- Email: [email protected]
Recombinant Newcastle disease viruses with targets for PCR diagnostics for rinderpest and peste des petits ruminants
Journal of Virological Methods 259 (2018) 50–53
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Recombinant Newcastle disease viruses with targets for PCR diagnostics for rinderpest and peste des petits ruminants
T
⁎
P.A. van Rijna,b, , J. Boonstraa, H.G.P. van Gennipa a b
Department of Virology, Wageningen Bioveterinary Research, PO box 65, 8200 AB, Lelystad, The Netherlands Department of Biochemistry, Centre for Human Metabolomics, North-West University, South Africa
A R T I C LE I N FO
A B S T R A C T
Keywords: Rinderpest virus Peste des petits ruminants virus Newcastle disease virus PCR diagnostics, positive PCR control
Since February 1st 2011, rinderpest (RP) has been officially declared eradicated worldwide. National authorities have been requested to destroy all their RP related materials. Nonetheless, their national reference laboratories performing real time reverse transcription polymerase chain reaction assays (PCR diagnostics) need RP positive control samples, since some countries still prefer to maintain diagnostic capability for RP for several reasons. In the future, a similar situation will arise for peste des petits ruminants (PPR) as the ambition has been expressed to eradicate PPR. Anticipating on this, we intended to perform qualified PCR diagnostics without use of infectious RPV or PPRV. Therefore, Newcastle disease virus (NDV) with small RNA inserts based on RPV or PPRV sequences were generated and used as positive control material. Recombinant NDVs (recNDVs) were differentially detected by previously established PCR diagnostics for RPV or PPRV. Both recNDVs contain a second PCR target showing that additional targets in NDV are feasible and would increase the diagnostic sensitivity by use of two PCR assays. RecNDV with small PCR targets is not classified as RPV or PPRV containing material, and can be used to mimic RPV or PPRV. Using these recNDVs as virus positive material contributes to the ambition of worldwide eradication, while qualified PCR diagnostics for these OIE-listed diseases remains operational.
Rinderpest virus (RPV) and peste des petits ruminants virus (PPRV) form distinct virus species within the genus Morbillivirus (Paramxyoviridae family, order of Mononegavirales). Other virus species within the Morbillivirus genus are measles virus, canine distemper virus, cetacean morbillivirus, phocine distemper virus, and unclassified morbillivirus. RPV and PPRV cause severe disease in large and small ruminants, respectively, and are notifiable diseases according to the World Organization for Animal Health (OIE). Since February 1st, 2011, RP has been declared officially eradicated worldwide, and is the first eradicated disease of livestock following eradication of the human disease smallpox in 1980. In line with the global eradication of RP, international bodies like the Food and Agriculture Organization of the United Nations now promote reduction of the number of institutions holding and working with infectious RPV. For this, countries have been requested to destroy infectious RPV as well as RP associated materials, or to ship these materials to so-named Rinderpest Holding Facilities. Notwithstanding the worldwide eradication of RP, however, qualified diagnostic capability for RP should remain operational for an unknown time period for several reasons. Following the success of RP eradication, the ambition has been
expressed to eradicate PPR in the coming decades. Currently, PPRV is still circulating in many countries and is of risk for PPR-free countries. Well-validated diagnostics, preferably Differentiating Infected from VAccinated individuals (DIVA) diagnostics compatible with PPR DIVA vaccine, will accelerate control and eradication of PPR. This also implies infectious PRRV as positive control in diagnostic assays, such as virus isolation, immunofluorescence assays, serum neutralization assays and real time reverse transcription polymerase chain reaction assays (PCR diagnostics). On the other hand, veterinary laboratories should strengthen their level of biosecurity with regard to hold infectious PPRV in proportion to the level of risk incurred by the country. This is a dilemma for diagnostic laboratories, national reference laboratories, institutions and countries contributing to control of PPR through surveillance and monitoring programs, while they share the ambition to eradicate PPR. Here, a non-PPRV positive control for PCR diagnostics is very welcome. Newcastle disease virus (NDV) is also a member of the Paramyxoviridae family but forms a separate virus species within the Avulavirus genus consisting of virus strains varying from non-virulent (lentogenic) to virulent (velogenic) virus strains. The natural hosts of
Abbreviations: DIVA, differentiating infected from vaccinated individuals; ND, Newcastle disease; OIE, Office International des Epizooties (World Organisation for Animal Health); PCR, polymerase chain reaction; PPR, peste des petits ruminants; RP, rinderpest; SPF, specific pathogen free; TCID, tissue culture infective dose ⁎ Corresponding author at: Department of Virology, Wageningen Bioveterinary Research, PO box 65, 8200 AB, Lelystad, The Netherlands. E-mail addresses: [email protected] (P.A. van Rijn), [email protected] (J. Boonstra), [email protected] (H.G.P. van Gennip). https://doi.org/10.1016/j.jviromet.2018.06.007 Received 7 March 2018; Received in revised form 24 April 2018; Accepted 10 June 2018 Available online 12 June 2018 0166-0934/ © 2018 Elsevier B.V. All rights reserved.
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Fig. 1. Schematic overview of the rescue of recombinant Newcastle disease virus (recNDV). Rescue of recNDV using reverse genetics has been described (Peeters et al., 1999). cDNA encompassing the insert was cloned in the correct orientation in a shuttle plasmid, and subsequently recloned in full length cDNA of lentogenic NDV strain LaSota. Full length cDNA and expression plasmids of L, NP and P were transfected to fowlpox T7 infected QM5 cells. RecNDV was rescued and subsequently passed twice in eggs to prepare virus stocks.
