version 4

(GraphPad, San Diego, CA). One-way analysis of variance multiple comparison tests were used to identify differences in mRNA expression as well as in quantitative histological measurements. The continuous parametric data in the figures are expressed as the mean ± SD. Student’s unpaired t-test was used to determine the significance of differences between two groups. A log-rank (Mantel-Cox) test was used to determine the significance of the Kaplan-Meier survival curves. Differences were considered statistically significant if the P value was < 0.05.

4.

Results

4.1. Effect of elafin on alveologenesis in experimental BPD We initially examined whether elafin could ameliorate the alveolar development defects that resulted from hyperoxic exposure. In the pups that received 21 days of hyperoxia exposure, the lung histology exhibited grossly abnormal alveolar structure, and elafin treatment led to a histological appearance that was almost indistinguishable from that of control pups (Fig. 1A, Table 2). To quantitatively assess the alveolar development, we calculated the secondary crest number/field and the secondary crest/tissue ratio in mice that had been exposed to elafin; secondary crest 10

formation is the initial step in the development of alveoli from saccules. Gomori’s method for staining lung elastin was used to highlight the secondary crest formation. Morphometric analyses of the lung histology showed that the alveolar development was impaired in pups that had been exposed to 85% O2, as indicated by a significant decrease in the secondary crest number/field (Fig. 1B). This damage was ameliorated by elafin: the secondary crest number/field and the secondary crest/tissue ratio were increased by approximately 60%, the alveolar number, as assessed by radial alveolar count (RACs), was increased by 45% (Fig. 1C), and the mean linear intercept (MLI), which is inversely proportional to the alveolar surface area, was decreased by 40% (Fig. 1D), indicating a dramatic increase in alveolar surface area.

4.2. Improvement of somatic growth with elafin administration Because alveologenesis in the injured lung was improved by elafin, we further investigated whether elafin could ameliorate the somatic growth in pups with hyperoxic injury. In the established model of BPD, the overall somatic weights of the pups in the hyperoxia group were approximately 20% less than the somatic weights of the room air groups on day 21[2]. Elafin administration improved the weight loss and appearance of illness in the pups exposed to 85% O2 (Fig. 2A). Overall survival was assessed using the Kaplan-Meier method. The survival curve for the pups in this study is shown in Fig. 2B. The postnatal survival rate was decreased by 85% O2 exposure, whereas elafin administration significantly increased the survival of the mice exposed to 85% O2.

4.3. Elafin attenuates hyperoxia-induced injury by alleviating excessive elastin deposition

We next examined the elastin biogenesis in the lungs of hyperoxia-injured 7-day-old mouse pups after elafin administration. In the developing lung, elastin assembly was disrupted by chronic 85% O2 exposure (Fig. 3A), and importantly, elafin administration 11

improved the alveolar elastin localization in the injured newborn lung. Furthermore, consistent with the elastin assembly data, pronounced immunoreactivity for tropoelastin was observed in the hyperoxia-exposed pups, whereas it was less pronounced for the air-exposed pups (Fig. 3B). Additionally, as expected, elafin administration suppressed the expression of tropoelastin. We next explored the mRNA expression of some key factors involved in elastogenesis. The levels of fibrillin-1 (Fig. 3C) and fibulin-5, which are responsible for elastin synthesis and assembly, were elevated by 2-3-fold in the lungs of the O2-injured pups, and these levels were decreased by elafin administration (Fig. 3D). The lysyl oxidase mRNA levels were significantly elevated in the O2 groups compared to those exposed to air groups for both the 3d and 7d time points. Furthermore, the lysyl oxidase mRNA was significantly decreased at 7d in the elafin-treated group compared to the O2–exposed mice (Fig. 3E). Together, these data indicate that elastin metabolism is dysregulated in the 85% O2-injured developing mouse lung and that this dysregulation is somewhat ameliorated by elafin administration. To determine whether elafin administration could prevent the breakdown of lung elastin, the urinary excretion of desmosine, a surrogate marker of elastin degradation, was determined. The mean value of desmosine-to-creatinine was 1929 pmol desmosine/mg creatinine in mice that had been exposed to 85% O 2 for 7 days, which was higher than the mean urine value of 984 pmol desmosine/mg creatinine for the normal controls. In addition, elafin treatment fully suppressed this increase in the mean levels of urinary desmosine (1136 pmol desmosine/mg creatinine) (Fig. 3F).

