Recombination between satellite phage P4 and its helper P2 I. In vivo and in vitro construction of P4::P2 hybrid satellite phage

Gene, 14 (1981) 231-241

231

Elsevier/Ninth-HollandBiomedicalPress

R e c o m b i n a t i o n b e t w e e n satellite phage P4 and its helper P2 I. In vivo and in vitro construction of P4::P2 hybrid satellite phage (Recombinant DNA;EcoRI; restriction endonudeases)

Bj6rn H. Lindqvist * Institute of Medical Biology, University of Tromsq~, 9001 Troms~ (Norway) and Department of Molecular Biology, University of California, Berkeley, CA 94720 (U.S.A.)

(ReceivedDecember5th, 1980) (Accepted January 22nd, 1981)

SUMMARY P4::P2 hybrid satellite phages which carry a portion (including the 1)2 head gene Q and the cohesive end) of the left end of the P2 chromosome linked to the essential part of the P4 chromosome have been isolated by in rive as well as in vitro recombination. These hybrids express gene Q and grow in the presence of a 1"2 helper even if defective in gene Q.

INTRODUCTION Bacteriophage P4 is a satellite virus which requires the presence of a helper phage - such as 1'2 - to complete its life cycle. It has been shown that P4 maturation needs all known structural genes of the helper (Six, 1975). P4 DNA replication, however, is independent of the helper (Lindqvist and Six, 1971). Our efforts to understand the interactions between P2 and P4 have been directed toward studies on the genetics and biochemistry of the expression of the ganomes and little attention has so far been given to the possibility of recombination in the 1'2 and 1'4 system, because I'4 is less than 1% homologous, sug* Where all correq~ondenceshould be addressed. Abbreviations: bp, b m pairs; EtBr, ethidium bromide; kb, kilobase pairs; SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCI, 0.01.5 M Na, citrate, pH 7.8.

gesting that such recombination would be infrequent. However, the isolation of P2::1'4 hybrids would be of great interest and should provide a new means to analyse the P2-P4 system (Bradley et al., 1975). The cohesive ends of 1'2 and P4 are known to be identical (Wang et al., 1973), but lack of knowledge concerning the orientation of the 1'4 chromosome relative to that of 1'2 has made it impossible to predict and design selective conditions for the isolation of viable I'4::P2 recombinant phage particles. It is now known, however, that one of the arms, constituting about 30% of the P4 chromosome, is nonessential for I'4 growth (Souza et al., 1978). Therefore, it seems likely that P4::P2 recombinants might arise in rive by illegirnate recombination between the nonessential part o f the I'4 chromosome and one of the endportions of the 1'2 chromosome. Furthe:more, it is also conceivable that recombinants may arise by exchange of the early 1'2 DNA region for the essen-

0378-1119/81/0000-0000/$02.50 O 1981 Elsevier/North-Holland Biomedical Press ',

232

HEAD

LYSIS

TAIL

DNA

ori BamH£ BamHl

BamHl

int. C B ~ _ _ ~

P2 del 2

6630 EcoRl

EcoRI

ori BamHl

2201 2 8 0 0 1 I 440 EcoRI EcoRI

I

BamHI

7590

Fig. I. Restriction and partial genetic maps of P2 and P4. The location of the restriction sites is based on the works of Chattoraj et aL (1977), West,6 and Ljungquist (1979) for P2 and Goldstein et al. (1975), B.H. Lindqvist (unpublished results) for P4. The P4 gene loc~tions are derived from the map of Kalm et aL (1980). 6, ttansactivation; s/d, head size determination; e, derepression; psu. polarity suppression, ori, replication origin;/nt, P2 integration, C, P2 repressor. The size of each EcoR! fragment is f~ven in bp.

tial portion of 1'4 (see Fig. !). Comparison of the EcoRl restriction maps of 1)2 and I'4 DNA suggest that in vitro recombination might yield the aforementioned hybrids. As can be seen in Fig. i, the P2-A fragment could be joined to the P4-a fragment, thereby generating a P4::1'2 hybrid. Likewise, the P4-a fragment could be joined to the ABC fragment of P2. It is f~r from clear, however, whether or not such a P4::1'2 hybrid could be viable. As the above mentioned recombination schem~ involve the cohesive ends of 1'2 and 1'4 it is absolutely required that the chromosome's are oriented relative to one another as shown in Fig. 1. In this paper we describe tl~.e isolation of viable helper-dependent P4::P2 hybrids, which carry the left portion of the P2 chromosome, including the P2 cohesive end, attached to the essential right part of the P4 chromosome. In an accompanying paper we describe the isolation and characterization of a helper independent P4::P2 hybrid which carries the essential part of 1'4, (the a fragment)joined to the full ~omplement of the late genes of I'2 (the ABC fragment) (Lindqvist, 1981).