60–80% confluence and infected with fowlpox recombinant virus expressing bacteriophage T7 DNA dependent RNA polymerase (Britton et al., 1996) for 1 h at 37 °C. Subsequently, monolayers were cotransfected with 1.0 μg of pNDFL2 derivative, 1.6 μg of pCIneo-NP, 0.8 μg of pCIneo-P and 0.8 μg of pCIneo-L using Fugene HD according to the instructions (Roche, Mannheim, Germany). Culture supernatant was harvested at 3–4 days post transfection and filtered through a 0.20 μm-pore-size filter. The insert in rescued recNDV was confirmed by conventional sequencing with appropriate sequence primers (not shown). A virus stock was prepared by two passages in eggs. For this, 9–11 days embryonated specific pathogen free (SPF) eggs were inoculated in the allantoic cavities and virus was harvested after 3–5 days. The first egg passage was filtered and 1000 times diluted prior to the second inoculation. Virus stocks were titrated on QM5 cells according to standard procedures. Infection foci were immunostained with anti-F monoclonal antibody 8E12A8C3 (Peeters et al., 1999), and virus titres were calculated (Reed and Muench, 1938). Typically, the first egg passage reached high virus titres of 107−8 TCID50/ml recNDV. RecNDVs were studied on their use as alternative positive controls for PCR diagnostics for RPV and PPRV. Primers and probes of previously developed and validated in-house PCR tests for RPV and PPRV haven been synthesized by Eurogentec and Tib Molbiol, respectively. Primers and probes, including those of PCR tests previously published by others, are listed in Table 1. In-house PCR tests were used to study detection of viral genomic RNA in dilutions of both recNDVs (Fig. 3). Briefly, total nucleic acid was extracted from 200 μl using a MagNA Pure Compact Nucleic Acid Isolation Kit according to manufacturer’s instructions (Roche), and was eluted in 100 μl water. RPV RT-PCR mix: 20 μl total volume: 5 μl isolated RNA, 100 nM of each primer, 200 nM of each probe, 2.25 mM MnO2, 7.5 μl LC master mix (Roche). 20 min 61 °C, 30 s 95 °C, 45 cycli (1 s 95 °C, 10 s 59 °C, 15 s
NDV are avian species and NDV does not cause viremia in ruminants. Further, NDV is completely harmless for humans and has a long history as broad-spectrum oncolytic agent in humans (National Cancer Institute on Newcastle disease virus as a treatment for cancer, 2018). Reverse genetics for NDV has been developed to express foreign genes (Peeters et al., 1999; Zhao and Peeters, 2003), including NDV vectored vaccines for important pathogens of livestock and humans (Carnero et al., 2009; Duan et al., 2015; Kortekaas et al., 2010; Nakaya et al., 2001). Similarly, slightly modified full length cDNA of lentogenic NDV strain LaSota, named pNDFL2 (Kortekaas et al., 2010), and helper plasmids pCIneo-NP, pCIneo-P and pCIneo-L (Peeters et al., 1999) were used to rescue recombinant NDVs (recNDVs) with PCR targets (Fig. 1). Two small cDNAs each with two PCR targets of RPV or PPRV, respectively, and separated by a small randomized spacing sequence were synthesized by Genscript Corporation Piscataway, NJ, USA (Fig. 2). One PCR target was based on in-house PCR tests for RPV or PPRV. The second PCR target was based on the signature primer and probe binding sites relevant to previously published PCR tests for RPV (Carrillo et al., 2010) and PPRV (Batten et al., 2011), respectively. The total foreseen RNA inserts were adjusted to multiples of six nucleotides according to the rule-of-six for packaging of the NDV genome (Peeters et al., 2000), and were 360 or 300 base pairs in length (Fig. 2). LguI cDNA fragments were recloned in the correct orientation in a shuttle plasmid, and the appropriate ApaI-NotI fragments were subsequently cloned in pNDFL2 according to standard cloning procedures (Peeters et al., 1999; Zhao and Peeters, 2003) (Fig. 1). RecNDVs with the small RNA insert between the P gene (phospoprotein) and M gene (matrix protein) of NDV were rescued (Fig. 1). Briefly, Quail fibrosarcoma cells (QM-5) were grown in Ford Dodge QT35 medium (Invitrogen, Carlsbad, CA, USA) containing 5% foetal calf serum (FCS) and 1% Pen Strep (10,000 units/ml, Invitrogen) to
Fig. 2. Overview of RNA inserts in recNDVs. RNA inserts encompasses two PCR targets of RPV or PPRV, respectively. Flanking LguI sites are grey shaded. PCR targets are separated by a randomized spacer sequence. RPV and PPRV specific sequences and nonspecific sequences are presented by capitol and small symbols, respectively. Targets of previously published PCR tests and in-house PCR tests are underlined and double underlined, respectively. 51
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Further, the in-house RPV PCR test is highly specific, since canine distemper virus is the closest matching sequence with four mismatches in each of the primers and probes, and will be not detected. The second target is based on the previously published PCR assay (Carrillo et al., 2010). Twelve sequences with this PCR target were found in Genbank, and all will be detected as these contain a maximum of one mismatch per primer or probe. The closest matching sequence is of measles virus (accession no.: JN635411.1 and KT588921.1) with two mismatches in one probe and one mismatch in the reverse primer. This could lead to false positive PCR results. Many RPV strains have been stored by laboratories worldwide, and will be sequenced by the few remaining RPV Holding Facilities in the near future. Anticipating on genetic variability, two PCR targets were inserted in NDV to reduce the chance on false negative PCR results. The recNDV with RPV PCR targets enables qualified PCR diagnostics for RP without the need to handle infectious RPV. Likely, two RPV PCR tests or actualization of currently qualified PCR tests will be needed to guarantee satisfying results with regard to diagnostic sensitivity and specificity in the future. At Wageningen Bioveterinary Research (WBVR), virulent RPV associated materials and all remaining RBOK vaccine virus associated materials have been destroyed in 2016 andn 2017, respectively, including positive PCR control material. Accordingly, the Dutch national reference institute for animal diseases WBVR does no longer store RPV associated materials. Similarly, recNDV with two targets of PPRV PCR tests was generated and anticipates on unknown PPRV variants. About 135 PPRV sequences with the target of the in-house PPRV PCR test were found in Genbank. PPRV sequences contain 0(n = 88),1(n = 36) or 2(n = 5) mismatches per primer or probe sequence, and will be detected. PPRV strain Ghana/ NK1/2010 has three mismatches in the probe sequence (KJ466104.1 (Dundon et al., 2014)). Indeed, this PPRV strain was not detected by the in-house PCR test but the amplified DNA fragment was detected by gel electrophoresis, and mismatches were confirmed by sequencing (not shown). Three sequences (MF574748.1, MF574749.1, and MF574750. 1) submitted to Genbank in July 2017 have 10, 8 or 7 mismatches in the reverse primer, respectively. Thus, the diagnostic sensitivity of the inhouse PPRV PCR test is of concern as these PPRV variants of recently submitted sequences will be missed. The second target is based on the previously published PCR assay (Batten et al., 2011). About 120 PPRV sequences matching this target were found in Genbank. About 110 PPRV sequences contain 0 or 1 mismatch. Eight sequences have > 3 mismatches per primer or probe, and could lead to false PCR negative results, and thus could reduce the diagnostic sensitivity of this PCR assay. Three of these sequences have been submitted recently in July 2017, and two of these sequences, MF574748.1 and MF574749.1, have several mismatches in this PCR target. Importantly, both PCR tests of which the targets were inserted in recNDV will not detect these recent PPRV variants. Apparently, it might be necessary to actualize recommended PCR diagnostics in order to detect all PPRV variants.