4.4. Analysis of neutrophil and macrophage infiltration with elafin administration We next used a spectrophotometric assay to determine the free neutrophil elastase (NE) activity in the lung tissues under the various conditions. As expected, the NE activity was increased in the 85% O2-exposed pups and was significantly reduced in the elafin-treated samples (Fig. 4A). Myeloperoxidase activity, a marker of neutrophil influx, was also suppressed by the elafin administration in the lungs of the pups exposed to 85% O2 at 14 and 21 days (Fig. 4B). 12

We next explored the effect of elafin treatment on the monocyte infiltration in the lungs of newborn mice that were exposed to 85% O2. As shown in Fig. 4C, the neutrophils and macrophages were primarily located in the airways and airspaces of the lungs in the 85% O2-treated newborn mice (Fig. 4C). Exposure to 85% O2 for seven days increased the neutrophil and macrophage infiltration, whereas few inflammatory cells were present in control lungs. Furthermore, the increased neutrophil and macrophage infiltration in lung tissue was attenuated by elafin administration (Fig. 4C), which indicated that inhibition of neutrophil elastase attenuated the macrophage influx. The macrophage influx might account for the aberrant elastin localization. 4.5. Elafin prevents the induction of TGF-β1 activity To further explore whether elafin could influence TGF-β1, IL-1β and αvβ6, which have been implicated in elastogenesis, the levels of the TGF-β1, IL-1β, and αvβ6 integrin transcripts in the lung homogenates of mice to which elafin had been administered were measured by RT-PCR. As shown in Fig. 5A, the increase in TGF-β1 mRNA expression observed in the lungs of the O2-treated pups (P21) relative to control pups was inhibited by elafin. The IL-1β and αvβ6 integrin transcriptional pattern was consistent with the transcriptional regulation of TGF-β1 by elafin administration (Fig. 5B, 5C). TGF-β1 immunostaining was minimal in the distal lung parenchyma of neonatal P21 pups (Fig. 5D). After O2 exposure, the level of TGF-β1 protein increased in the walls of the distal air spaces as well as in the bronchiolar epithelium and vascular endothelial cells, in contrast to its typical localization in the cytoplasm. Consistent with the mRNA expression data, the changes in TGF-β1 abundance and location that were induced by O2 exposure were prevented by elafin administration (Fig. 5D). Furthermore, a sandwich ELISA assay revealed that the overall levels of TGF-β activation in the lung homogenates of mice exposed to 85% O 2 were reduced to normal levels by elafin administration (Fig. 5E). To examine the TGF-β1 signaling cascade, we next investigated the TGF-β1-mediated smad2/3 signaling, which is a marker of TGF-β1 activation in lung fibroblasts. As shown in Figure 6A, exposure to hyperoxia significantly increased Smad3 phosphoryation, which could be suppressed by elafin administration. 13

We next explored the roles of elafin in hyperoxia-associated apoptosis subsequent to the activation of TGF-β1 signaling. The mice that had been exposed to hyperoxia exhibited significantly higher cyto-c release at postnatal day 7 (Figure 6B) compared with the air control. This increase could be measured as early as postnatal day 3 (data not shown). We next inhibited the elastase activity in the hyperoxia-exposed mice by elafin administration. As expected, the induction of cytochrome c release (Fig. 6B) was also potently inhibited by elafin, which was confirmed by quantitative IHC using the TUNEL assay (Fig. 6C). 5.

Discussion In this study, increased NE activity was observed in the developing lungs of the