MATERIALS AND METllODS

(a)Phages P4virl (Lindqvist and Six, 1971) and P2del2 (Chattoraj et al., 1975) were used as parents in the search for 1)4::P2 hybrids. The del2 deletion, which shortens the P2 chromosome by 6.1%, has been included to improve the chances for isolation of helper-independent P4::P2 hybrids (see Lindqmt, 1981). The P4::P2 helper-dependent hybrids were isolated on a P2Q- lysogen (C-1516) but grown on a P2Q÷ lysogen (C-1592) for stock production (C-I 516 lysogen carries a P2 prophage with a temperature. sensitive mutation in gene Q). The stocks were ohmined from cultures grown in LB, to which a fmal concentration of 10-2 M EDTA was added at the time of ,ross lysis. The cellular debris was removed and the phage particles pelleted by centrifugation for 2 h at 54 000 × g. The phage pellet was finally resuspended in 0.08 M MgCl2, supplemented with 1% ammonium acetate and 10-2 M Tris. HCI, pH 7.2 (Barretet al., 1976). For subsequent work with the

233 DNA, the phage stocks were purified by CsCI density gradient equilibrium centrifugation and dialysed against 0.075 mM MgCI2. Indicator strains for plaque assays were C-1055 for P2 and C-1197 for P4.

Formamide and CsCl were of pro analysi grade from Merck, Darmstadt, FRG. Agarose (electrophoretic grade) was purchased from Sigma St. Louis, MO 63178, USA.

(b) Bacterial strains

(f) Restriction endonuclease digestion, ligase reaction and gel electrophoresis

These are listed in Table I.

(c) Media L broth (LB) was previously described by Six and Klug (1973). LB agar for phage assays (Bertani and Bertani, 1970) and TPG-CAA Medium (Lindqvist and Six, 1971) were gso as described. (d) DNA preparations The phages (5 X 1011--2 X 1012 particles/ml)were treated with SDS at a f'mal concentration of 0.25%, and kept at 60°C for 3 min (B~vre and Szybalski, 1971). Phenol treatment of the DNA was repeated three times. The phenol was removed by repeated dialyses against 0.1 X SSC. The DNA preparations were kept at about 0°C.

The cor~4itions described by Hopkins et al. (1976) for restriction enzyme digestion were used. In vitro ligation of P2 and P4 EcoRI fragments were carried out by mixing 10 ~1 of each EcoRI.digested DNA in 100 ~1 ligase buffer. The mixture was heated for 15 min at 70°C and allowed to cool on the laboratory bench. The mixture was then kept at 10°C while 10~1 of a 1 mM ATP solution and 0.15 units of T4 iigase were added to ligate the recombined fragments. The ligase buffer is composed of 66 mM Tris. HC1, 1 mM EDTA, 10 mM MgCI2, 100 mM NaC1, 10 mM dithiotreitol, and 0.1 mg bovine serum albumin per ml (Hopkins et al., 1976). Agarose gels (1% in 0.04 M Tris.acetate, pH 8.0) were operated horizontally in the absence of EtBr at constant voltage. The gel dimensions were 130 X 130 X 3 mm. The gels were stained by EtBr and subjected to photography. The negatives are displayed in the figures.

(e) Enzymes and chemicals (g) Transfection Restriction endonucleases EcoRl and 9arnHl as weU as T4 polynucleotide ligase were obtained from New England Biolabs, Boston, IdA 01915, USA.

E. coli C4a and C-2326 were used for P2 and P4 transfection, respectively. The cells were grown in LB

TABLE I Bacterial strains used in the present study Strain designation

Pertinent mutation

Prophage carried

C-la C-322 C-339 C-1055 C-1197 C-1415 C-1512 C-1514 C-1516 C-1592 C-1757 C-2326

none none none none none rep-3 none none none none supD none

none l'2Pam-137 P21gcc none P2 none P2Mts-52 P2Ots-44 P2Qts.48 P2cox-3 none P2/g

Nonlysogenic precursor C-la C-la C-1055 C-1200 C-1055 C-1055 C-1055 C-la C-la

Origin or reference Bertani (1968) E.W. Six, Iowa City E.W. Six, Iowa City Wiman et aL (1970) Caie.ader et al. (1970) Calender et al, (1970) Lindahl (1969) Lindahl (1969) Lindahl (1969) E.W. Six, Iowa City Sunshine et al. (1971) Kahn and Helinski(1978)