Table 1 List of PCR primers and probes. Sequences are indicated in the 5′- > 3′ order. Fw, Rv, and Pr indicate forward primer, reverse primer, and probe, respectively. PCR tests target the N-gene of PPRV (PPRV_N), the L- (RPV_L10) or Ngene of RPV (RPV_N). ‘WBVR’ indicates the in-house validated PCR tests and ‘Ba’ and ‘Ca’ refer to previously published and well-validated PCR tests (Batten et al., 2011; Carrillo et al., 2010). Primer/probe
Sequence
Fw_RPV_N_WBVR Pr1_RPV_N_WBVR Pr2_RPV_N_WBVR Rv_RPV_N_WBVR
ATGGGTGAACTGGCTCCTTA TCCAGAACAAGTTCAGTGCAGGAG-FL LCred640-CCCCTGTTGTGGAGCTATGCTATG-PH ACCTGAAATATGCAGGGTCA
Fw_RPV_L10_Ca Pr_RPV_L10_Ca Rv_RPV_L10_Ca
RATGAAAGGWCATGCCATATT ATCATCAACGGGTATCG GGTGGCCAGCTCC
Fw_PPRV_N_WBVR Pr_PPRV_N_WBVR Rv_PPRV_N_WBVR
AGTATCCGCCTTGTTGAGGT FAM-AGTCCGGGTTGACCTTTGCA-BHQ TCTATTATTTCTCTGTTCTCAAACC
Fw_PPRV_N_Ba Pr_PPRV_N_Ba Rv_PPRV_N_Ba
AGAGTTCAATATGTTRTTAGCCTCCAT CACCGGAYACKGCAGCTGACTCAGAA TTCCCCARTCACTCTYCTTTGT
72 °C), 30 s 40 °C, 4 °C. PPRV RT-PCR mix: 20 μl total volume: 5 μl isolated RNA, 800 nM primers, 200 nM probe, 2 μl RT mix (Quantifast Probe RT-PCR kit, Qiagen), 10 μl master mix (Quantifast Probe RT-PCR kit, Qiagen). 10 min 50 °C, 5 min 95 °C, 45 cycli (10 s 95 °C, 30 s 60 °C), 10 s 40 °C, 4 °C. PCR results were interpreted negative, doubtful or positive as previously described (van Rijn et al., 2012). In-house PCR tests for RPV or PPRV detected recNDV in dilutions up to 107 corresponding to 1–10 TCID50/ml. Undiluted recNDV with RPV targets was not detected with the PPRV PCR test, and undiluted recNDV with PPRV targets was not detected with the RPV PCR test. Clearly, in-house PCR tests were highly sensitive and specific. Further, as expected, the related paramyxovirus NDV was not detected by both PCR tests. In preparedness on destruction of all RPV associated materials, lentogenic recNDV with two RPV PCR targets was first generated, and tested with in-house validated PCR tests (Fig. 3). Apparently, dilutions of recNDV can replace (infectious) RPV or RPV as positive control for extraction, reverse transcription and amplification. Both PCR targets are highly conserved and specific (in silico sensitivity and specificity). The in-house RPV PCR test has been developed in our laboratory many years ago according to the fluorescence resonance energy transfer (FRET) system as for many PCR tests (van Rijn et al., 2004). About 24 RPV sequences in Genbank encompass this PCR target. RPV strain Fusan cattle type B (accession no.: AB547189.1 (Fukai et al., 2011)) contains three mismatches in one of the probe sequences, and will not be detected according to the in silico sensitivity (false negative).
Fig. 3. Results of in-house PCR diagnostics for dilutions of recNDVs. RecNDVs containing RNA inserts of RPV or PPRV were diluted in culture medium and tested three independent times with the respective qualified in-house PCR test for RPV and PPRV (A, B and C). Note, undiluted recNDV with RPV targets was not detected by the PPRV PCR test, and vice versa.
52
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Boonstra for excellent technical assistance, and Dr William Dundon (APHL Joint FAO/IAEA Division, IAEA Laboratories, Seibersdorf, Austria) and Dr. Angelika Loitsch (Institute for Veterinary Disease Control, Austrian Agency for Health and Food Safety, Moedling, Austria) for PPRV strain Ghana/NK1/2010. This research was financially supported by the Dutch Ministry of Economic Affairs (WBVRproject number 1600013-01).