mouse pups exposed to O2, and this correlated with severely suppressed alveologenesis. Importantly, the serine elastase inhibitor elafin ameliorated the suppressed alveologenesis in the hyperoxia-injured newborn lung via suppression of the inflammatory response, which was associated with aberrant elastin deposition. Elafin also attenuated the influx of neutrophils and monocytes and the increased TGFβ1 and IL-1β activation induced by as little as 3 days of O 2 exposure. These observations suggest that pulmonary elastase activity, which is linked to inflammation, presumably induces elastin degradation and thereby contributes to impaired alveolar formation, offering a potential treatment target for the similar pathological process (BPD) in human neonates. A previous study showed that MV-O2 increased the serine elastase activity in the lungs of 4-day-old mice, which led to increased synthesis of tropoelastin and the dispersion of elastic fibers throughout the walls of distal air spaces [19]. These changes occurred in the absence of apparent inflammation, which prompted the speculation that lung parenchymal cells such as smooth muscle cells or fibroblasts, in which elastase activity can be evoked, may have been the source of the increased elastase activity [20, 21, 22]. Such an inflammatory response has been well documented in our previous research and other reports, such as the study that showed that NE enables the migration of neutrophils from the pulmonary circulation into alveoli [23]. We found an increase in the serine elastase activity in lungs exposed to O2 for as long as 21 days. In the chronic in vivo animal model, these changes were accompanied by 14

increased lung inflammation, as indicated by the increased expression of proinflammatory cytokines and chemokines and the influx of neutrophils and monocytes into the alveoli. Although elastase activity was elevated at all time points analyzed, the urinary desmosine at 21d was not elevated. Currently, we do not have a clear explanation for this observation. Elafin is a serine protease inhibitor that binds to ECM proteins; this binding helps to preserve its antiproteolytic function, thus protecting against injury induced by sustained inflammation [24]. As reported previously, although elafin is not expressed in rodents, exogenous elafin (engineered expression or recombinant elafin) was protective against lung inflammatory injury, which indicated the therapeutic role of elafin in rodents. The anti-inflammatory effects of elafin were observed after the intranasal delivery of LPS [25], although no reports have addressed previously addressed its functional involvement in animal models of BPD. Here, in oxygenexposed pups with developing lungs, the elastase-dependent mechanisms of alveolar formation were investigated using an elastase inhibition strategy. A previous study conducted with mechanically ventilated newborn mice showed that intra-tracheal elafin treatment suppressed the lung elastase activity associated with inflammation and inhibited elastin degradation, thereby preventing dispersion of the lung elastin from the septal tips, decreasing apoptosis and enabling lung growth (7). In the present study, elafin treatment not only blocked the increased lung elastolytic activity and desmosine excretion and ameliorated the pulmonary neutrophil elastase activity that occurred in response to O2 exposure but also diminished the dispersion of elastic fibers and reduced apoptosis to promote alveologenesis in the hyperoxia-injured pups and to improve the elastin organization in the alveoli. Elastin degradation products have been shown to trigger lung inflammation and apoptosis, thereby contributing to air space enlargement [26, 27]. Inflammation can also augment elastolysis and proteolysis. Thus, by inhibiting elastase activity and thereby preserving the elastin at septal tips where future alveoli are known to sprout, elafin seems to have prevented the lung damage that normally results from 85% O2 exposure. qRT-PCR evaluation corroborated the findings of the histochemical analyses, confirming the functional importance of elafin in elastin metabolism. This point is also illustrated by the elafin15

mediated modulation of genes, including fibrillin-1, fibulin-5, and lysyl oxidases, all of which are critical for elastic fiber assembly in oxygen-exposed mice. Moreover, concerning the effect of elastin on the growth of pups, we detected improved growth in the elafin-treated pups exposed to high levels of oxygen, which was consistent with the effect on the disrupted alveolarization in the same mice. The activation of TGF-β1 is the major pathogenic contributor to BPD via its function in the modulation of elastic fiber deposition [28, 29, 30, 31]. Several previous studies indicated that neutrophil elastase could cause the release of TGF-β1, which is involved with dysregulated production of lung elastin and failed alveolar septation in the lung [32, 33, 34, 3]. Recent reports have indicated that in neonatal mice genetically modified to express elafin, this protein might prevent the adverse pulmonary effects of mechanical ventilation with 40% O2 for 24 hours and thus could play an important role in the pathogenesis of BPD [35]. Furthermore, elafin prevented the over expression of pSmad2 protein in this preclinical model of ventilation with 40% O2 [35]. Although the current data do not clearly identify the precise mechanism underlying the suppression of TGF-β1 by elafin, a possible mechanism is that elafin suppressed the increased TGFβ activation evoked by mechanical ventilation and by hyperoxia, and this likely plays a key role in reducing apoptosis. Because O2 exposure increases inflammatory cytokine levels as described above, our data on NE upregulation suggest a biologically plausible association. In this study, it is likely that TGF-β inhibition in response to elafin treatment played a key role in preventing at least some of the adverse pulmonary effects of O2, namely, dysregulated elastin production and apoptosis, both of which can contribute to defective alveolar septation and lung growth. Thus, the suppression of TGF-β activation may account, at least in part, for the beneficial effects of elafin treatment in stabilizing the lung elastin and enabling alveolar septation in newborn mice during O2 exposure. The finding that elafin treatment yielded improved somatic growth and survival (Fig. 2) raises the interesting possibility that elafin also may protect against O2-induced injury to organs other than the lung. Competing financial interests 16