234 to about 2 X lOs cells/nil, concentrated ten-fold in 0.1 M CaCI2, starved for an hot~r at+ O°C,and finally transfected as described by Hopkins et al. (1976). (It) In vitro pad~aging The ligated phage DNA n~olecules were packaged in vitro by employing an extract of P2M- infected cells as described by Bowden and Calendar (1979). Under these conditions, both 1'2 as well as 1'4 chromosomes will be packaged into a P2 capsid. (i) Electron microscopy Phage DNA heterodup!exes were prepared by the fo.~na~de procedure of Westmoreland et al. (1969) as described by Davis et al. (1971). The heteroduplexes were visualized in Hitachi EM model HU-12 at 75 kV.

Ij) DNA sequencing The cohesive ends of the P2 chromosome were end labeled by [7.S2P]ATP, the P4-d fragment isolated after EcoRi digestion and subjected to the chemical degradation procedure of Maxam and Gilbert (1977).

RESULTS

(a) Isolation of P4::P2 hybrid satelfite phages Before attempting to isolate P4::P2 hybrids the orientation of the P2 and P4 cohesive ends relative to their genetic maps had to be established. In order for the potential hybrid DNA molecules to be able to circularize, the cohesive ends need to be complementary after the recombination event. Murray et al. (1977) had established the sequence of the cohesive ends of P2-A fragment as well as the D fragment. Vie therefore isolated the P4-d fragment (see Fig. 1)for sequence analysis and subsequent comparison with the P2-A and D fragments. The result is shown in Fig. 2. It can be concluded that the relative orientation of the P'2 and P4 cohesive ends is as presented in Fig. 1. We ~ refer to these orientations below, but it should be noted that orientation of P4 is opposite

to the previously published orientation (Souza et al., 1978).

(1) In vivo isolation To isolate P4::P2 hybrids in rive, E. coli C-la was coinfected with P4v/rl and P2de/2, and the progeny was fractionated by CsCl centrifugation (Barrett et al., 1976). Portions of the P4 peak were plated on C-1516 at 42°C. This strain carries a F2 prophage with a mutation in the Q gene. Hence, only 1'4 recombinants carrying a functional 1'2 Q gene would be expected to plate on C-1516 at 42°C. Several Q-independent plaques were obtained under these conditions, each isolate being a e~mdidate for P4::P2 hybrid carrying gene Q. It was found, however, that P4 Q-independent plaques could also be obtained directly from the P4 parent stock used in the coinfection. It will be shown later by endonuclease restriction analysis that all the isolates appear to be identical and are likely to have originated from a single recombinant present in the original P4virl stock used. (2) In vitro isolaiion EcoRI digestion of P2 and P4 DNA, and the subsequent fragment anr~ealing would be expected to generate a P,~-a fragment joined to a P2-A fragment. Such a structure would be a candidate for a P4 hybrid carrying gene Q as well as gene P of !'2, since it has been shown that the Ecoltl site is located in the O gene (G. Bertani, personal communication). By employing the isolation procedure described in Fig. 3, six Q.independent plaques were isolated for further characterization. These isolates as well as the in rive isolates fail to plate in the absence of P2. Furthermore, they are indistinguishable from P4 wild-type particles in the electron microscope (unpublished observations). The isolates were purified and retested on the P2 Q- lysogen as well as on 1'2 lysogens defective in genes P, O, M, respectively. Three of the in rive isolates were also included in this test. As can be seen in Table II, contrary to P4 wildtype, all the isolates plate on the Q- lysogen. None of the isolates, however, plate on the P-, O-, and M- lysogens. This result suggests that the isolates represent P4 Jike P2::P4 hybrids, which have received the left end portion of 1'2 and as a consequence express the Q gene but none of genes P, O, or M. Attempts were also made to isolate 1'4 P.indepen-

235

P4 d-fragment:

AGCCAAACGCGCGCCACGAAAGGGGCGGAGCGG TCGGTTTGCGCGCG

P2 A-fragment:

C GC G C G T C A C G A A A G G G G C GCGCGCA

G GAGC

GG

P2D-fragment:

C GC C C GC C C GC T C C GC C C C T T T C GT G GCGGGCG Fig. 2. The orientation of the cohesive ends of P2 and P4. The nucleotide sequence of the cohesiveend located in the P4-d f~~gment was obtained by the procedure of Maxam and Gilbert (1977). The location and sequences of the P2 cohesive ends are as published by Murrayet al. (1977).

dent plaques by plating the in vitro packaged phages on a I'2 P- lysogen (strain C-322). Under conditions where ten P4 Q-independent plaques were detected no P4 P-independent plaque was seen. (b) Grawth of the hybrids One-step growth experiments were done with both the in vivo as well as in vitro constructed hybrids (Hy8 and Hy213) (Fig. 4). As can be seen, the growth of the hybrid: [esembles that of P4.

(c) Physical and genetic characterizations of the P4 Q-independent DNA (1) Restriction analysis The fac. that the isolated phages plated exclusively on P2 lysogens and were able to grow in the presence of a P2Q- helper suggested that P4 particles carrying the left end portion of 1'2 had been isolated. In order to investigate the DNA organization of the isolated I'4 particles, stocks were grown, and DNA was extracted. The DNA was subjected to EcoRI digestion followed by agarose gel electrophoresis. All the in vivo isolates as well as three (Hy9, Hyl 2, lty21) of the six in vitro isolates were resistant to EcoRI. Two (HyS, ltyl 7) of the six in vitro isolates contain a single EcoRI restriction site whereas one (Hy3) carries two sites. In Hy3 the EcoRI sites which give rise to the P4-b fragment have been retained. The results for the in vitro isolates (Fig. 5) clearly demonstrate that a major change has taken place in the left ann of the I'4 chromosome. The in vitro recombinants cannot contain an annealed complete F2-A fragment, since the fragment re~vered is always smaller that, the P2-A fragment. If, initially, the proper frag.

ments (A + a) annealed in vitro, deletion events must have occurred in rive ieadh~g to the present DNA structures. In the case the Hy9, 12 and 21, the deletions must include the rightmost EcoRl site of P4. In all cases, the length of the Q-independent P4 DNA is less than that of P4 wild type. The results for the in rive isolates are not included, but they all showed the same resistance to EcoRl as did Hy9, 12 and 21. To confirm that the Q-independent P4 DNAs are indeed hybrid DNAs and to examine the extent of the P2 DNA contribution, the DNAs of some isolates were digested with BamHl, which recognizes two sites in the very left end of the P2 DNA (see Fig. 1). Hence, if the isolates carries the left end of P2, BamHl should recognize this piece of DNA and generate a characteristic P2.type fragment not present L,a wild-type P4 (see Fig. 1). Hy8, Hyl 7 and five of the in rive made hybrids were analysed for that purpose. The EcoRl.resistant in vitro made hybrids (Hy9, 12 and 21) were not analysed further. As many as five different in vivo isolates were analysed because suspicion arose that they might originate from the same recombination event. The results shown in Fig. 6 demonstrate that the BamHI fragment of the left end of P2 (marked BamHI) can be recovered from the in vivo isolates (Hy213, 251) as well as from Hyl7. Hy8, however, lacks the P2-size fragment but contains instead a slightly larger fragment generated by the loss of one of BamHI sites. The bands marked with a star represent the P2::P4 joint fragments. Analogous joint fragments of Hy213 and Hy251, including the small 1'2 end fragment of about 220 bp, have run off the gel. The restriction pattern of the in vivo isolates is shown in Fig. 7 with Hy213 and Hy400 as exanaples- The band marked with a star

236

EcoRI

EcoRI DNA

Q EcoRI dcb

represents the F2::1'4 joint fragment. This BamHl fragment is electrophoretically ident.ical for all five in vivo isolates tested. Hence, the hybrids isolated in vivo most likely represent the progeny of a single recombinant.

(2/Heteroduplex analysis

DNA

i ligation + in vitro packaging

plate for plaques E. coli (P2 O-)=(C - 1516) Fig. 3. in vitro ~:onstrJction and isolation of viable P2::P4 hybrids P2del2. DNA (36 ~g in 88 ul volume) and P4viri DNA (13 gg in 46 ~! volume) were partially digested with !.3 and 1.2 an;~ts of EcoRl respectively (Hopkins et al. ! 9"/6). After 60 rain at 37°C the reactions were stopped by heating the samples for 10 rain at 70°C. The digests were annealed, and then ligated as described in MATERIALS AND METtlODS. The ligation reaction was followed by the reco~ely of transfectinus P2 or 1'4 DNA. By this criterion iigation was completed ~fter about 50 h at 10°C (results not shown). At this point the DNA mixture was subjected to in vitro packaging m the presence of P2M- extracts (Bowden and Calendar, 1979). (Transfection was unable to resolve any recombinants. It could be estimated that transfection was at least 50 times less efficient than the in vitxo packaging procedure.) The in vitro made particles were checked for the presence of gene Q-hldependent P4 phage by plating on the P2Qlysogen, C-1516, at ¢2°c.