NonPPRV sequences did not match to the sequences of both incorporated PCR targets. Taken together, both PPRV PCR tests showed a high in silico specificity but improvement of the in silico sensitivity will be required to detect all PPRV variants. Obviously, recNDV with these actualized or additional PCR targets could be generated easily. Using recNDV as alternative positive control material, the Dutch national reference institute for animal diseases WBVR is prepared on the foreseen worldwide eradication of PPR. Historically, large areas of the world are PPR-free, and PPRV PCR diagnostics can now be performed even long before eradication in PPR endemic countries without use of infectious PPRV and without veterinary BSL3 facilities. It is laborious and expensive to collect defined positive field samples from abroad or to perform animal trials for exotic diseases in order to enable proper test validation. Regarding PCR diagnostics, the here developed recNDVs can be used to spike defined negative field samples with small (limited) amounts of recNDV to generate defined positive samples. These spiked samples closely mimic PCR positive field samples, in particular since NDV is also a member of the Paramyxoviridae family. Validation of PCR diagnostics, including nucleic acid extraction, reverse transcription, polymerase chain reaction and real time detection, is in particular important for variable field samples, such as faeces or excreta. For many diseases, the virus collection of national reference laboratories is very limited, like for RPV and PPRV in historically diseasefree countries worldwide. Furthermore, many virus variants have not been stored, like these observed by molecular epidemiology studies. On the other hand, genetic data of variants become massively and rapidly available nowadays. Even more, in vitro propagation of emerging viruses is not always successful. Clearly, the here described method enables validation of PCR diagnostics without expensive and risky shipment of dangerous infectious viruses to laboratories in countries free of disease. The here described recNDVs are available on request. Notably, reverse genetics for NDV is routinely used in many laboratories, and recNDV with other or additional PCR targets can be generated. Possibly, PCR diagnostics should be actualized in order to anticipate on new virus variants escaping from current well-validated PCR diagnostics. RecNDV as alternative positive PCR control should be considered for closely related viruses, like other enveloped, single negative stranded RNA viruses (Mononegavirales, Bunyavirales, Arenavivirdae, and Orthomxyoviridae). Lentogenic recNDVs with small RNA inserts are completely safe and will improve biosafety and biosecurity for zoonotic and OIE-listed virus diseases.
References Batten, C.A., Banyard, A.C., King, D.P., Henstock, M.R., Edwards, L., Sanders, A., Buczkowski, H., Oura, C.C., Barrett, T., 2011. A real time RT-PCR assay for the specific detection of Peste des petits ruminants virus. J. Virol. Methods 171, 401–404. Britton, P., Green, P., Kottier, S., Mawditt, K.L., Penzes, Z., Cavanagh, D., Skinner, M.A., 1996. Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J. Gen. Virol. 77 (Pt 5), 963–967. Carnero, E., Li, W., Borderia, A.V., Moltedo, B., Moran, T., Garcia-Sastre, A., 2009. Optimization of human immunodeficiency virus gag expression by newcastle disease virus vectors for the induction of potent immune responses. J. Virol. 83, 584–597. Carrillo, C., Prarat, M., Vagnozzi, A., Calahan, J.D., Smoliga, G., Nelson, W.M., Rodriguez, L.L., 2010. Specific detection of Rinderpest virus by real-time reverse transcriptionPCR in preclinical and clinical samples from experimentally infected cattle. J. Clin. Microbiol. 48, 4094–4101. Duan, Z., Xu, H., Ji, X., Zhao, J., 2015. Recombinant Newcastle disease virus-vectored vaccines against human and animal infectious diseases. Future Microbiol. 10, 1307–1323. Dundon, W.G., Adombi, C., Waqas, A., Otsyina, H.R., Arthur, C.T., Silber, R., Loitsch, A., Diallo, A., 2014. Full genome sequence of a peste des petits ruminants virus (PPRV) from Ghana. Virus Genes 49, 497–501. Fukai, K., Morioka, K., Sakamoto, K., Yoshida, K., 2011. Characterization of the complete genomic sequence of the rinderpest virus Fusan strain cattle type, which is the most classical isolate in Asia and comparison with its lapinized strain. Virus Genes 43, 249–253. Kortekaas, J., de Boer, S.M., Kant, J., Vloet, R.P., Antonis, A.F., Moormann, R.J., 2010. Rift Valley fever virus immunity provided by a paramyxovirus vaccine vector. Vaccine 28, 4394–4401. Nakaya, T., Cros, J., Park, M.S., Nakaya, Y., Zheng, H., Sagrera, A., Villar, E., GarciaSastre, A., Palese, P., 2001. Recombinant Newcastle disease virus as a vaccine vector. J. Virol. 75, 11868–11873. National Cancer Institute on Newcastle disease virus as a treatment for cancer, o.a. and http://www.nci.nih.gov/cancerinfo/pdq/cam/NDV. Peeters, B.P., de Leeuw, O.S., Koch, G., Gielkens, A.L., 1999. Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. J. Virol. 73, 5001–5009. Peeters, B.P., Gruijthuijsen, Y.K., de Leeuw, O.S., Gielkens, A.L., 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch. Virol. 145, 1829–1845. Reed, L.J., Muench, H., 1938. Asimple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 27, 493–497. van Rijn, P.A., Wellenberg, G.J., Hakze-van der Honing, R., Jacobs, L., Moonen, P.L., Feitsma, H., 2004. Detection of economically important viruses in boar semen by quantitative RealTime PCR technology. J. Virol. Methods 120, 151–160. van Rijn, P.A., Heutink, R.G., Boonstra, J., Kramps, H.A., van Gennip, R.G., 2012. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8. J. Vet. Diagn. Invest. 24, 469–478. Zhao, H., Peeters, B.P., 2003. Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication. J. Gen. Virol. 84, 781–788.