The authors declare that they have no competing interests. Author contributions Wenli Han, Xiaomei Li, Han Zhang and Benli Yu designed and performed the experiments, analyzed the data, and prepared the manuscript. Chun Deng bred the mice. Chun Deng and Chunbao Guo analyzed the data, evaluated the manuscript, and wrote the paper. Acknowledgements We thank Prof. Xianqing Jin for providing technical assistance and insightful discussions during the preparation of the manuscript. We thank Dr. Xiaoyong Zhang of the Wistar Institute (USA), who provided medical writing services. This research was supported by the National Natural Science Foundation of China (No. 81270058, 30770950), the Chongqing Natural Science Foundation (CSTC, 2009BB6072), and the Science and Technology Research Project of Chongqing Education Committee (KJ1500229).

References;1; 1.

Isayama T, Iwami H, McDonald S, Beyene J.;1; Association of Noninvasive Ventilation Strategies With Mortality and Bronchopulmonary Dysplasia Among 2Preterm Infants: A Systematic Review and Meta-analysis. JAMA. 2016;316:61124.

2.

Torchin H, Ancel PY, Goffinet F, Hascoët JM, Truffert P, Tran D, Lebeaux C, Jarreau PH. Placental Complications and Bronchopulmonary Dysplasia:;1; EPIPAGE-2 Cohort Study. Pediatrics. 2016;137:e20152163.

3.

Kim YM, Haghighat L, Spiekerkoetter E, Sawada H, Alvira CM, Wang L, Acharya S, Rodriguez-Colon G, Orton A, Zhao M, Rabinovitch M:;1; Neutrophil elastase is produced by pulmonary artery smooth muscle cells and is linked to neointimal lesions. Am J Pathol. 2011;179:1560-1572.

4.

Yi M, Jankov RP, Belcastro R, Humes D, Copland I, Shek S, Sweezey NB, Post M, Albertine KH, Auten RL, Tanswell AK.:;1; Opposing effects of 60% oxygen and

17

neutrophil influx on alveologenesis in the neonatal rat. Am J Respir Crit Care Med 2004;170:1188-1196. 5.

Witsch TJ, Turowski P, Sakkas E, Niess G, Becker S, Herold S, Mayer K, Vadász I,;1; Roberts JD Jr, Seeger W, Morty RE: Deregulation of the lysyl hydroxylase matrix cross-linking system in experimental and clinical bronchopulmonary dysplasia. Am J Physiol Lung Cell Mol Physiol 2014;306:L246-259.

6.

Han W, Guo C, Liu Q, Yu B, Liu Z, Yang J, Deng C:;1; Aberrant elastin remodeling in the lungs of O₂-exposed newborn mice; primarily results from perturbed interaction between integrins and elastin. Cell Tissue Res. 2015;359:589-603.

7.

Hilgendorff A, Parai K, Ertsey R, Jain N, Navarro EF, Peterson JL, Tamosiuniene R, Nicolls MR, Starcher BC, Rabinovitch M, Bland RD:;1; Inhibiting lung elastase activity enables lung growth in mechanically ventilated newborn mice. Am J Respir Crit Care Med 2011;184:537-546.

8.

Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E, Keating MT:;1; Elastin is an essential determinant of arterial morphogenesis. Nature. 1998;393:276-280.

9.

Wendel DP, Taylor DG, Albertine KH, Keating MT, Li DY:;1; Impaired distal airway development in mice lacking elastin. Am J Respir Cell Mol Biol. 2000; 23:320-326.