To confirm and extend the results of the restriction work, the hybrids were subjected to heteroduplex analysis. Heteroduplexes of P4virl/Hy8, H y l 7 , and Hy213, respectively, are shown in Fig. 8. It can be measured that 1.6, 2.8 and 2.5 kb of the left end of 1)2 are present in Hy8, H y l 7 and Hy213, respectively. This result is consistent with the restriction analysis and confirms that the complete EcoRI.A fragment of 1>2 (3.5 kb) is not present in the P4: :1)2. in vitro made hybrids. The results of the restriction and heteroduplex analysis are summarized in Fig. 9. Since all the in vivo isolates appear to be identical, it is concluded that they have originated from the same recombination event. The possibility that they might represent independent site-specific recombination events seems less likely since it would require a recombination-specific P4 site in the vicinity of the P gene of 1'2. 1)4 is known to have its attachment site at 31A-36.5%, i.e. just right of the EcoRI site at 30.5% (R. Calendar, personal communication). This is the very same region where the hybrid joint is found in the in vivo hybrids. Hence, the I)4 int-att system, might nevertheless have been responsible for an unspecific recombination event giving rise to the hybrid isolated in vivo.

(3) Marker rescue analysis None of the hybrids were able to grow in the

T A B L E II

Plating properties of the P4 Q-independent isolates Portions of the purified plaques were spot tested on P2 lysogens under non permissive conditions. P4virl served as a control. Isolate

P2 prophage defective in gene: Q(C-1516)

P(C-322)

O(C-1514)

MC-1512)

Wild-type control (C-1197)

P4r/rl

4-

Hy3,8,9,12,17,21 (made in vitro) Hy201,213,251,323,400 (made in vivo)

4-

237

213 P4 8

I 20

I 40

I 60

I 80

1 100

Minutes Fig. 4. One-step growth curves. The one-step growth expetiments were performed according to Six and Klug (I 973). C-339 was used as host and the growth temperature was 37“C. The growth of two Q-independent isolates are shown: Hy8 (in vitro constructed) and Hy213 (in vivo constructed). P4 served as a control.

absence of gene P. This indicates that Q is the only functional P2 gene present in the hybrids. The p2 portion of the Hy17 hybrid, however, is only about 650 bp shorter than the P2-A fragment, which is known to contain gene Q, P and part of the 0 gene (G. Bertani, personal communication), Xcnce, at least part of the P gene ought to be present in Ilyl7. To investigate in more detail the genetic content of the P2 DNA portions of the hybrids, a marker rescue analysis was performed. P2 amber mutants defective in gene Q, P or 0 were used in coinfections with hybrids Hy8, Hyl7 and Hy213, respectively. The burst was analysed for wildqpe recombinants by plating on a nonpermissive host. The result is shown in Table III. As expected, the Q allele can be rescued from all three hybrids, whereas the 1’ allele can be recovered only from hybrids Hy17 and Hy213. The 0 allele cannot be detected in any of the hybrids. Hence, these results and the plating properties of the hybrids indicate that they contain a l?2 DNA portion, most likely cut in or in the vicinity of gene P, with an intact gene Q.

,oresiswere car-

t isolates (Hy9,

238

Fig. 6. BcmH! restriction analysis of in vivo and in vitroconstructea (~-independent DNA. The digestion and gel eleetrophorcsis were carried out as described in METHODS (duration of run was 20 h at 15 V). The DNA of four Q-in~ependent isolates were analysed. (Hy213, Hy251 age in vivo constructed hybrids and Hy8 and HyI7 are in vitro conetructed hybrids). The DNA of P2 and 1'4 we.re included ~s ;eferences. The DNA bands at the position of a stag represents P2::P4 joint fragments.

Fig. 7. BamHi restriction mtalysis of in vivo-comaracted Q-independent DNA. The digestion and gel electrophoresis were carried out as described in METHODS (duration of run was 18 h at 11 V). The DNA of two in vivo constructed hybrids (Hy213 and Hy400) were analysed. P4 DNA was included as a reference. The DNA band at the position of the stag represents the P2::P4 joint fragment.