Conflict of interest None. Acknowledgements The authors are grateful to Olav de Leeuw and Christine Leendertse-
53
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Recombinant Newcastle disease viruses with targets for PCR diagnostics for rinderpest and peste des petits ruminants
T
⁎
P.A. van Rijna,b, , J. Boonstraa, H.G.P. van Gennipa a b
Department of Virology, Wageningen Bioveterinary Research, PO box 65, 8200 AB, Lelystad, The Netherlands Department of Biochemistry, Centre for Human Metabolomics, North-West University, South Africa
A R T I C LE I N FO
A B S T R A C T
Keywords: Rinderpest virus Peste des petits ruminants virus Newcastle disease virus PCR diagnostics, positive PCR control
Since February 1st 2011, rinderpest (RP) has been officially declared eradicated worldwide. National authorities have been requested to destroy all their RP related materials. Nonetheless, their national reference laboratories performing real time reverse transcription polymerase chain reaction assays (PCR diagnostics) need RP positive control samples, since some countries still prefer to maintain diagnostic capability for RP for several reasons. In the future, a similar situation will arise for peste des petits ruminants (PPR) as the ambition has been expressed to eradicate PPR. Anticipating on this, we intended to perform qualified PCR diagnostics without use of infectious RPV or PPRV. Therefore, Newcastle disease virus (NDV) with small RNA inserts based on RPV or PPRV sequences were generated and used as positive control material. Recombinant NDVs (recNDVs) were differentially detected by previously established PCR diagnostics for RPV or PPRV. Both recNDVs contain a second PCR target showing that additional targets in NDV are feasible and would increase the diagnostic sensitivity by use of two PCR assays. RecNDV with small PCR targets is not classified as RPV or PPRV containing material, and can be used to mimic RPV or PPRV. Using these recNDVs as virus positive material contributes to the ambition of worldwide eradication, while qualified PCR diagnostics for these OIE-listed diseases remains operational.
Rinderpest virus (RPV) and peste des petits ruminants virus (PPRV) form distinct virus species within the genus Morbillivirus (Paramxyoviridae family, order of Mononegavirales). Other virus species within the Morbillivirus genus are measles virus, canine distemper virus, cetacean morbillivirus, phocine distemper virus, and unclassified morbillivirus. RPV and PPRV cause severe disease in large and small ruminants, respectively, and are notifiable diseases according to the World Organization for Animal Health (OIE). Since February 1st, 2011, RP has been declared officially eradicated worldwide, and is the first eradicated disease of livestock following eradication of the human disease smallpox in 1980. In line with the global eradication of RP, international bodies like the Food and Agriculture Organization of the United Nations now promote reduction of the number of institutions holding and working with infectious RPV. For this, countries have been requested to destroy infectious RPV as well as RP associated materials, or to ship these materials to so-named Rinderpest Holding Facilities. Notwithstanding the worldwide eradication of RP, however, qualified diagnostic capability for RP should remain operational for an unknown time period for several reasons. Following the success of RP eradication, the ambition has been
expressed to eradicate PPR in the coming decades. Currently, PPRV is still circulating in many countries and is of risk for PPR-free countries. Well-validated diagnostics, preferably Differentiating Infected from VAccinated individuals (DIVA) diagnostics compatible with PPR DIVA vaccine, will accelerate control and eradication of PPR. This also implies infectious PRRV as positive control in diagnostic assays, such as virus isolation, immunofluorescence assays, serum neutralization assays and real time reverse transcription polymerase chain reaction assays (PCR diagnostics). On the other hand, veterinary laboratories should strengthen their level of biosecurity with regard to hold infectious PPRV in proportion to the level of risk incurred by the country. This is a dilemma for diagnostic laboratories, national reference laboratories, institutions and countries contributing to control of PPR through surveillance and monitoring programs, while they share the ambition to eradicate PPR. Here, a non-PPRV positive control for PCR diagnostics is very welcome. Newcastle disease virus (NDV) is also a member of the Paramyxoviridae family but forms a separate virus species within the Avulavirus genus consisting of virus strains varying from non-virulent (lentogenic) to virulent (velogenic) virus strains. The natural hosts of
Abbreviations: DIVA, differentiating infected from vaccinated individuals; ND, Newcastle disease; OIE, Office International des Epizooties (World Organisation for Animal Health); PCR, polymerase chain reaction; PPR, peste des petits ruminants; RP, rinderpest; SPF, specific pathogen free; TCID, tissue culture infective dose ⁎ Corresponding author at: Department of Virology, Wageningen Bioveterinary Research, PO box 65, 8200 AB, Lelystad, The Netherlands. E-mail addresses: [email protected] (P.A. van Rijn), [email protected] (J. Boonstra), [email protected] (H.G.P. van Gennip). https://doi.org/10.1016/j.jviromet.2018.06.007 Received 7 March 2018; Received in revised form 24 April 2018; Accepted 10 June 2018 Available online 12 June 2018 0166-0934/ © 2018 Elsevier B.V. All rights reserved.
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Fig. 1. Schematic overview of the rescue of recombinant Newcastle disease virus (recNDV). Rescue of recNDV using reverse genetics has been described (Peeters et al., 1999). cDNA encompassing the insert was cloned in the correct orientation in a shuttle plasmid, and subsequently recloned in full length cDNA of lentogenic NDV strain LaSota. Full length cDNA and expression plasmids of L, NP and P were transfected to fowlpox T7 infected QM5 cells. RecNDV was rescued and subsequently passed twice in eggs to prepare virus stocks.