10. Yu B, Li X, Wan Q, Han W, Deng C, Guo C:;1; High-Mobility Group Box-1 Protein Disrupts Alveolar Elastogenesis of Hyperoxia-Injured Newborn Lungs. J Interferon Cytokine Res 2016;36:159-168. 11. Wang J, Bao L, Yu B, Liu Z, Han W, Deng C, Guo C:;1; Interleukin-1β Promotes Epithelial-Derived Alveolar Elastogenesis via αvβ6 Integrin-Dependent TGF-β Activation. Cell Physiol Biochem 2015;36:2198-2216. 12. Nickel NP, Spiekerkoetter E, Gu M, Li CG, Li H, Kaschwich M, Diebold I, Hennigs JK, Kim KY, Miyagawa K, Wang L, Cao A, Sa S, Jiang X, Stockstill RW, Nicolls MR, Zamanian RT, Bland RD, Rabinovitch M:;1; Elafin Reverses Pulmonary Hypertension via Caveolin-1-Dependent Bone Morphogenetic Protein Signaling. Am J Respir Crit Care Med 2015;191:1273-1286. 13. Zaidi SH, Hui CC, Cheah AY, You XM, Husain M, Rabinovitch M:;1; Targeted overexpression of elafin protects mice against cardiac dysfunction and mortality following viral myocarditis. J Clin Invest 1999;103:1211-1219. 18

14. Cowan B, Baron O, Crack J, Coulber C, Wilson GJ, Rabinovitch M: Elafin,;1; a serine elastase inhibitor, attenuates post-cardiac transplant coronary arteriopathy and reduces myocardial necrosis in rabbits afer heterotopic cardiac transplantation. J Clin Invest 1996;97:2452-2468. 15. Schneider JP, Ochs M:;1; Alterations of mouse lung tissue dimensions during processing for morphometry: a comparison of methods. Am J Physiol Lung Cell Mol Physiol. 2014; 306: L341-50. 16. Hsia CC, Hyde DM, Ochs M,;1; Weibel ER; ATS/ERS Joint Task Force on Quantitative Assessment of Lung Structure: An official research policy statement of the American Thoracic Society/European Respiratory Society: standards for quantitative assessment of lung structure. Am J Respir Crit Care Med. 2010; 181:394-418. 17. Starcher B, Green M, Scott M:;1; Measurement of urinary desmosine as an indicator of acute pulmonary disease. Respiration. 1995;62:252-257. 18. Gao Z, Shang Q, Liu Z, Deng C, Guo C:;1; Mitochondrial ATF2 translocation contributes to apoptosis induction and BRAF inhibitor resistance in melanoma through the interaction of Bim with VDAC1. Oncotarget. 2015;6:36338-36353. 19. Bland RD, Ertsey R, Mokres LM, Xu L, Jacobson BE, Jiang S, Alvira CM, Rabinovitch M, Shinwell ES, Dixit A:;1; Mechanical ventilation uncouples synthesis and assembly of elastin and increases apoptosis in lungs of newborn mice. Prelude to defective alveolar septation during lung development? Am J Physiol Lung Cell Mol Physiol 2008;294:L3-14. 20. Numanami H, Koyama S, Sato E, Haniuda M, Nelson DK, Hoyt JC, Freels JL, Habib MP, Robbins RA:;1; Serine protease inhibitors modulate chemotactic cytokine production by human lung fibroblasts in vitro. Am J Physiol Lung Cell Mol Physiol 2003;284:L882-890. 21. Bland RD, Xu L, Ertsey R, Rabinovitch M, Albertine KH, Wynn KA, Kumar VH, Ryan RM, Swartz DD, Csiszar K, Fong KS:;1; Dysregulation of pulmonary elastin synthesis and assembly in preterm lambs with chronic lung disease. Am J Physiol Lung Cell Mol Physiol 2007;292:L1370-1384. 22. Hirche TO, Atkinson JJ, Bahr S, Belaaouaj A:;1; Deficiency in neutrophil elastase does not impair neutrophil recruitment to inflamed sites. Am J Respir Cell Mol Biol 19