(d) Transcription P4 transcription can be divided into an early and a late phase. The early transcription is leftward (includes gene a) whereas late transcription is rightward (Harris and Calendar, 1978). In the hybrids the P2 DNA is oriented in such a way that the Q gene has to be expressed leftward in order to give rise to a functional product. It was therefore o f interest to investigate the temporal patterns o f transcription from the P4 and the P2 DNA regions after infection Fig. 8. Heteroduplex analysis. Examples of hcteroduplexes between in vitro or in vivo constructed hybrids and DNA strands of P4v/rl. (a) Hy8; Co) Hy213, and (e) HylT. ~see MATERIALS AND METHODS, section i). Split ends can be seen in all three cases. This zesult is consistent with the presence of P2 DNA in the hybrids.

239 26.5 30.5

2.0

EcoRI sites

36.3 P4

10

0

91.3 40

20

50

60

70

80

BamHl sites 100%

i~mHl

I

IQ

Hy 3

(92.7 %)

BamHl

10

Hy 8 Hy17

io

Hy 201,213,251, 323,400

I

BamHl IQ

i

(84.3 %)

'

(95.6 %)

-

(90.0 %)

BamHI

I

Q Hy 17 transcription

"-

BamHl

BamHl

P4 early transcription

~

P4 late transcription ,

P2 m - RNA

~"

P4 m - RNA

Fig. 9. Structure and function of the Q-independent DNA. (a) Summary of restriction and heteroduplex analysis of in vivo (Hy201, 213,251,323 and 400) and in vitro (Hy3, 8, 17) constructed P4 Q-independent DNA. (b) Hy17 Q gene transcription.

of a non-lysogenie host with the hybrids. The P2 and P4 transcripts are detected by hybridization to P2 and 1)4 DNA, respectively (Lindqvist, 1974). The result of such an experiment with Hy 17 is shown in Fig. 10. The 1)4 transcription follows the pattern described by Harris apd Calendar (1978). Initially a burst of early transcription can be seen, which reaches a maximum around 10 rain after infection. From this point it declines and at 30 rain the presence of late P4 transcription is evident. The transcription from the 1)2 DNA region follows the pattern of the early P4 transcription. This result suggests that the Q gene transcription is under control of the P4 early leftward transcription. Presumably, the early

P4 transcription proceeds into the P2 region giving rise to a hybrid P4::P2 transcript as schematically represented in Fig. 9b. Thus, the Q gene product, which i,~ required in the morpl',ogenesis of P2 or P4, appears as an early gene product in cells infected with the hybrids.

DISCUSSION

The present results clearly demonstrate that viable hybrids can be obtained between P2 and P4 by in vitro recombination techniques. Hybrid formation

TABLE !II Marker rescue experiments Before coinfection of E. coli C-1757 with P2 amber mutants and the hybrids, the phages were UV-ix;adiated to increase the recombination frequency (Lindahl, 1969). The infections were performed in LB at 37°C, Total P2 yields were assayed on strain C-1757 and P2 wild-type recombinants on (2-1055. The values are given as recombinants over total phage yield. P4: "P2 hybrids

none

1'4 (control) Hy8 HyI7 Hy213 a Sunshine et al., 1971.

P2 amber mutants Q - (P2virlQam34 ) a

P- (P2virlPam13 7) a

O- (P2vir l Oam 71) a

1.4 x 10-6 3.1 x 10-7 2.2 X 10-3 8.8 × 10-4 9.0 X 10-4

8.1 x 10-7 1.8 x 10-7 1.7 X 10-7 2.1 X 10-4 1.8 x 10-4

1.6 × 10-8 2.3 X 10-8 2.0 x 10-8

240

0.8

< z c3 eL

transmil~ion from P4 DNA

0.6

3 eL O

-g .N

,~- 0.4 L-

.,Q .IZ

E Q.

?

"!"