60–80% confluence and infected with fowlpox recombinant virus expressing bacteriophage T7 DNA dependent RNA polymerase (Britton et al., 1996) for 1 h at 37 °C. Subsequently, monolayers were cotransfected with 1.0 μg of pNDFL2 derivative, 1.6 μg of pCIneo-NP, 0.8 μg of pCIneo-P and 0.8 μg of pCIneo-L using Fugene HD according to the instructions (Roche, Mannheim, Germany). Culture supernatant was harvested at 3–4 days post transfection and filtered through a 0.20 μm-pore-size filter. The insert in rescued recNDV was confirmed by conventional sequencing with appropriate sequence primers (not shown). A virus stock was prepared by two passages in eggs. For this, 9–11 days embryonated specific pathogen free (SPF) eggs were inoculated in the allantoic cavities and virus was harvested after 3–5 days. The first egg passage was filtered and 1000 times diluted prior to the second inoculation. Virus stocks were titrated on QM5 cells according to standard procedures. Infection foci were immunostained with anti-F monoclonal antibody 8E12A8C3 (Peeters et al., 1999), and virus titres were calculated (Reed and Muench, 1938). Typically, the first egg passage reached high virus titres of 107−8 TCID50/ml recNDV. RecNDVs were studied on their use as alternative positive controls for PCR diagnostics for RPV and PPRV. Primers and probes of previously developed and validated in-house PCR tests for RPV and PPRV haven been synthesized by Eurogentec and Tib Molbiol, respectively. Primers and probes, including those of PCR tests previously published by others, are listed in Table 1. In-house PCR tests were used to study detection of viral genomic RNA in dilutions of both recNDVs (Fig. 3). Briefly, total nucleic acid was extracted from 200 μl using a MagNA Pure Compact Nucleic Acid Isolation Kit according to manufacturer’s instructions (Roche), and was eluted in 100 μl water. RPV RT-PCR mix: 20 μl total volume: 5 μl isolated RNA, 100 nM of each primer, 200 nM of each probe, 2.25 mM MnO2, 7.5 μl LC master mix (Roche). 20 min 61 °C, 30 s 95 °C, 45 cycli (1 s 95 °C, 10 s 59 °C, 15 s
NDV are avian species and NDV does not cause viremia in ruminants. Further, NDV is completely harmless for humans and has a long history as broad-spectrum oncolytic agent in humans (National Cancer Institute on Newcastle disease virus as a treatment for cancer, 2018). Reverse genetics for NDV has been developed to express foreign genes (Peeters et al., 1999; Zhao and Peeters, 2003), including NDV vectored vaccines for important pathogens of livestock and humans (Carnero et al., 2009; Duan et al., 2015; Kortekaas et al., 2010; Nakaya et al., 2001). Similarly, slightly modified full length cDNA of lentogenic NDV strain LaSota, named pNDFL2 (Kortekaas et al., 2010), and helper plasmids pCIneo-NP, pCIneo-P and pCIneo-L (Peeters et al., 1999) were used to rescue recombinant NDVs (recNDVs) with PCR targets (Fig. 1). Two small cDNAs each with two PCR targets of RPV or PPRV, respectively, and separated by a small randomized spacing sequence were synthesized by Genscript Corporation Piscataway, NJ, USA (Fig. 2). One PCR target was based on in-house PCR tests for RPV or PPRV. The second PCR target was based on the signature primer and probe binding sites relevant to previously published PCR tests for RPV (Carrillo et al., 2010) and PPRV (Batten et al., 2011), respectively. The total foreseen RNA inserts were adjusted to multiples of six nucleotides according to the rule-of-six for packaging of the NDV genome (Peeters et al., 2000), and were 360 or 300 base pairs in length (Fig. 2). LguI cDNA fragments were recloned in the correct orientation in a shuttle plasmid, and the appropriate ApaI-NotI fragments were subsequently cloned in pNDFL2 according to standard cloning procedures (Peeters et al., 1999; Zhao and Peeters, 2003) (Fig. 1). RecNDVs with the small RNA insert between the P gene (phospoprotein) and M gene (matrix protein) of NDV were rescued (Fig. 1). Briefly, Quail fibrosarcoma cells (QM-5) were grown in Ford Dodge QT35 medium (Invitrogen, Carlsbad, CA, USA) containing 5% foetal calf serum (FCS) and 1% Pen Strep (10,000 units/ml, Invitrogen) to
Fig. 2. Overview of RNA inserts in recNDVs. RNA inserts encompasses two PCR targets of RPV or PPRV, respectively. Flanking LguI sites are grey shaded. PCR targets are separated by a randomized spacer sequence. RPV and PPRV specific sequences and nonspecific sequences are presented by capitol and small symbols, respectively. Targets of previously published PCR tests and in-house PCR tests are underlined and double underlined, respectively. 51
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Further, the in-house RPV PCR test is highly specific, since canine distemper virus is the closest matching sequence with four mismatches in each of the primers and probes, and will be not detected. The second target is based on the previously published PCR assay (Carrillo et al., 2010). Twelve sequences with this PCR target were found in Genbank, and all will be detected as these contain a maximum of one mismatch per primer or probe. The closest matching sequence is of measles virus (accession no.: JN635411.1 and KT588921.1) with two mismatches in one probe and one mismatch in the reverse primer. This could lead to false positive PCR results. Many RPV strains have been stored by laboratories worldwide, and will be sequenced by the few remaining RPV Holding Facilities in the near future. Anticipating on genetic variability, two PCR targets were inserted in NDV to reduce the chance on false negative PCR results. The recNDV with RPV PCR targets enables qualified PCR diagnostics for RP without the need to handle infectious RPV. Likely, two RPV PCR tests or actualization of currently qualified PCR tests will be needed to guarantee satisfying results with regard to diagnostic sensitivity and specificity in the future. At Wageningen Bioveterinary Research (WBVR), virulent RPV associated materials and all remaining RBOK vaccine virus associated materials have been destroyed in 2016 andn 2017, respectively, including positive PCR control material. Accordingly, the Dutch national reference institute for animal diseases WBVR does no longer store RPV associated materials. Similarly, recNDV with two targets of PPRV PCR tests was generated and anticipates on unknown PPRV variants. About 135 PPRV sequences with the target of the in-house PPRV PCR test were found in Genbank. PPRV sequences contain 0(n = 88),1(n = 36) or 2(n = 5) mismatches per primer or probe sequence, and will be detected. PPRV strain Ghana/ NK1/2010 has three mismatches in the probe sequence (KJ466104.1 (Dundon et al., 2014)). Indeed, this PPRV strain was not detected by the in-house PCR test but the amplified DNA fragment was detected by gel electrophoresis, and mismatches were confirmed by sequencing (not shown). Three sequences (MF574748.1, MF574749.1, and MF574750. 1) submitted to Genbank in July 2017 have 10, 8 or 7 mismatches in the reverse primer, respectively. Thus, the diagnostic sensitivity of the inhouse PPRV PCR test is of concern as these PPRV variants of recently submitted sequences will be missed. The second target is based on the previously published PCR assay (Batten et al., 2011). About 120 PPRV sequences matching this target were found in Genbank. About 110 PPRV sequences contain 0 or 1 mismatch. Eight sequences have > 3 mismatches per primer or probe, and could lead to false PCR negative results, and thus could reduce the diagnostic sensitivity of this PCR assay. Three of these sequences have been submitted recently in July 2017, and two of these sequences, MF574748.1 and MF574749.1, have several mismatches in this PCR target. Importantly, both PCR tests of which the targets were inserted in recNDV will not detect these recent PPRV variants. Apparently, it might be necessary to actualize recommended PCR diagnostics in order to detect all PPRV variants.