2004;30:576-584. 23. Kaynar AM, Houghton AM, Lum EH, Pitt BR, Shapiro SD:;1; Neutrophil elastase is needed for neutrophil emigration into lungs in ventilator-induced lung injury. Am J Respir Cell Mol Biol 2008;39:53-60. 24. Guyot N, Zani ML, Maurel MC, Dallet-Choisy S, Moreau T:;1; Elafin and its precursor trappin-2 still inhibit neutrophil serine proteinases when they are covalently bound to extracellular matrix proteins by tissue transglutaminase. Biochemistry 2005;44:15610-15618. 25. Small DM, Zani ML, Quinn DJ, Dallet-Choisy S, Glasgow AM, O'Kane C, McAuley DF, McNally P, Weldon S, Moreau T, Taggart CC:;1; A functional variant of elafin with improved anti-inflammatory activity for pulmonary inflammation. Mol Ther. 2015;23:24-31. 26. Aoshiba K, Yokohori N, Nagai A:;1; Alveolar wall apoptosis causes lung destruction and emphysematous changes. Am J Respir Cell Mol Biol 2003;28:555-562. 27. Aakurai R, Villarreal P, Husain S, Liu J, Sakurai T, Tou E, Torday JS, Rehan VK:;1; Curcumin protects the developing lung against long-term hyperoxic injury. Am J Physiol Lung Cell Mol Physiol 2013;305:L301-311. 28. Ahlfeld SK, Wang J, Gao Y, Snider P, Conway SJ:;1; Initial Suppression of Transforming Growth Factor-β Signaling and Loss of TGFBI Causes Early Alveolar Structural Defects Resulting in Bronchopulmonary Dysplasia. Am J Pathol 2016;186:777-793. 29. DiCamillo SJ, Yang S, Panchenko MV, Toselli PA, Naggar EF, Rich CB, Stone PJ, Nugent MA, Panchenko MP:;1; Neutrophil elastase-initiated EGFR/MEK/ERK signaling counteracts stabilizing effect of autocrine TGF-beta on tropoelastin mRNA in lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 2006;291:L232-243. 30. Ferrari G, Pintucci G, Seghezzi G, Hyman K, Galloway AC, Mignatti P: VEGF,;1; a prosurvival factor, acts in concert with TGF-beta1 to induce endothelial cell apoptosis. Proc Natl Acad Sci U S A 2006;103:17260-17265. 31. Mokres LM, Parai K, Hilgendorff A, Ertsey R, Alvira CM, Rabinovitch M, Bland RD:;1; Prolonged mechanical ventilation with air induces apoptosis and causes failure of alveolar septation and angiogenesis in lungs of newborn mice. Am J Physiol Lung Cell Mol Physiol 2010;298:L23-35. 20

32. Buczek-Thomas JA, Lucey EC, Stone PJ, Chu CL, Rich CB, Carreras I, Goldstein RH, Foster JA, Nugent MA:;1; Elastase mediates the release of growth factors from lung in vivo. Am J Respir Cell Mol Biol 2004;31:344-350. 33. Gauldie J, Galt T, Bonniaud P, Robbins C, Kelly M, Warburton D:;1; Transfer of the active form of transforming growth factor-beta 1 gene to newborn rat lung induces changes consistent with bronchopulmonary dysplasia. Am J Pathol 2003;163:2575-2584. 34. Masood A1, Yi M2, Belcastro R3, Li J3, Lopez L3, Kantores C3, Jankov RP4, Tanswell AK5:;1; Neutrophil elastase-induced elastin degradation mediates macrophage influx and lung injury in 60% O2-exposed neonatal rats. Am J Physiol Lung Cell Mol Physiol 2015;309:L53-62. 35. Hilgendorff A, Parai K, Ertsey R,;1; Juliana Rey-Parra G, Thébaud B, Tamosiuniene R, Jain N, Navarro EF, Starcher BC, Nicolls MR, Rabinovitch M, Bland RD: Neonatal mice genetically modified to express the elastase inhibitor elafin are protected against the adverse effects of mechanical ventilation on lung growth. Am J Physiol Lung Cell Mol Physiol 2012;303:L215-227. Figure legends Fig. 1. Elafin is associated with improved distal airway development in the injured newborn lung. A. Histologic sections of neonatal lung obtained from 21-day-old pups treated as indicated were stained with H&E for morphometric analyses as described previously (n = 6 animals for each group, 12 fields/animal). One representative slide per group is shown. Elafin ameliorated the enlarged distal airspaces (*) observed in the 85% O 2exposed lungs, consistent with enhanced alveologenesis. Scale bar=50 μm. The morphometric analyses revealed that treatment with elafin ameliorated the changes in secondary crest number/field (B), the radial alveolar counts (RAC) (C), and the mean linear intercept (MLI) (D) in lungs chronically exposed to 85% O2 (n = 6 for each group, 12 fields/animal). Columns: average values of a minimum of three independent experiments; bars: ± SD; *p <0.05, #p <0.05, one-way ANOVA. Fig. 2. Elafin contributes to improvements in postnatal growth and survival. A. Time course of body weight for the pups treated as indicated. The data represent 21