~,4= 0.2' transcription from P2 DNA

N

,

o

lO

20

3O

40

50

60

rain

Fig. 10. lly! 7 transcription. E. coil C-la was grown in TPGCAA medium to about 1 × l0 s celis/mland infected at 37°C with HyI7 at a multiplicity of infection of 10. Samples of 3 ml were removed and pulse-labeled with 50 ~Ci of [3HIuridine for 2 rain at the times indicated. RNA was extracted and hybridized to f•er-bound P2 and P4 DNA, respectively {B¢vre and Szybalski, 1971). The results repzesent the av~age data of two experiments, e, label hybridized to P2 DNA; o, label hybridized to i'4 DNA.

must also occur in vivo since a I'4::1'2 hybrid has been isolated from a 1)4 stock grown in the presence of P2. However, the reproducibility of the in vivo recombination remains to be established. It was known that a portion of the left arm of P4 could be substituted for by phage lambda DNA (Souza et al., 1978). This ~bservation was essential for the design of our isolation experiment. Our results further demonstrate that a large part of the left arm of 1)4, including the cohesive end, can be exchanged for DNA that carries an appropriate cohesive end. It is known that the EcoRI site which generates the P2-A fragment is located in the O gene (G. Berttani, personal con~nunicafion'}. Since the transcription of 1)2 is divergent with respect to genes P and O, it is thought that transcription is initiated from a

DNA sequence between these genes. The hope was that this promoter region would be included in the P4::P2 hybrids, in such a way that a mini-system for studying transactivation would be created. This is probably not the case since none of the hybrids will grow on a P- lysogen. The Hyl7 fragment is about 650 bp shorter than the P2-A fragment. Thus, the results indicate that the above-mentioned divergent promoter region must lie in this 650 bp region. The results of the transcription study indicate that the P4 early promoter(s) has taken over the control of the expres~on of the P2 DNA portion in the hybrids. Can we all be sure that the Q gene is expressed and its product being active during the growth of the 1)4 hybrids? Attempts to complement P2 Q- phages in coinfections with Hyl7 have failed presumably due to the strong interference for 1)2 growth exerted by 1)4 (Diana et al., 1978). E~g., certain deletions in the ?~ genome will suppress the need for gene D product in ~ head morphogenesis (Sternberg and Weisberg, 1977). It can be argued that the 1)2 Q gene product functions in an analogous manner to the D gene product of ~,. Hence, deletion in the 1'4 DNA shouid suffice to suppress the need for the 1'2 Q gene. It can be shown, however, that this is not the case. Deletions of I'4 corresponding to size of the deletion in Hyl7 or larger fail to plate on !'2 Q-lysogens (unpublished results). The failure to obtain proper in vitro libation of the P2-A fragment to the a fragment of 1'4 is not under. stood. One possible explanation could be that the presence in the hybrids of the above mentioned P2 promoter region disrupts the functional organization of 1'4 transcription. Therefore, in order to survive the hybrids must delete that region, and the retention of the intact P2-A fragment should not be expected. In this connection it is interesting to recall the ability of P4 to generate deletions in its non-essential region (Souza et al., 1978).

ACKNOWLEDGEMENTS

This work was initiated during a sabbatical stay in the Department of Molecular Biology, University of California, Berkeley, CA. We wish to thank Dr. D. Bowden for showing us in vitro packaging of P2 and

241

P4 DNA and Dr. N. Franklin for tutoring us in DNA sequencing. The technical assistance of Ms. SigneElise Aakre is gratefuny ac'~-mwledged. This work was supported by the Norwegian Research Council for Sciences and Humanities (grant C.17.~4-1) and in part from grants to R. Calendar, whom we thank for his hospitality.