Table 1 List of PCR primers and probes. Sequences are indicated in the 5′- > 3′ order. Fw, Rv, and Pr indicate forward primer, reverse primer, and probe, respectively. PCR tests target the N-gene of PPRV (PPRV_N), the L- (RPV_L10) or Ngene of RPV (RPV_N). ‘WBVR’ indicates the in-house validated PCR tests and ‘Ba’ and ‘Ca’ refer to previously published and well-validated PCR tests (Batten et al., 2011; Carrillo et al., 2010). Primer/probe
Sequence
Fw_RPV_N_WBVR Pr1_RPV_N_WBVR Pr2_RPV_N_WBVR Rv_RPV_N_WBVR
ATGGGTGAACTGGCTCCTTA TCCAGAACAAGTTCAGTGCAGGAG-FL LCred640-CCCCTGTTGTGGAGCTATGCTATG-PH ACCTGAAATATGCAGGGTCA
Fw_RPV_L10_Ca Pr_RPV_L10_Ca Rv_RPV_L10_Ca
RATGAAAGGWCATGCCATATT ATCATCAACGGGTATCG GGTGGCCAGCTCC
Fw_PPRV_N_WBVR Pr_PPRV_N_WBVR Rv_PPRV_N_WBVR
AGTATCCGCCTTGTTGAGGT FAM-AGTCCGGGTTGACCTTTGCA-BHQ TCTATTATTTCTCTGTTCTCAAACC
Fw_PPRV_N_Ba Pr_PPRV_N_Ba Rv_PPRV_N_Ba
AGAGTTCAATATGTTRTTAGCCTCCAT CACCGGAYACKGCAGCTGACTCAGAA TTCCCCARTCACTCTYCTTTGT
72 °C), 30 s 40 °C, 4 °C. PPRV RT-PCR mix: 20 μl total volume: 5 μl isolated RNA, 800 nM primers, 200 nM probe, 2 μl RT mix (Quantifast Probe RT-PCR kit, Qiagen), 10 μl master mix (Quantifast Probe RT-PCR kit, Qiagen). 10 min 50 °C, 5 min 95 °C, 45 cycli (10 s 95 °C, 30 s 60 °C), 10 s 40 °C, 4 °C. PCR results were interpreted negative, doubtful or positive as previously described (van Rijn et al., 2012). In-house PCR tests for RPV or PPRV detected recNDV in dilutions up to 107 corresponding to 1–10 TCID50/ml. Undiluted recNDV with RPV targets was not detected with the PPRV PCR test, and undiluted recNDV with PPRV targets was not detected with the RPV PCR test. Clearly, in-house PCR tests were highly sensitive and specific. Further, as expected, the related paramyxovirus NDV was not detected by both PCR tests. In preparedness on destruction of all RPV associated materials, lentogenic recNDV with two RPV PCR targets was first generated, and tested with in-house validated PCR tests (Fig. 3). Apparently, dilutions of recNDV can replace (infectious) RPV or RPV as positive control for extraction, reverse transcription and amplification. Both PCR targets are highly conserved and specific (in silico sensitivity and specificity). The in-house RPV PCR test has been developed in our laboratory many years ago according to the fluorescence resonance energy transfer (FRET) system as for many PCR tests (van Rijn et al., 2004). About 24 RPV sequences in Genbank encompass this PCR target. RPV strain Fusan cattle type B (accession no.: AB547189.1 (Fukai et al., 2011)) contains three mismatches in one of the probe sequences, and will not be detected according to the in silico sensitivity (false negative).
Fig. 3. Results of in-house PCR diagnostics for dilutions of recNDVs. RecNDVs containing RNA inserts of RPV or PPRV were diluted in culture medium and tested three independent times with the respective qualified in-house PCR test for RPV and PPRV (A, B and C). Note, undiluted recNDV with RPV targets was not detected by the PPRV PCR test, and vice versa.
52
Journal of Virological Methods 259 (2018) 50–53
P.A. van Rijn et al.
Boonstra for excellent technical assistance, and Dr William Dundon (APHL Joint FAO/IAEA Division, IAEA Laboratories, Seibersdorf, Austria) and Dr. Angelika Loitsch (Institute for Veterinary Disease Control, Austrian Agency for Health and Food Safety, Moedling, Austria) for PPRV strain Ghana/NK1/2010. This research was financially supported by the Dutch Ministry of Economic Affairs (WBVRproject number 1600013-01).