10-15 mice per group at each time point. *p < 0.05 compared with the corresponding air-exposed control; #p <0.05 compared with the 85% O2-exposed mice that were treated with elafin (one-way ANOVA). B. Kaplan-Meier curves for overall survival of the pups treated as indicated. The data represent 10-15 mice per group at each time point. Elafin significantly decreased the mortality of the 85% O2-exposed newborn mice (*p<0.01, log rank test). Fig. 3. Elafin is associated with improved alveolar elastin deposition in the injured newborn lung. A. Elastin staining of the peripheral lungs of 7-day-old mouse pups treated as indicated. Treatment with elafin was associated with improved elastin deposition in the tips of alveolar septae (arrow) (n = 6 for each group, 12 fields/animal). One representative slide per group is shown. Scale bar=50 μm. Right panel: Quantitative histogram data of the elastin fiber density, expressed as a percentage of the lung parenchyma, calculated from micrographs by a pathologist blinded to the indicated groups (n = 6 for each group, 12 fields/animal). The data represent the means ± SD. *p <0.05, #p <0.05, one-way ANOVA. B. Western blotting for tropoelastin, fibrillin-1, and lysyl oxidase in the lungs of 7-day-old pups treated as indicated. β-actin was used as loading control. Representative figures of multiple experiments are shown. Lower panel: Quantitative data of the relative intensity for tropoelastin were calculated with respect to the loading control (assigned a value of 1). The data represent the means ± SD. *p <0.05, #p <0.05, one-way ANOVA. Comparison of fibrillin-1 (C), fibulin-5 (D), and lysyl oxidase (E) mRNA levels, which were expressed relative to β-actin mRNA, in 21-day-old pups treated as indicated (n = 6 for each group). Bars: ± SD. At least three independent experiments were performed. *p <0.05, #p <0.05, one-way ANOVA. F. The urinary excretion of desmosine, in 3, 7, and 21-day-old pups treated as indicated (n = 6 for each group). Bars: ± SD. At least three independent experiments were performed. *p <0.05, #p <0.05, one-way ANOVA.

Fig. 4. Effect of elafin on pulmonary inflammation after exposure to 85% O2 for 21 days 22