REFERENCES It

Barrett, K.J., Marsh, M.L. and Calendar, R.: Interactions between a satellite phage and its helper. J. Mol. Biol. 106 (1976) 683-707. Bertani, L.E.: Abortive induction of bacteriophage P2. Virology 36 (1968) 87-103. Bertani, L.E., and Bertani, G.: Preparation and characterization of temparate noninducible bacteriophage P2. (host Escherichla colt'). J. Gen. ViroL 6 (1970) 201212. Bowden, D., and Calendar, R.: Maturation of bacterioohage P2 DNA in vitro: A complex, site-specific system for DNA cleavage. J. Mol. Biol. 129 (1979) t-18. Bradley, C., Ling, O.P. and Egan, J.B.: Isolation of phage P2-186 intervarietal hybrids and 186 insertion mutations. Mol. Gen. Genet. 140 (1975) 123-135. BCvre, K. and Szybalski, W.: Multistep DNA-RNA hybridization techniques, in Grossman, L. and Moldave, K. (Eds.), Methods in Enzymology. Vol. 21, Academic Press, New York, 1971, pp. 350-383. Calendar, R., Lindqvist, B.H., Sironi, G. and Clark, A.J.: Characterization of REP- mutants and their interactions with P2 phage. Virology 40 (1970) 72-83. Chattoraj, D.K., Young,husband, H,B. and lnman, R.B.: Physical mapping of bacteriophage P2 mutations and their relation to the genetic map. Mol. Gen. Genet., 136 (1975) 139-149. Chattoraj, D.K., Oberoi, Y.K. and Bertani, G.: Restriction of bacteriophage P2 by the Escherichia coli RI plasmid, and in vitro cleavage of its DNA by the EcoRl endonuclease. Virology 81 (1977) 460-470. Davis, R.W., Simon, M. and Davidson, N.: Electron microscope heteroduplex methods for mapping regions of base sequence homology in nucleic acids, in Grossman, L. and Moldave, K. (Eds.), Methods in Enzymology. Vol. 21 Academic Press, New York, 1971, 413-428. Diana, C., Deho, G., Geisseisoder, J., Tinelli, L. and Goldstein, R.: Viral interference at the level of capsid size determination by satellite phage 1'4. J. Mol. Biol. 126 (1978) 433-445. Golds:ein, L , Thomas, M., and Davis, R.W.: EcoRl endonuclease cleavage map of bacteriophage P4 DNA. Virology 66 (1975) 420-427. Harris, J.D. and Calendar, R.: Transcription map of satellite coliphage P4. Virology 85 (1978) 343-358.

Hopkins, A.S., Murray, N.E. and Brammar, W.J.: Characterization of ;ffrp-transducing bacteriophages made in vitro. J. Mol. Biol. 107 (1976) 549-569. Kahn, M. and Helinski, D.R.: Construction of a novel plasmid-phage hybrid: Use of the hybrid to demonstrate ColEI DNA replication in vivo in the absence of a ColE1!specified protein. Proc. Natl. Acad. Sci. USA 75 (1978) 12200-2204. Lindahl, G.: Genetic map of bacteriophage P2. Virology 39 ~(1969) 839-860. Lindqvist, B.H.: Expression of phage transcription in P2 lysogens infected with helper-dependent coliphage P4. Proc. Natl. Aead. Sci. USA 71 (1974) 2752-2755. Lindqvist, B.H.: Recombination between satellite phage P4 and its helper P2, lI. In vitro construction of a helperindependent P4::P2 hybrid phage. Gene 14 (1981) 243250. Lindqvist, B.H. and Six, E.W.: Replication of bacteriophage P4 DNA in a nonlysogenic host. Virology 43 (1971) 17. Maxam, A. and Gilbert, W.: A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74 (1977) 560-564. Murray, K., Isaksson-Forsen, A.G., Challberg, M. and Englund, P.T.: Symmetrical nucleotide sequences in the recognition sites for the ter function of bacteriophages P2, 299 and 186. J. Mol. Biol. 112 (1977) 471-489. Six, E.W.: Helper dependence of satellite bacteriophage P4: Which gene functions of bacteriophage P2 are needed by P4? Virology 67 (1975) 249-263. Six, E.W. and Klug, C.A.C.: Bacteriophage P4: A satellite virus depending on a helper such as prophage P2. Virology 51 (1973) 327--344. Sternberg, N. and Weisberg, R.: Packaging of coliphage lamly da DNA, ll. The role of the gene D protein. J. Mol. Biol. 17 (1977) 733-759. Souza, L., Geisselsoder, J., Hopkins, A.S. and Calender, R.: Physical mapping of the satellite phage P4 genome. Virology 85 (1978) 335-342. Sunshine, M.G., Thorn, M., Gibbs, W., Caiendar, R. and Kelly, B.: P2 phage amber mutants: Characterization by use of polarity suppressors. Virology 46 (1971) 691-702. West66, A., and Ljungqvist, E.: A restriction endonuclease cleavage map of bacteriophage P2. Mol. Gen. Genet. 171 (1979) 91-102. Wang, C.J., Martin, K.V. and Calendar, R.: On the sequence similarity of the cohesive ends of coliphage P4, P2 and 186 deoxyribonucleic acid. Biochemistry 12 (1973) 2119-2123. Westmoreland, B.C., Szybalski, W. and Ris, H.: Mapping of deletions and substitutions in heteroduplex DNA molecules of bacteriophage lambda by electron microscopy. Science, 163 (1969) 1343-1348. Wiman, M., Bertani, G., Kelly, B. and Sasaki, I.: Genetic map of Escherichta coil strain C. Mol. Gen. Genet. 197 (1970) 1-31. Communicated by A.I. Bukhari.