NonPPRV sequences did not match to the sequences of both incorporated PCR targets. Taken together, both PPRV PCR tests showed a high in silico specificity but improvement of the in silico sensitivity will be required to detect all PPRV variants. Obviously, recNDV with these actualized or additional PCR targets could be generated easily. Using recNDV as alternative positive control material, the Dutch national reference institute for animal diseases WBVR is prepared on the foreseen worldwide eradication of PPR. Historically, large areas of the world are PPR-free, and PPRV PCR diagnostics can now be performed even long before eradication in PPR endemic countries without use of infectious PPRV and without veterinary BSL3 facilities. It is laborious and expensive to collect defined positive field samples from abroad or to perform animal trials for exotic diseases in order to enable proper test validation. Regarding PCR diagnostics, the here developed recNDVs can be used to spike defined negative field samples with small (limited) amounts of recNDV to generate defined positive samples. These spiked samples closely mimic PCR positive field samples, in particular since NDV is also a member of the Paramyxoviridae family. Validation of PCR diagnostics, including nucleic acid extraction, reverse transcription, polymerase chain reaction and real time detection, is in particular important for variable field samples, such as faeces or excreta. For many diseases, the virus collection of national reference laboratories is very limited, like for RPV and PPRV in historically diseasefree countries worldwide. Furthermore, many virus variants have not been stored, like these observed by molecular epidemiology studies. On the other hand, genetic data of variants become massively and rapidly available nowadays. Even more, in vitro propagation of emerging viruses is not always successful. Clearly, the here described method enables validation of PCR diagnostics without expensive and risky shipment of dangerous infectious viruses to laboratories in countries free of disease. The here described recNDVs are available on request. Notably, reverse genetics for NDV is routinely used in many laboratories, and recNDV with other or additional PCR targets can be generated. Possibly, PCR diagnostics should be actualized in order to anticipate on new virus variants escaping from current well-validated PCR diagnostics. RecNDV as alternative positive PCR control should be considered for closely related viruses, like other enveloped, single negative stranded RNA viruses (Mononegavirales, Bunyavirales, Arenavivirdae, and Orthomxyoviridae). Lentogenic recNDVs with small RNA inserts are completely safe and will improve biosafety and biosecurity for zoonotic and OIE-listed virus diseases.
References Batten, C.A., Banyard, A.C., King, D.P., Henstock, M.R., Edwards, L., Sanders, A., Buczkowski, H., Oura, C.C., Barrett, T., 2011. A real time RT-PCR assay for the specific detection of Peste des petits ruminants virus. J. Virol. Methods 171, 401–404. Britton, P., Green, P., Kottier, S., Mawditt, K.L., Penzes, Z., Cavanagh, D., Skinner, M.A., 1996. Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J. Gen. Virol. 77 (Pt 5), 963–967. Carnero, E., Li, W., Borderia, A.V., Moltedo, B., Moran, T., Garcia-Sastre, A., 2009. Optimization of human immunodeficiency virus gag expression by newcastle disease virus vectors for the induction of potent immune responses. J. Virol. 83, 584–597. Carrillo, C., Prarat, M., Vagnozzi, A., Calahan, J.D., Smoliga, G., Nelson, W.M., Rodriguez, L.L., 2010. Specific detection of Rinderpest virus by real-time reverse transcriptionPCR in preclinical and clinical samples from experimentally infected cattle. J. Clin. Microbiol. 48, 4094–4101. Duan, Z., Xu, H., Ji, X., Zhao, J., 2015. Recombinant Newcastle disease virus-vectored vaccines against human and animal infectious diseases. Future Microbiol. 10, 1307–1323. Dundon, W.G., Adombi, C., Waqas, A., Otsyina, H.R., Arthur, C.T., Silber, R., Loitsch, A., Diallo, A., 2014. Full genome sequence of a peste des petits ruminants virus (PPRV) from Ghana. Virus Genes 49, 497–501. Fukai, K., Morioka, K., Sakamoto, K., Yoshida, K., 2011. Characterization of the complete genomic sequence of the rinderpest virus Fusan strain cattle type, which is the most classical isolate in Asia and comparison with its lapinized strain. Virus Genes 43, 249–253. Kortekaas, J., de Boer, S.M., Kant, J., Vloet, R.P., Antonis, A.F., Moormann, R.J., 2010. Rift Valley fever virus immunity provided by a paramyxovirus vaccine vector. Vaccine 28, 4394–4401. Nakaya, T., Cros, J., Park, M.S., Nakaya, Y., Zheng, H., Sagrera, A., Villar, E., GarciaSastre, A., Palese, P., 2001. Recombinant Newcastle disease virus as a vaccine vector. J. Virol. 75, 11868–11873. National Cancer Institute on Newcastle disease virus as a treatment for cancer, o.a. and http://www.nci.nih.gov/cancerinfo/pdq/cam/NDV. Peeters, B.P., de Leeuw, O.S., Koch, G., Gielkens, A.L., 1999. Rescue of Newcastle disease virus from cloned cDNA: evidence that cleavability of the fusion protein is a major determinant for virulence. J. Virol. 73, 5001–5009. Peeters, B.P., Gruijthuijsen, Y.K., de Leeuw, O.S., Gielkens, A.L., 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch. Virol. 145, 1829–1845. Reed, L.J., Muench, H., 1938. Asimple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 27, 493–497. van Rijn, P.A., Wellenberg, G.J., Hakze-van der Honing, R., Jacobs, L., Moonen, P.L., Feitsma, H., 2004. Detection of economically important viruses in boar semen by quantitative RealTime PCR technology. J. Virol. Methods 120, 151–160. van Rijn, P.A., Heutink, R.G., Boonstra, J., Kramps, H.A., van Gennip, R.G., 2012. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8. J. Vet. Diagn. Invest. 24, 469–478. Zhao, H., Peeters, B.P., 2003. Recombinant Newcastle disease virus as a viral vector: effect of genomic location of foreign gene on gene expression and virus replication. J. Gen. Virol. 84, 781–788.
Conflict of interest None. Acknowledgements The authors are grateful to Olav de Leeuw and Christine Leendertse-
53