A. Measurement of the NE activity in the lungs of pups treated as indicated (n = 6 for each group). B. Measurement of myeloperoxidase (MPO) activity in the lungs of pups treated as indicated (n = 6 for each group). Bars: ± SD. At least three independent experiments were performed. *p <0.05, #p <0.05, one-way ANOVA. C. Histologic sections of neonatal lung obtained from 7-day-old pups treated as indicated were subjected to immunohistochemistry (IHC) to identify neutrophils by staining with rat anti-Ly-6G (arrows) as described previously [6] (Scale bar=50 μm) (n = 6 for each group, 12 fields/animal). One representative slide per group is shown. The pups that were exposed to 85% O2 and treated with elafin had no gross parenchymal thickening, consistent with the ameliorated inflammation. Right panel: The quantitative histogram data of Ly-6G positive cells at the microscopic level were determined by a pathologist blinded to the indicated groups (n = 6 for each group, 12 fields/animal). The data represent the means ± SD. *p <0.05, #p <0.05, one-way ANOVA. Fig. 5. Elafin suppresses the induction of TGF-β1, IL-1β and αvβ6 after hyperoxia Comparison of the TGF-β1 (A), IL-1β (B) and αvβ6 integrin (C) mRNA expression levels relative to that of the housekeeping gene β-actin, in 3-, 7-, or 21-day-old pup lungs treated as indicated (n = 6 for each group). Columns: average values from a minimum of six independent experiments; bars: ± SD. *p <0.05, #p <0.05, one-way ANOVA. D. Immunohistochemistry was used to detect TGF-β1 in the lungs of 21-day-old pups treated as indicated. Positive staining of the alveolar epithelium and walls of distal air spaces is indicated (arrows). The staining was considerably more prominent in the 85% O2-exposed lungs than in the control lungs. Scale bar =50 μm; (n = 3 for each group, 12 fields/animal). One representative slide per group is shown. Lower panel: Quantitative histogram data of the TGF-β1 positive cells at the microscopic level were determined by a pathologist blinded to the indicated groups (n = 6 for each group, 12 fields/animal). The data represent the means ± SD. *p <0.05, #p <0.05, one-way ANOVA. E. Comparison of active TGF-β1 concentrations in the lungs of 21-day-old pups treated as indicated. The total active TGF-β1 levels in the lung homogenates were measured using ELISA (n = 6 for each group). The values represent the means ± SD. A minimum of three independent experiments were performed. *p <0.01 compared with the corresponding air-exposed control (one-way ANOVA). 23

Fig. 6. Elafin suppresses TGF-β1 activation and the relevant apoptosis A. Western blot analyses for pSmad3 in the total protein extracts from the lungs of 7day-old pups treated as indicated. A representative example from a minimum of three independent experiments is shown. β-actin was used as loading control. Right panel: The quantitative data of the relative intensity for pSmad3 were calculated with respect to the ß-actin protein. B. The lungs of 7-day-old pups treated as indicated were subjected to Western blotting for cytochrome c in the cytosolic and mitochondrial fractions. β-actin and COX-IV were used as loading controls. Representative figures of multiple experiments are shown. Right panel: The quantitative data of the relative intensity for cytosolic cytochrome c were calculated with respect to the ß-actin protein. C. The apoptosis assay was performed using TUNEL immunohistochemistry (IHC) on the lung tissues collected from 7-day-old pups treated as indicated (Scale bar=50 μm) (n = 6 for each group, 12 fields/animal). Representative figures of multiple experiments per group are shown.

24

Figr-1

25

Figr-2

26

Figr-3

27

Figr-4

28

Figr-5

29

Figr-6

30

Table 1 Gene

Forward primer

Reverse primer

Lysyl oxidase

CGCAAAGAGTGAAGAACCA

GTGTCCTCCAGACAGAAGC

Fibrillin-1

CCAACTCGTGTCGGCTGTG

GCTGTATCTCCATTGTCTCCC

Fibrillin-5

GGGCTCATACTTCTGCTCG

GATGGTGAATGGCTGGTCT

β6 integrin

TAGCTTCCAGCCAAGGTGGG

TCTGAGGGACTGGTATGTGTGTCC

Interleukin-1β

TGGTGTGTGACGTTCCCATT

CAGCACGAGGCTTTTTTGTTG

TGF-β1

GATCCTGTCCAAACTAAGGCTC

ACCTCTTTAGCATAGTAGTCCGC

β-actin

CAGCCTTCCTTCTTGGGTAT

GCTCAGTAACAGTCCGCCTA

31

Table 2 Time course of lung injury following exposure to 85% O2 with or without recombinant human elafin treatment 7

14d

21d

Subgroup

Edema

Infiltration

Edema

Infiltration

Edema

Infiltration

Air+C

0.14 ± 0.06

0.14 ± 0.05

0±0

0.1 ± 0.06

0±0

0.16 ± 0.08

O2+C

0.15 ± 0.08

0.2 5± 0.15

0.29± 0.22#

0.41 ± 0.32#

0.26 ± 0.21#

0.45 ± 0.22#

Air+elafin

0.11 ± 0.05

0.1 8± 0.07

0.1 ± 0.05

0.28 ± 0.16

0±0

0.2 6± 0.14

O2+elafin

0.12± 0.07

0.17 ± 0.08

0.1 ± 0.09

0.29 ± 0.24*#

0.18 ± 0.09

0.29 ± 0.17*

Definition of subgroups and parameter

32